- Email: [email protected]
Genomic Structure and Diversity of the Chicken Mx Gene1
RAPID COMMUNICATION Genomic Structure and Diversity of the Chicken Mx Gene1 X. Y. Li, L. J. Qu, Z. C. Hou, J. F. Yao, G. Y. Xu, and N. Yang2 Department of Animal Genetics and Breeding, College of Animal Science and Technology, and State Key Laboratory of Agrobiotechnology, China Agricultural University, Beijing 100094, China gene by comparison among 4 directly sequenced Mx genomic DNA sequences, and the reference sequence was inferred from the chicken genome project. The genomic diversity of the chicken Mx gene showed large variation in different regions, with the highest diversity in the 5′ untranslated region and the lowest in the 3′ untranslated region. The genomic structure and variation of sequences gathered here will allow an extensive analysis of the gene function with the aim of improving the antiviral resistance activities of chickens.
Key words: chicken, DNA sequence, genomic structure, Mx gene, variation 2007 Poultry Science 86:786–789
phisms and differential antiviral activities of the chicken Mx gene in 15 breeds in which a specific amino substitution at position 631 (Ser to Asn) was found to determine differential antiviral activities in vitro. The substitution also showed skewed allele frequencies in different chicken populations, with a much higher frequency of the favorable allele A in native breeds than in highly selected lines (Li et al., 2006). However, the genomic structure of the gene, including the intron and control regions, remains unknown. Knowledge of the genomic sequence of the chicken Mx gene will facilitate further functional genomic and transgenic studies. The objective of the present study was to determine the genomic structure and diversity of the chicken Mx gene.
INTRODUCTION The Mx protein confers resistance activity to orthomyxovirus infection and has been found in many organisms, including yeast (Rothman et al., 1990) and vertebrates ranging from fish to humans (Staeheli et al., 1989; Staeheli, 1990; Pavlovic et al., 1991; Bazzigher et al., 1993; Plant and Thune, 2004). As an interferon (IFN)-associated protein, it contains conserved tripartite guanosine triphosphate binding sites and a Leu zipper (Horisberger et al., 1990; Melen et al., 1992; Pitossi et al., 1993). Various Mx proteins differ widely with respect to intracellular distribution and biological activities (Bernasconi et al., 1995). Isolation of cDNA and an IFN-inducible promoter of the Mx gene have been reported in the chicken (Schumacher et al., 1994; Bernasconi et al., 1995). The chicken Mx protein is a predominantly cytoplasmic form and consists of 705 amino acids (Bernasconi et al., 1995). Yang et al. (2006) reported expression of the Mx protein in high and low egg production chicken strains. Recent outbreaks of avian influenza in many parts of the world have drawn worldwide attention to the prevention of the disease. Ko et al. (2002) reported polymor-
MATERIALS AND METHODS A BLAT search (http://genome.ucsc.edu/) using chicken Mx cDNA (accession no. Z23168) resulted in the genomic DNA sequence of the Mx gene for the Red Jungle Fowl (International Chicken Genome Sequencing Consortium, 2004), which was designated as the reference sequence of the Mx gene. Sixteen pairs of PCR primers were designed to amplify the genomic DNA sequence of the Mx gene using Primer 3.0 software (Rozen and Skalesky, 2000; Table 1). Each amplifying segment was about 1,500 bp, except the 16th segment, which was about 500 bp. An overlapping sequence existed in the length of 150 to 200 bp between 2 adjacent amplified segments. The chicken genomic DNA was extracted using the phenol-chloroform method from the fresh blood of a Silkie, a White Leghorn, and 2 Rhode Island Red individuals
©2007 Poultry Science Association Inc. Received November 8, 2006. Accepted December 20, 2006. 1 The genomic sequences for the Mx gene of a Silkie, a White Leghorn, and 2 Rhode Island Red chickens were deposited at GenBank under accession nos. DQ788614, DQ788615, DQ788613, and DQ788616, respectively. 2 Corresponding author: [email protected]
786
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
ABSTRACT The Mx protein, which confers resistance to orthomyxovirus, has been detected in several organisms, and one nonsynonymous substitution (S631N) of the chicken Mx protein has been shown to affect resistant activities to the avian influenza virus in vitro. In the current study, the genomic sequence and polymorphism of the chicken Mx gene are reported. The full length of the chicken Mx gene spans about 21 kb, with 13 exons on chromosome 1 of the chicken genome. A total of 237 single nucleotide polymorphisms were found in the chicken Mx
STRUCTURE AND DIVERSITY OF THE Mx GENE Table 1. Primers for PCR amplification
787
1
Forward primers
Reverse primers
MxF1 MxF2 MxF3 MxF4 MxF5 MxF6 MxF7 MxF8 MxF9 MxF10 MxF11 MxF12 MxF13 MxF14 MxF15 MxF16
AAAAGGAAAGGGGCTGTTGCTC CTCCCAGAGAAGTGAAGCTAGG AGACTCTGGTTTCAGCACTTCC GTGACAGGTGTTTGAGCACAGT AACATCATTGAATGGGAATCCT ATTGATCTTGTTGACAGCCTGA CTACAAAAGCTCAGGCTGTGTG ACGTTAATGGCTGGGTCTAAAA GACATATCATGTGGTGGCTTGT AGATTTTGGTCAAGCATTGGAG CAGCTGTGTTCAGCCTACCTAA GTCTTTGATGCACGTCTTTGTC CCTGACTTTGTTTTGTCTGTCTG CCAAAAGGTGAGAAAGCATCAT CTTCTTCCCTTCAGCCTCAAAT GCCTACCAATACCTGGTAGACTTT
CCATCCCACAAGAAACCTCTGG TTTTGTATTTACCAGGGGCATC ACTGAAGAAAACAATTCCATCTG TCCAACCTTAATGATTGCATGA GGTGAAAACCTGAGAAGGTGAG TGACATCATGAACCACTTAGGG TGGAAAGAGGAAAGCAATGAAT AGCAAATGCTTGCATGTAGGA ACCATATCCCTTAGTGCAGCAT GGGTGTGTGCTTTGTGTGTACT TGGACAGGACATGAGAAACAAC ATTAGCAAAACGCTTGTTAGCC GTGGCAGCAGTACTGATAGGAG ATGCCCTGGTATTTGGTTACTG TGCTAGAAAGCAAAAGCAGAAA GCTCCCCCTCCTTTCAAATA
1
Primer sequences are shown from 5′ to 3′.
(Sambrook and Russell, 2001). The PCR amplification was performed in 15 L using 50 ng of genomic DNA, 1.5 L of 10× PCR buffer, 1.5 mM MgCl2, 10 pmol of primers, 0.2 mM deoxyribonucleotide triphosphate, and 0.5 U of proofreading Taq DNA polymerase (Dingguo, Beijing, China). The following cycling protocol was used: 94°C for 5 min, followed by 35 cycles of 45 s at 94°C, annealing temperature for 45 s, and 72°C for 1 min, and a final extension step at 72°C for 10 min. The PCR products were checked by electrophoresis in 0.8% agarose gel and purified with the Qiaquick DNA purification kit (Qiagene, Hilden, Germany). The purified PCR products were sequenced using a straightforward “walking” technique and Big Dye Terminator v3.1 reagents on an Applied Biosystems 3730 DNA analyzer (ABI, Tokyo, Japan) by the dideoxy-mediated chain-termination method (Sanger et al., 1997). All sequencing primers are listed in Table 2. The sequencing results were checked and aligned into the full genomic sequence of the chicken Mx gene with DNAMAN 4.0 software (Lynnon Biosoft, Quebec, Canada). Alignment of the Mx genomic DNA sequence with the cDNA sequence was performed to obtain the genomic organization of the chicken Mx gene. The variation among 5 sequences of the chicken Mx gene, including 4 directly
sequenced sequences and 1 reference sequence, was estimated using the Dnasp 4.0 program (Rozas et al., 2003). The diversity of exon, intron, 5′ untranslated region (UTR), 3′-UTR, promoter, synomynous, and nonsynomynous sites in the gene was analyzed and compared.
RESULTS AND DISCUSSION The sequences of the 16 PCR products of each of 4 individuals were shown in high quality, and the length of the full genomic DNA sequences of the Mx gene for 1 Silkie, 1 White Leghorn, and 2 Rhode Island Red individuals were 21,258, 21,289, 21,292, and 21,281 bp, respectively, whereas the deduced Mx gene for the Red Jungle Fowl spanned 21,207 bp on chromosome 1 of the chicken genome. These 4 directly sequenced data were deposited at GenBank under accession numbers DQ788614, DQ788615, DQ788613, and DQ788616, respectively. The genomic organization of the Mx gene for the White Leghorn is illustrated in Figure 1. The coding sequence of the chicken Mx gene, consisting of 13 exons, was 2,118 bp encoding the Mx protein with 705 amino acids, which was identical to the results of previous studies (Bernasconi et al., 1995; Ko et al., 2002). The length of each exon
Figure 1. Genomic organization of the chicken Mx gene. CDS = coding sequence; the number in CDS = the length of each exon; ISRE = interferonstimulated response element; UTR = untranslated region.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
Primer no.
788
LI ET AL. Table 2. Primers for the sequencing of different amplified fragments1 Primer sequences
Primer no.
Primer sequence
01S1 01S2 01S3 02S1 02S2 02S3 03S1 03S2 03S3 04S1 04S2 04S3 05S1 05S2 05S3 06S1 06S2 06S3 07S1 07S2 07S3 08S1 08S2 08S3
CCTCCTCTGGACAGACTCCA GCATGGTTCAAATTGAGGTTG CATGGGTTAAAACCTCCAGTTC CAAACAACGAACCTGAAAACAG TCAACCAAAGAACAGGCTCA TTGATTGCTCCTTGAACTGC TCCTCATCCTCCAGCTGTATC TCAAACAACACCTGCATGAT TCGCTCTTTCGCTCTCTCTC TGCCATGGGGTATTCTCAGT AGGGGGAATGAGAGAGTGGT TAGGCTGCAGCAATCAGATG AAATCCCAGCCATTCTCAAG CCTCCTTTCAGGTGGCTGTA CTTTTCACCTTTCAGGACAGC ACGTTCAAGGCATGTGTTTG TCGCCAGCAAAATGTATTGA CCCAGTCCACTCACACAATG AGAGGCCAACCTCTACCTCAC GCTTTGAAGAGTCTGGAGCAC TGGCTGATCTGTCAACCTCA CAAGACCATCTATCTGCAAAGC TCTTTCCTTGTTGTGCAGGA GGCTTTCATTCCAGCAGTGT
09S1 09S2 09S3 10S1 10S2 10S3 11S1 11S2 11S3 12S1 12S2 12S3 13S1 13S2 13S3 14S1 14S2 14S3 15S1 15S2 15S3 16S1 16S2
TGAAGGTGGAAGAGATGCAG AAAGGTTTGCAAGGCAAAAG AGGGAGGTGTTCCTGCCTAT TGAAAGGAAGAAGGGTTGGA GGCATACTTCCCACAAGCAG TTCAAAAATCTCAAGGAAGAGC TCCTTTCCATGCATTGTCTG AGAGCAAAGCAACCAAGAGC ACTGGCTTCTGGCAGAGAAT ATCAGGCACACCAATGTCAC TTGCCCAAATATGAAGACCA GCCAGTTCTTTGCATAATGG TCACTCCAAAAACTGGACACC GGGTAGCCTCAGAGCACAAT TGGAGTCAGGATCCTTCCAG TGTGTAGATGTTATCCTGGCAGT GAAAACTGCATCCGCTTCAC TGCTCCAGTAAAAGAGCTGTC TCCTTGGAAGTCAGCCCTTA GTGGCCTGTATGGGAACTGT ACAGCTGACAATCCCATAAATC CAAAACTACCTACCTCAGAGCTCAA TTCTGCTTTTGCTTTCTAGCATT
1
Primer sequences are shown from 5′ to 3′. The first 2 numbers indicate amplified fragments. S = sequencing primer.
2
from the 5′ to the 3′ end was 237, 193, 138, 155, 139, 199, 79, 123, 142, 159, 77, 243, and 234 bp, respectively. The 5′-UTR was 140 bp but was separated by an inserted fragment of 664 bp into 2 parts, which were 48 and 92 bp, respectively. The 3′-UTR was 288 bp with a poly (A) signal at the end. The length of the promoter was 215 bp and included an IFN-stimulated response element. The genomic organization of the Mx gene for the other 3 individuals and Red Jungle Fowl were the same as that of the White Leghorn. In total, 237 mutation sites, including 24 singleton variable sites and 213 parsimony informative sites, were identified among 4 directly sequenced Mx genomic DNA sequences and the reference sequence. Two hundred five polymorphic sites were found in introns of the chicken Mx gene. The nucleotide diversity (π value) of the promoter, 5′-UTR, coding sequences, synonymous sites, nonsynonymous sites, intron, and 3′-UTR were distinctly different from each other, in a descending order of 5′-UTR (0.01032) > promoter (0.01003) > synonymous sites (0.0080) > intron (0.00472) > overall (0.00465) > coding sequences (0.00378) > nonsynonymous sites (0.00256) > 3′-UTR (0.00216; Figure 2). The reason for high polymorphism in the promoter of the chicken Mx gene could be the balanced selection on the promoter, which maintains polymorphism in this region because of the interaction between pathogens and disease-related genes or corresponding regions. Six polymorphic sites were identified in the promoter and 1 mutation of G > A existed in the IFN-stimulated response element. A 31-bp insertion-deletion polymorphism was found in the 3′-UTR for the Red Jungle Fowl and confirmed in some individuals of other breeds (Figure 3). In the coding sequence, the diversity for the beginning part, from the first to the fourth exon,
was the highest (0.0040), and that of the middle part, from the fifth to ninth exon, was the lowest (0.0030), whereas that of the last part, from the 10th to the 13th exon, was in the middle (0.0036). The Mx S631N mutation site, with potential resistance to the influenza virus as reported by Ko et al. (2002), was located in the last exon. Four chicken Mx gene sequences were gathered by direct sequencing, and the polymorphisms were analyzed in the current study. Measures of reducing sequencing errors, such as using proofreading Taq polymerase, an overlapping sequence between adjacent amplified fragments, and double-checking the sequencing maps, espe-
Figure 2. Nucleotide diversity of different parts of the chicken Mx gene. π = nucleotide diversity; UTR = untranslated region.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
Primer no.2
STRUCTURE AND DIVERSITY OF THE Mx GENE
789
Figure 3. The insert-deletion polymorphism (INDEL) mutation in the 3′ untranslated region of the chicken Mx gene. RIR = Rhode Island Red; SK = Silkie; WL = White Leghorn; and RJF = Red Jungle Fowl.
ACKNOWLEDGMENTS The current research was supported by grants from the National Basic Research Program of China (no. 2006CB102102) and the National Natural Science Foundation of China (no. 30500357).
REFERENCES Bernasconi, D., U. Schultz, and P. Staeheli. 1995. The interferoninduced Mx protein of chickens lacks antiviral activity. J. Interferon Cytokine Res. 15:47–53. Bazzigher, L., A. Schwarz, and P. Staeheli. 1993. No enhanced influenza virus resistance of murine and avian cells expressing cloned duck Mx protein. Virology 195:100–112. Horisberger, M. A., G. K. McMaster, H. Zeller, M. G. Wathelet, J. Dellis, and J. Content. 1990. Cloning and sequence analyses of cDNAs for interferon- and virus-induced human Mx proteins reveal that they contain putative guanine nucleotidebinding sites: Functional study of the corresponding gene promoter. J. Virol. 64:1171–1181. International Chicken Genome Sequencing Consortium. 2004. Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 432:695–716. Ko, J. H., H. K. Jin, A. Asano, A. Takada, A. Ninomiya, H. Kida, H. Hokiyama, M. Ohara, M. Tsuzuki, M. Nishibori, M. Mizutani, and T. Watanabe. 2002. Polymorphisms and the differential antiviral activity of the chicken Mx gene. Genome Res. 12:595–601.
Li, X. Y., L. J. Qu, J. F. Yao, and N. Yang. 2006. Skewed allele frequencies of an Mx gene mutation with potential resistance to avian influenza virus in different chicken populations. Poult. Sci. 85:1327–1329. Melen, K., T. Ronni, B. Broni, R. M. Krug, C. H. Von Bonsdorff, and I. Julkunen. 1992. Interferon-induced Mx proteins form oligomers and contain a putative leucine zipper. J. Biol. Chem. 267:25898–25907. Pavlovic, J., T. Zurcher, O. Haller, and P. Staeheli. 1990. Resistance to influenza virus and vesicular stomatitis virus conferred by expression of human MxA protein. J. Virol. 64:3370–3375. Pitossi, F., A. Blank, A. Schroder, A. Schwarz, P. Hussi, M. Schwemmle, J. Pavlovic, and P. Staeheli. 1993. A functional GTP-binding motif is necessary for antiviral activity of Mx proteins. J. Virol. 67:6726–6732. Plant, K. P., and R. L. Thune. 2004. Cloning and characterisation of a channel catfish Ictalurus punctatus Mx gene. Fish Shellfish Immunol. 16:391–405. Rothman, J. H., C. K. Raymond, T. Gillbert, P. J. O’Hara, and T. H. Stevens. 1990. A putative GTP binding protein homologous to interferon-inducible Mx proteins performs an essential function in yeast protein sorting. Cell 61:1063–1074. Rozas, J., J. C. Sa´chez-DelBarrio, X. Messeguer, and R. Rozas. 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19:2496–2497. Rozen, S., and H. J. Skaletsky. 2000 Primer3 on the WWW for general users and for biologist programmers. Pages 365– 386 in Bioinformatics Methods and Protocols: Methods in Molecular Biology. S. Krawetz and S. Misener, ed. Humana Press, Totowa, NJ. Sambrook, J., and D. W. Russell. 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Woodbury, NY. Sanger, F., S. Nicklen, and A. R. Coulson. 1997. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467. Schumacher, B., D. Bernasconi, U. Schultz, and P. Staeheli. 1994. The chicken Mx promoter contains an ISRE motif and confers interferon inducibility to a reporter gene in chick and monkey cells. Virology 203:144–148. Staeheli, P. 1990. Interferon-induced proteins and the antiviral state. Adv. Virus Res. 38:147–200. Staeheli, P., Y. X. Yu, and R. Grob. 1989. A double-stranded RNA-inducible fish gene homologous to the murine influenza virus resistance gene Mx. Mol. Cell. Biol. 9:3117–3121. Yang, K. T., C. Y. Lin, J. S. Liou, Y. H. Fan, S. H. Chiou, C. W. Huang, C. P. Wu, E. C. Lin, C. F. Chen, Y. P. Lee, W. C. Lee, S. T. Ding, W. T. K. Cheng, and M. C. Huang. 2006. Differentially expressed transcripts in shell glands from low and high egg production strains of chickens using cDNA microarrays. Anim. Reprod. Sci., doi:10.1016/j.anireprosci. 2006.09.004.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
cially for the polymorphic sites, improved the quality of the sequencing results. The sequencing results also confirmed the reference sequence inferred from the chicken genomic sequences in the chicken genome project (http://www.ncbi.nlm.nih.gov/genome/guide/ chicken). Most of the variation sites reported in other studies (Ko et al., 2002) were detected in the current study and some new ones were discovered. The length of the coding sequences of all chicken Mx genes revealed in the current and previous studies were identical (2,118 bp). The difference in the length of the full genomic sequence of the chicken Mx gene resulted mainly from variations in the introns and the control regions. The promoter and the 3′-UTR should play a crucial role in transcription and translation. Further experiments should be directed toward the function of these variable sites, especially the G > A substitution in the promoter and 31-bp insertiondeletion polymorphism in the 3′-UTR.
Key words: chicken, DNA sequence, genomic structure, Mx gene, variation 2007 Poultry Science 86:786–789
phisms and differential antiviral activities of the chicken Mx gene in 15 breeds in which a specific amino substitution at position 631 (Ser to Asn) was found to determine differential antiviral activities in vitro. The substitution also showed skewed allele frequencies in different chicken populations, with a much higher frequency of the favorable allele A in native breeds than in highly selected lines (Li et al., 2006). However, the genomic structure of the gene, including the intron and control regions, remains unknown. Knowledge of the genomic sequence of the chicken Mx gene will facilitate further functional genomic and transgenic studies. The objective of the present study was to determine the genomic structure and diversity of the chicken Mx gene.
INTRODUCTION The Mx protein confers resistance activity to orthomyxovirus infection and has been found in many organisms, including yeast (Rothman et al., 1990) and vertebrates ranging from fish to humans (Staeheli et al., 1989; Staeheli, 1990; Pavlovic et al., 1991; Bazzigher et al., 1993; Plant and Thune, 2004). As an interferon (IFN)-associated protein, it contains conserved tripartite guanosine triphosphate binding sites and a Leu zipper (Horisberger et al., 1990; Melen et al., 1992; Pitossi et al., 1993). Various Mx proteins differ widely with respect to intracellular distribution and biological activities (Bernasconi et al., 1995). Isolation of cDNA and an IFN-inducible promoter of the Mx gene have been reported in the chicken (Schumacher et al., 1994; Bernasconi et al., 1995). The chicken Mx protein is a predominantly cytoplasmic form and consists of 705 amino acids (Bernasconi et al., 1995). Yang et al. (2006) reported expression of the Mx protein in high and low egg production chicken strains. Recent outbreaks of avian influenza in many parts of the world have drawn worldwide attention to the prevention of the disease. Ko et al. (2002) reported polymor-
MATERIALS AND METHODS A BLAT search (http://genome.ucsc.edu/) using chicken Mx cDNA (accession no. Z23168) resulted in the genomic DNA sequence of the Mx gene for the Red Jungle Fowl (International Chicken Genome Sequencing Consortium, 2004), which was designated as the reference sequence of the Mx gene. Sixteen pairs of PCR primers were designed to amplify the genomic DNA sequence of the Mx gene using Primer 3.0 software (Rozen and Skalesky, 2000; Table 1). Each amplifying segment was about 1,500 bp, except the 16th segment, which was about 500 bp. An overlapping sequence existed in the length of 150 to 200 bp between 2 adjacent amplified segments. The chicken genomic DNA was extracted using the phenol-chloroform method from the fresh blood of a Silkie, a White Leghorn, and 2 Rhode Island Red individuals
©2007 Poultry Science Association Inc. Received November 8, 2006. Accepted December 20, 2006. 1 The genomic sequences for the Mx gene of a Silkie, a White Leghorn, and 2 Rhode Island Red chickens were deposited at GenBank under accession nos. DQ788614, DQ788615, DQ788613, and DQ788616, respectively. 2 Corresponding author: [email protected]
786
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
ABSTRACT The Mx protein, which confers resistance to orthomyxovirus, has been detected in several organisms, and one nonsynonymous substitution (S631N) of the chicken Mx protein has been shown to affect resistant activities to the avian influenza virus in vitro. In the current study, the genomic sequence and polymorphism of the chicken Mx gene are reported. The full length of the chicken Mx gene spans about 21 kb, with 13 exons on chromosome 1 of the chicken genome. A total of 237 single nucleotide polymorphisms were found in the chicken Mx
STRUCTURE AND DIVERSITY OF THE Mx GENE Table 1. Primers for PCR amplification
787
1
Forward primers
Reverse primers
MxF1 MxF2 MxF3 MxF4 MxF5 MxF6 MxF7 MxF8 MxF9 MxF10 MxF11 MxF12 MxF13 MxF14 MxF15 MxF16
AAAAGGAAAGGGGCTGTTGCTC CTCCCAGAGAAGTGAAGCTAGG AGACTCTGGTTTCAGCACTTCC GTGACAGGTGTTTGAGCACAGT AACATCATTGAATGGGAATCCT ATTGATCTTGTTGACAGCCTGA CTACAAAAGCTCAGGCTGTGTG ACGTTAATGGCTGGGTCTAAAA GACATATCATGTGGTGGCTTGT AGATTTTGGTCAAGCATTGGAG CAGCTGTGTTCAGCCTACCTAA GTCTTTGATGCACGTCTTTGTC CCTGACTTTGTTTTGTCTGTCTG CCAAAAGGTGAGAAAGCATCAT CTTCTTCCCTTCAGCCTCAAAT GCCTACCAATACCTGGTAGACTTT
CCATCCCACAAGAAACCTCTGG TTTTGTATTTACCAGGGGCATC ACTGAAGAAAACAATTCCATCTG TCCAACCTTAATGATTGCATGA GGTGAAAACCTGAGAAGGTGAG TGACATCATGAACCACTTAGGG TGGAAAGAGGAAAGCAATGAAT AGCAAATGCTTGCATGTAGGA ACCATATCCCTTAGTGCAGCAT GGGTGTGTGCTTTGTGTGTACT TGGACAGGACATGAGAAACAAC ATTAGCAAAACGCTTGTTAGCC GTGGCAGCAGTACTGATAGGAG ATGCCCTGGTATTTGGTTACTG TGCTAGAAAGCAAAAGCAGAAA GCTCCCCCTCCTTTCAAATA
1
Primer sequences are shown from 5′ to 3′.
(Sambrook and Russell, 2001). The PCR amplification was performed in 15 L using 50 ng of genomic DNA, 1.5 L of 10× PCR buffer, 1.5 mM MgCl2, 10 pmol of primers, 0.2 mM deoxyribonucleotide triphosphate, and 0.5 U of proofreading Taq DNA polymerase (Dingguo, Beijing, China). The following cycling protocol was used: 94°C for 5 min, followed by 35 cycles of 45 s at 94°C, annealing temperature for 45 s, and 72°C for 1 min, and a final extension step at 72°C for 10 min. The PCR products were checked by electrophoresis in 0.8% agarose gel and purified with the Qiaquick DNA purification kit (Qiagene, Hilden, Germany). The purified PCR products were sequenced using a straightforward “walking” technique and Big Dye Terminator v3.1 reagents on an Applied Biosystems 3730 DNA analyzer (ABI, Tokyo, Japan) by the dideoxy-mediated chain-termination method (Sanger et al., 1997). All sequencing primers are listed in Table 2. The sequencing results were checked and aligned into the full genomic sequence of the chicken Mx gene with DNAMAN 4.0 software (Lynnon Biosoft, Quebec, Canada). Alignment of the Mx genomic DNA sequence with the cDNA sequence was performed to obtain the genomic organization of the chicken Mx gene. The variation among 5 sequences of the chicken Mx gene, including 4 directly
sequenced sequences and 1 reference sequence, was estimated using the Dnasp 4.0 program (Rozas et al., 2003). The diversity of exon, intron, 5′ untranslated region (UTR), 3′-UTR, promoter, synomynous, and nonsynomynous sites in the gene was analyzed and compared.
RESULTS AND DISCUSSION The sequences of the 16 PCR products of each of 4 individuals were shown in high quality, and the length of the full genomic DNA sequences of the Mx gene for 1 Silkie, 1 White Leghorn, and 2 Rhode Island Red individuals were 21,258, 21,289, 21,292, and 21,281 bp, respectively, whereas the deduced Mx gene for the Red Jungle Fowl spanned 21,207 bp on chromosome 1 of the chicken genome. These 4 directly sequenced data were deposited at GenBank under accession numbers DQ788614, DQ788615, DQ788613, and DQ788616, respectively. The genomic organization of the Mx gene for the White Leghorn is illustrated in Figure 1. The coding sequence of the chicken Mx gene, consisting of 13 exons, was 2,118 bp encoding the Mx protein with 705 amino acids, which was identical to the results of previous studies (Bernasconi et al., 1995; Ko et al., 2002). The length of each exon
Figure 1. Genomic organization of the chicken Mx gene. CDS = coding sequence; the number in CDS = the length of each exon; ISRE = interferonstimulated response element; UTR = untranslated region.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
Primer no.
788
LI ET AL. Table 2. Primers for the sequencing of different amplified fragments1 Primer sequences
Primer no.
Primer sequence
01S1 01S2 01S3 02S1 02S2 02S3 03S1 03S2 03S3 04S1 04S2 04S3 05S1 05S2 05S3 06S1 06S2 06S3 07S1 07S2 07S3 08S1 08S2 08S3
CCTCCTCTGGACAGACTCCA GCATGGTTCAAATTGAGGTTG CATGGGTTAAAACCTCCAGTTC CAAACAACGAACCTGAAAACAG TCAACCAAAGAACAGGCTCA TTGATTGCTCCTTGAACTGC TCCTCATCCTCCAGCTGTATC TCAAACAACACCTGCATGAT TCGCTCTTTCGCTCTCTCTC TGCCATGGGGTATTCTCAGT AGGGGGAATGAGAGAGTGGT TAGGCTGCAGCAATCAGATG AAATCCCAGCCATTCTCAAG CCTCCTTTCAGGTGGCTGTA CTTTTCACCTTTCAGGACAGC ACGTTCAAGGCATGTGTTTG TCGCCAGCAAAATGTATTGA CCCAGTCCACTCACACAATG AGAGGCCAACCTCTACCTCAC GCTTTGAAGAGTCTGGAGCAC TGGCTGATCTGTCAACCTCA CAAGACCATCTATCTGCAAAGC TCTTTCCTTGTTGTGCAGGA GGCTTTCATTCCAGCAGTGT
09S1 09S2 09S3 10S1 10S2 10S3 11S1 11S2 11S3 12S1 12S2 12S3 13S1 13S2 13S3 14S1 14S2 14S3 15S1 15S2 15S3 16S1 16S2
TGAAGGTGGAAGAGATGCAG AAAGGTTTGCAAGGCAAAAG AGGGAGGTGTTCCTGCCTAT TGAAAGGAAGAAGGGTTGGA GGCATACTTCCCACAAGCAG TTCAAAAATCTCAAGGAAGAGC TCCTTTCCATGCATTGTCTG AGAGCAAAGCAACCAAGAGC ACTGGCTTCTGGCAGAGAAT ATCAGGCACACCAATGTCAC TTGCCCAAATATGAAGACCA GCCAGTTCTTTGCATAATGG TCACTCCAAAAACTGGACACC GGGTAGCCTCAGAGCACAAT TGGAGTCAGGATCCTTCCAG TGTGTAGATGTTATCCTGGCAGT GAAAACTGCATCCGCTTCAC TGCTCCAGTAAAAGAGCTGTC TCCTTGGAAGTCAGCCCTTA GTGGCCTGTATGGGAACTGT ACAGCTGACAATCCCATAAATC CAAAACTACCTACCTCAGAGCTCAA TTCTGCTTTTGCTTTCTAGCATT
1
Primer sequences are shown from 5′ to 3′. The first 2 numbers indicate amplified fragments. S = sequencing primer.
2
from the 5′ to the 3′ end was 237, 193, 138, 155, 139, 199, 79, 123, 142, 159, 77, 243, and 234 bp, respectively. The 5′-UTR was 140 bp but was separated by an inserted fragment of 664 bp into 2 parts, which were 48 and 92 bp, respectively. The 3′-UTR was 288 bp with a poly (A) signal at the end. The length of the promoter was 215 bp and included an IFN-stimulated response element. The genomic organization of the Mx gene for the other 3 individuals and Red Jungle Fowl were the same as that of the White Leghorn. In total, 237 mutation sites, including 24 singleton variable sites and 213 parsimony informative sites, were identified among 4 directly sequenced Mx genomic DNA sequences and the reference sequence. Two hundred five polymorphic sites were found in introns of the chicken Mx gene. The nucleotide diversity (π value) of the promoter, 5′-UTR, coding sequences, synonymous sites, nonsynonymous sites, intron, and 3′-UTR were distinctly different from each other, in a descending order of 5′-UTR (0.01032) > promoter (0.01003) > synonymous sites (0.0080) > intron (0.00472) > overall (0.00465) > coding sequences (0.00378) > nonsynonymous sites (0.00256) > 3′-UTR (0.00216; Figure 2). The reason for high polymorphism in the promoter of the chicken Mx gene could be the balanced selection on the promoter, which maintains polymorphism in this region because of the interaction between pathogens and disease-related genes or corresponding regions. Six polymorphic sites were identified in the promoter and 1 mutation of G > A existed in the IFN-stimulated response element. A 31-bp insertion-deletion polymorphism was found in the 3′-UTR for the Red Jungle Fowl and confirmed in some individuals of other breeds (Figure 3). In the coding sequence, the diversity for the beginning part, from the first to the fourth exon,
was the highest (0.0040), and that of the middle part, from the fifth to ninth exon, was the lowest (0.0030), whereas that of the last part, from the 10th to the 13th exon, was in the middle (0.0036). The Mx S631N mutation site, with potential resistance to the influenza virus as reported by Ko et al. (2002), was located in the last exon. Four chicken Mx gene sequences were gathered by direct sequencing, and the polymorphisms were analyzed in the current study. Measures of reducing sequencing errors, such as using proofreading Taq polymerase, an overlapping sequence between adjacent amplified fragments, and double-checking the sequencing maps, espe-
Figure 2. Nucleotide diversity of different parts of the chicken Mx gene. π = nucleotide diversity; UTR = untranslated region.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
Primer no.2
STRUCTURE AND DIVERSITY OF THE Mx GENE
789
Figure 3. The insert-deletion polymorphism (INDEL) mutation in the 3′ untranslated region of the chicken Mx gene. RIR = Rhode Island Red; SK = Silkie; WL = White Leghorn; and RJF = Red Jungle Fowl.
ACKNOWLEDGMENTS The current research was supported by grants from the National Basic Research Program of China (no. 2006CB102102) and the National Natural Science Foundation of China (no. 30500357).
REFERENCES Bernasconi, D., U. Schultz, and P. Staeheli. 1995. The interferoninduced Mx protein of chickens lacks antiviral activity. J. Interferon Cytokine Res. 15:47–53. Bazzigher, L., A. Schwarz, and P. Staeheli. 1993. No enhanced influenza virus resistance of murine and avian cells expressing cloned duck Mx protein. Virology 195:100–112. Horisberger, M. A., G. K. McMaster, H. Zeller, M. G. Wathelet, J. Dellis, and J. Content. 1990. Cloning and sequence analyses of cDNAs for interferon- and virus-induced human Mx proteins reveal that they contain putative guanine nucleotidebinding sites: Functional study of the corresponding gene promoter. J. Virol. 64:1171–1181. International Chicken Genome Sequencing Consortium. 2004. Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 432:695–716. Ko, J. H., H. K. Jin, A. Asano, A. Takada, A. Ninomiya, H. Kida, H. Hokiyama, M. Ohara, M. Tsuzuki, M. Nishibori, M. Mizutani, and T. Watanabe. 2002. Polymorphisms and the differential antiviral activity of the chicken Mx gene. Genome Res. 12:595–601.
Li, X. Y., L. J. Qu, J. F. Yao, and N. Yang. 2006. Skewed allele frequencies of an Mx gene mutation with potential resistance to avian influenza virus in different chicken populations. Poult. Sci. 85:1327–1329. Melen, K., T. Ronni, B. Broni, R. M. Krug, C. H. Von Bonsdorff, and I. Julkunen. 1992. Interferon-induced Mx proteins form oligomers and contain a putative leucine zipper. J. Biol. Chem. 267:25898–25907. Pavlovic, J., T. Zurcher, O. Haller, and P. Staeheli. 1990. Resistance to influenza virus and vesicular stomatitis virus conferred by expression of human MxA protein. J. Virol. 64:3370–3375. Pitossi, F., A. Blank, A. Schroder, A. Schwarz, P. Hussi, M. Schwemmle, J. Pavlovic, and P. Staeheli. 1993. A functional GTP-binding motif is necessary for antiviral activity of Mx proteins. J. Virol. 67:6726–6732. Plant, K. P., and R. L. Thune. 2004. Cloning and characterisation of a channel catfish Ictalurus punctatus Mx gene. Fish Shellfish Immunol. 16:391–405. Rothman, J. H., C. K. Raymond, T. Gillbert, P. J. O’Hara, and T. H. Stevens. 1990. A putative GTP binding protein homologous to interferon-inducible Mx proteins performs an essential function in yeast protein sorting. Cell 61:1063–1074. Rozas, J., J. C. Sa´chez-DelBarrio, X. Messeguer, and R. Rozas. 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19:2496–2497. Rozen, S., and H. J. Skaletsky. 2000 Primer3 on the WWW for general users and for biologist programmers. Pages 365– 386 in Bioinformatics Methods and Protocols: Methods in Molecular Biology. S. Krawetz and S. Misener, ed. Humana Press, Totowa, NJ. Sambrook, J., and D. W. Russell. 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Woodbury, NY. Sanger, F., S. Nicklen, and A. R. Coulson. 1997. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467. Schumacher, B., D. Bernasconi, U. Schultz, and P. Staeheli. 1994. The chicken Mx promoter contains an ISRE motif and confers interferon inducibility to a reporter gene in chick and monkey cells. Virology 203:144–148. Staeheli, P. 1990. Interferon-induced proteins and the antiviral state. Adv. Virus Res. 38:147–200. Staeheli, P., Y. X. Yu, and R. Grob. 1989. A double-stranded RNA-inducible fish gene homologous to the murine influenza virus resistance gene Mx. Mol. Cell. Biol. 9:3117–3121. Yang, K. T., C. Y. Lin, J. S. Liou, Y. H. Fan, S. H. Chiou, C. W. Huang, C. P. Wu, E. C. Lin, C. F. Chen, Y. P. Lee, W. C. Lee, S. T. Ding, W. T. K. Cheng, and M. C. Huang. 2006. Differentially expressed transcripts in shell glands from low and high egg production strains of chickens using cDNA microarrays. Anim. Reprod. Sci., doi:10.1016/j.anireprosci. 2006.09.004.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
cially for the polymorphic sites, improved the quality of the sequencing results. The sequencing results also confirmed the reference sequence inferred from the chicken genomic sequences in the chicken genome project (http://www.ncbi.nlm.nih.gov/genome/guide/ chicken). Most of the variation sites reported in other studies (Ko et al., 2002) were detected in the current study and some new ones were discovered. The length of the coding sequences of all chicken Mx genes revealed in the current and previous studies were identical (2,118 bp). The difference in the length of the full genomic sequence of the chicken Mx gene resulted mainly from variations in the introns and the control regions. The promoter and the 3′-UTR should play a crucial role in transcription and translation. Further experiments should be directed toward the function of these variable sites, especially the G > A substitution in the promoter and 31-bp insertiondeletion polymorphism in the 3′-UTR.