The genomic structure of the chicken ICSBP gene and its transcriptional regulation by chicken interferon

Gene 210 (1998) 265–275

The genomic structure of the chicken ICSBP gene and its transcriptional regulation by chicken interferon E. Dosch a, B. Zo¨ller a, I. Redmann-Mu¨ller a, I. Nanda b, M. Schmid b, A. Viciano-Gofferge a, C. Jungwirth a,* a Institute for Virology and Immunobiology, University of Wu¨rzburg, Versbacherstr. 7, D-97078 Wu¨rzburg, Germany b Institute of Human Genetics, University of Wu¨rzburg, Biozentrum, Am Hubland, D-97074 Wu¨rzburg, Germany Received 7 November 1997; accepted 19 January 1998; Received by A. Sippel

Abstract The chicken interferon consensus sequence binding protein (ChICSBP) gene spans over 9 kb of DNA and consists, as its murine homolog, of nine exons. The first untranslated exon was identified by 5∞-RACE technology. The second exon contains the translation initiation codon. Canonical consensus splice sites are found on every exon/intron junction. The introns are generally smaller than their mammalian counterparts. The ChICSBP and ChIRF-1 genes have been mapped by fluorescence in situ hybridization to different microchromosomes. The transcription start site has been mapped by primer extension. Inspection of the DNA sequence of a genomic clone containing the first exon and the region 1700-bp upstream revealed several potential cisregulatory elements of transcription. The ChICSBP mRNA is induced by recombinant ChIFN type I and ChIFN-c. A palindromic IFN regulatory element (pIRE ) with high sequence homology to c activation site (GAS ) sequences was functionally required in transient transfection assays for the induction of transcription by ChIFN-c. © 1998 Elsevier Science B.V. Keywords: Evolution; Avian; DNA-binding protein; Interferon regulatory factor

1. Introduction The interferon type I system has been highly conserved between mammals and aves which separated in evolution about 270 million years ago (for review see Friedman et al., 1984; Darnell et al., 1994; Tanaka et al., 1992). Functionally active ISREs have been found in promoters of avian and mammalian genes inducible by natural and recombinant IFN type I (Jungwirth et al., 1995; Zo¨ller et al., 1992; Schumacher et al., 1994). cDNAs for proteins belonging to the IRF family have been isolated from chicken and mammalian cells (Jungwirth et al., 1995; Driggers et al., 1990; Marienfeld et al., 1997; Grant et al., 1995; Miyamoto et al., 1988; Harada et al., 1989; Au et al., 1995; Veals et al., 1992). The deduced amino acid sequences of the avian and mammalian * Corresponding author. Tel: +49 931 201 3955. Fax: +49 931 201 2243. Abbreviations: CAT, chloramphenicol acetyltransferase; ChICSBP, chicken interferon consensus sequence binding protein; IFN, interferon; ISRE, IFN-stimulated response element; pIRE, palindromic interferon regulatory element; GAS, c interferon activation site. 0378-1119/98/$19.00 © 1998 Elsevier Science B.V. All rights reserved. PII S 03 7 8 -1 1 1 9 ( 9 8 ) 0 0 0 63 - 8

counterparts show high levels of sequence similarities, particularly in the putative DNA binding domains. ChIFN-c activity is secreted constitutively by chicken T-cell lines (Lowenthal et al., 1995). From this source, cDNAs for ChIFN-c have recently been cloned and expressed (Digby et al., 1996). The existence of IFN-c in the avian realm was thereby established, and it has become possible to compare the sequences which are required for induction by mammalian and ChIFN-c. ChICSBP is a member of the avian IRF family (Jungwirth et al., 1995). The murine ICSBP binds to the ISRE and modulates the transcription of IFNinducible genes by interaction with other members of the IRF family (Driggers et al., 1990; Bovolenta et al., 1994). The murine and human ICSBP gene is preferentially expressed in cells of the immune system, which indicates a specific role in immune regulation. This is also supported by studies with mice with a targeted disruption of the ICSBP gene which showed aberrant development of hematopoietic cells and impaired production of IFN-c (Holtschke et al., 1996). Comparable to the human ICSBP gene, the corresponding chicken gene is induced by ChIFN type I and

266

E. Dosch et al. / Gene 210 (1998) 265–275

ChIFN-c but, in contrast, it is expressed not only in cells of the lymphocyte system but also in fibroblasts ( Weisz et al., 1992; Jungwirth et al., 1995). This could indicate a different function of ChICSBP. An important role of the ICSBP and other members of the mammalian IRF family in the regulation of virus–host cell interaction was indicated by the observation that stable overexpression of the DNA-binding domain of murine ICSBP conveys resistance to Jurkat cells against vaccinia virus and human immuno-deficiency virus type 1 infection (Thornton et al., 1996). In this report we have studied the transcriptional regulation of the ChICSBP gene by ChIFN-c and ChIFN type I. To identify cis-elements involved in the regulation of an avian gene inducible by both types of ChIFN, we have studied the genomic organization of the ChICSBP gene. A DNA region responsible for transcriptional induction by ChIFN-c was identified in the region 5∞ upstream of the ChICSBP promoter by transient transfection assay. The ChICSBP gene was mapped by FISH analysis to a microchromosome different from that carrying the ChIRF-1 gene.

Twenty-four hours after transfection, cells were treated with chicken IFNs for an additional 48 h. Harvesting the cells 24 h after the addition of ChIFN gave similar results. Cell extracts were prepared and the amount of CAT protein determined using the CAT-ELISA kit (Anon., 1995). All assays were done in triplicate. CAT protein induction is given relative to the amount of CAT in untreated cells. Multiple independent transfections gave consistent results. Because cells were transfected in one batch before distribution and treatment of part of the cells with IFN, correction for difference in transfection efficiencies could be avoided (Zo¨ller et al., 1992; Decker et al., 1991) 2.3. Screening methods

2. Materials and methods

106 phages of a chicken genomic library in l FIX II (Stratagene) were plated and screened with ChICSBP cDNA clone labeled with 32P by random priming ( Feinberg et al., 1983). Positive phages were purified by three rounds. Inserts were cloned into Bluescript II SK(−) and sequenced on both strands by the dideoxynucleotide chain termination method using a T7 polymerase kit (Sanger et al., 1977). Sequences were analyzed as described previously (Anon., 1991).

2.1. Cell culture and interferon treatment

2.4. Blot analysis

Primary CEF were prepared by a conventional trypsinization technique and grown in MEM supplemented with 7% newborn calf serum. The permanent chicken fibroblast cell line C32 was cultured in DMEM/8% calf serum/2% chicken serum. Cells were pretreated with recombinant ChIFN type I or ChIFN-c under conditions indicated in the different experiments (Sekellick et al., 1994; Schultz et al., 1995; Digby et al., 1996). The concentration of ChIFN type I is given in i.u./ml. Recombinant ChIFN-c expressed in COS cells is used in a dilution of 1:500.

DNA was prepared from CEF as described and digested with different restriction enzymes (Sambrook et al., 1989). After separating the fragments by agarose gel electrophoresis and blotting, Southern analysis was performed with a ChICSBP cDNA probe labeled with DIG by random priming ( Feinberg et al., 1983). The probe was a mixture of the two ChICSBP inserts of the recombinant l phages, shown in Fig. 1A spanning the whole ChICSBP gene. The 8.3-kb segment was prepared

2.2. Transfection of cells and CAT assay Transfection of the chimeric CAT plasmids containing DNA fragments with putative regulatory cis elements was performed by the calcium phosphate precipitation technique with the modification that the cells were transfected in suspension. Two to 20 mg plasmid DNA were used for transfection. After transfection cells were distributed into three separate wells. Alternatively, cells were transfected by the scrape loading technique (Fechheimer et al., 1987). Cells in 60-mm petri dishes were washed with phosphate buffered saline and incubated with 2 mg plasmid DNA. Five minutes after the cells were transfected they were scraped from the petri dish and allowed to sit for 10 min. The cells were suspended and distributed into three fresh dishes.

Fig. 1. Restriction map of the two overlapping genomic clones representing the ChICSBP gene and exon/intron organization of the chicken ICSBP gene. (A) Two phage inserts covering the whole genomic ICSBP region. Recognition sites of restriction enzymes: E, EcoRI; B, BamHI; H, HindIII. (B) Exons: black boxes; introns: horizontal line between exons. The sequence of the exons was determined by sequencing both strands. Size of introns was deduced by partially sequencing introns and restriction mapping.

E. Dosch et al. / Gene 210 (1998) 265–275

by digestion with SacI; the 6.5-kb segment was isolated by digestion of the recombinant l DNA with XbaI. DIG labeling by random priming and hybridization conditions was according to the manufacturer’s recommendations (Anon., 1995). For Northern analysis RNA was isolated from primary CEF and C32 cells as described previously, separated in 1.2% agarose gels containing formaldehyde and blotted on nylon membranes (Brawerman, 1974). ChICSBP transcripts were detected by hybridization with an antisense riboprobe of ChICSBP labeled with DIG. The RNA probe was prepared from a ChICSBP cDNA containing the complete translated sequence (Jungwirth et al., 1995). The plasmid was linearized with ClaI and transcribed by T7 polymerase using DIG–UTP. The riboprobe lacks the DNA-binding domain of ChICSBP cDNA. The RNA hybridization conditions and detection method were as described previously (Anon., 1995). The hybridization signals were quantified by scanning densitometry and normalized to 18S and 28S rRNA. We reproducibly observed that the 28S rRNA of C32 cells moved faster on formaldehyde containing agarose gels. This difference in electrophoretic mobility was observed using different methods to prepare the RNA. This would indicate that the 28S rRNA from C32 cells is smaller by 100 nt than 28S rRNA from primary CEF. 2.5. Mapping of the transcription start site by primer extension Total RNA was isolated from primary CEF treated with ChIFN-c (1:500) dilution and cycloheximide (150 mg/ml ) for 16 h or left untreated (Brawerman, 1974). Primer extension was carried out as described using 18-mer antisense oligonucleotide primers complementary to region 159+ to +176 (ICS-1) or spanning +262 to +279 (ICS-19) of the ChICSBP cDNA (Jungwirth et al., 1995; Ausubel et al., 1989). 2.6. Amplification of the 5∞ end of ICSBP cDNA by 5∞-RACE (Frohman, 1993) RNAs prepared in the same way as for primer extension analysis were used. Total RNA (1 mg) was hybridized to the antisense primer spanning position +262 to +279 (ICS-19). The first strand was synthesized with reverse transcriptase as recommended by the supplier (GIBCO-BRL). After degradation of the RNA template, aCTP-tailing of the single cDNA-strand was done with terminal transferase. PCR was performed on the cDNA using the adaptor AP-X (GIBCO) and the nested oligomer (ICS-1E ). After cloning into pGEM 4Z vector, the sequence of the amplified product was determined by the dideoxy chain termination method (Sanger et al., 1977).

267

2.6.1. Primers used ICS-1,

GCCTTGAAAATGGAAGCG;

ICS-1E,

GGGGAATTCGCCTTGAAAATGGAAGCG;

ICS-19,

CGTTCCCAACACCGATTT;

AP-X,

AGGCCATCTAGAGACTAGTACGGGIIGGGIIGGGIG.

2.7. Construction of plasmids The standard cloning techniques were carried out as described (Sambrook et al., 1989). Chimeric promoter CAT gene plasmids were constructed by inserting different fragments from the upstream region of the ChICSBP promoter (position −1472 to −42 relative to the transcription initiation site) into CAT enhancer vector pBLCAT2 (Luckow et al., 1987). 2.7.1. p983Sm/A The SmaI–AscI fragment from p16II4S ( Fig. 1) was cloned into GEM4Z restricted with HincII. The fragment was removed with HindII and XbaI and cloned into pBLCAT2. 2.7.2. p452X/B (rev) The BamHI–XhoI fragment from p16II4S ( Fig. 1) was cloned into the pBLCAT2 restricted with BamHI and SalI. 2.7.3. p387P/A The EcoRI–AscI fragment of p16II4S was cloned into the HincII site of pGem4Z (pGem1440). A PstI fragment of the ChICSBP promoter region was deleted by digestion and religation (pGem383). The remaining promoter fragment was removed by digestion with HindIII and XbaI and cloned into pBLCAT2. 2.7.4. p252P/X The XhoI–XbaI fragment of the pGem383 was deleted by restriction and religation. The fragment was cut out by BamHI and HindIII digestion and cloned into pBLCAT2. 2.7.5. p125X/A Starting from pGem1440, a 123-bp fragment was isolated by digestion with XhoI and SmaI. The fragment was cloned into the SalI/SmaI linearized pGem4Z vector. The plasmid was cut with HindIII/XbaI and cloned in pBLCAT2. A fragment spanning position +1874 to +1983 (intron 2) containing a putative ISRE element was also cloned before the herpes tk promoter. A fragment was digested with SapI. The ends were blunted with Klenow polymerase and digested with HindIII. The fragment

268

E. Dosch et al. / Gene 210 (1998) 265–275

was cloned into pGem4Z restricted with HincII and HindIII. The fragment was cut out with HindIII and BamHI and cloned into pBLCAT2. 2.8. Chromosomal assignment FISH analysis was performed on metaphase chromosomes prepared from primary CEF (Lichter et al., 1990). Metaphase spreads were obtained following standard cytogenetic procedures. A recombinant phage clone containing an insert of a 20-kb genomic fragment (for ChISCBP) as well as a cDNA clone consisting of a 1.9-kb length insert for ChIRF-1 were used as DNA probes. The probes were labeled with biotin-16–dUTP by nick translation and labeled DNA was purified using a Sephadex G-50 column. Approximately 200 ng of biotinylated probe was coprecipitated with 20 mg of sonicated salmon sperm DNA, dissolved in 15 ml hybridization mixture [50% formamide, 2×SSC (pH 7.0) and 10% dextransulfate], denatured at 75°C for 10 min and then allowed to hybridize overnight to denatured chromosomes [70% formamide, 2×SSC (pH 7.0) at 70°C ] at 37°C. The post-hybridization washes and probe detection were carried out as described previously (Nanda et al., 1996), with the exception that post-hybridization washing for ChIRF-1 was performed in 2×SSC at 42°C. The slides were mounted with antifade solution containing DAPI and propidium iodide and were examined with a Zeiss Axiophot epifluorescence microscope equipped with appropriate filters. 2.9. Sequence accession numbers The sequence of the 1746-bp fragment of a clone containing the ChICSBP promoter and exon 1 has been deposited in the EMBL data bank (accession No. Y15087).

3. Results 3.1. Isolation of ChICSBP genomic clones and determination of structural organization of the gene A chicken genomic library was screened with a cDNA probe for ChICSBP. The probe includes the coding region from 30 bp downstream from translation start codon to the TGA and 32 bp 3∞-untranslated sequence. Several phages were isolated and characterized by restriction enzyme digestions. Fig. 1A shows the restriction map of two overlapping genomic ChICSBP clones. Clones were partially sequenced using primers designed according to the sequence of the ChICSBP cDNA. The sequence of the coding region of ChICSBP determined previously was confirmed by sequencing all exons on

two strands. The sequence of the untranslated first exon was obtained by the 5∞-RACE technique and shows, in contrast to the translated exons, only low similarity (see Fig. 6A and Kanno et al., 1993) to its murine counterpart. The size of the nine exons is very similar to those of the mouse ICSBP gene ( Fig. 1B and Table 1; Kanno et al., 1993). The size of introns was deduced by partial sequencing and restriction mapping. The calculated sizes of all introns of the avian gene are smaller than in the murine ICSBP gene. The initiation codon was located on exon 2. Table 1 shows sequences at the exon/intron boundaries. Southern blot analysis is consistent with the restriction map of the ChICSBP gene and indicates that the ChICSBP gene is a single copy gene (Fig. 2). 3.2. Chromosomal mapping of ChICSBP- and ChIRF-1 gene Previously we have shown that the ChIRF-2 gene maps to chromosome 4 (Marienfeld et al., 1997). As a basis for understanding the function of the individual members of the ChIRF family, we have mapped the ChICSBP- and ChIRF-1 gene. FISH analysis on at least 30 metaphase spreads with each probe showed recurrent labeling on a pair of microchromosomes (Figs. 3 and 4). The specific signal appeared as doublets reflecting the hybridization of probe to each chromatid of the chromosome. Approximately 80% of metaphases had labeling on both homologous chromosomes. The signal intensity was more pronounced in ChISCBP hybridization than the hybridization with ChIRF-1, which could be due to the significant difference in probe size: the ChISCBP phage clone used was at least 10 times larger than the ChIRF-1 cDNA probe. The location of the signal is confined exclusively to the subtelomeric region on the microchromosomes (Figs. 3c and 4c, d) in both cases. However, the ISCBP signal seems to be on a larger microchromosome that is distinguishable from the microchromosome carrying the ChIRF-1 signal in having a small perceptible short arm ( Fig. 3a’). Thus the chicken ISCBP and IRF-1 genes are assigned to two different microchromosomes. 3.3. The sequence 5∞ upstream of the ChICSBP genomic segment contains a pIRE/GAS element which confers ChIFN-c inducibility to the Herpes simplex virus (HSV) Tk promoter Cis-elements mediating transcriptional regulation by ChIFN type I have been functionally characterized previously in the BF-IV and chicken Mx gene ( Zo¨ller et al., 1992; Schumacher et al., 1994). To see whether the sequence elements needed for transcriptional activation by IFN-c are also conserved in evolution we have functionally characterized the promoter region of the

269

E. Dosch et al. / Gene 210 (1998) 265–275 Table 1 Sequence of exon/intron boundaries of the ChICSBP genea No. and size of exon 1 2 3 4 5 6 7 8 9

(36) (175) (184) (89) (112) (48) (387) (116) (990)

Exon

Intron

Size of intron

GGGGCG..........CGGAAG GATGTG..........TTCAAG GCTTGG..........AGAAAT GCAAAA..........AAGGAG CCTCCT..........GCCCCT CTTTGC..........ATTCGG GCTACT..........TTAGAG AGCTGC..........GTCCAG GTGGAG..........TTTTGT

gtaattag........tctgccccag gtagggtg........tttgctttag gtgagtgc........ctctctgcag gtgagccc........cctgtccag gtaagtag........ctacccacag gtaaggca........tttcttccag gttggtat........ctccttgcag gtatggca........tttggtctag

(1390) (950) (880) (447) (344) (122) (312) (850)

aSequence at the exon/intron boundaries was determined by sequencing both DNA strands.

Fig. 2. Identification of the ChICSBP gene sequence by genomic Southern blot analysis of CEF DNA. Genomic DNA was digested with the restriction enzymes indicated. 12 mg of DNA were used for each digest and the fragments were separated by agarose gel electrophoresis. After blotting, the fragments were detected by hybridization under conditions of high stringency with a DIG-labeled probe prepared from ChICSBP cDNA as decribed in Materials and methods. Size markers: restriction fragments of ChICSBP phage inserts of defined length.

ChICSBP gene. Transcription initiation site was mapped by primer extension. Two different primers complementary to position +262 to +279 or +159 to +176 were used alternatively. Primers were hybridized to total RNA from CEF pretreated with ChIFNs in the presence or absence of cycloheximide to induce ChICSBP mRNA. Fig. 5A shows the primer-extended product of 415 nt in cells pretreated with ChIFNs in the presence of cycloheximide ( lanes 2 and 4). A signal of the same size could also be detected in cells pretreated only with ChIFN-c ( lane 3). Due to the non-quantitative nature of the experiment, the intensity of signals does not reflect the

amount of mRNA in the cells as measured by Northern blot analysis. The signal in cells treated only with ChIFN type I ( lane 1) was not detectable. To confirm the transcription start site of ChIFN-c-induced mRNA primer extension was also carried out using a second primer (ICS-1). A major primer extended product of 215 nt can be detected in RNA from cells treated with ChIFN-c and cycloheximide (Fig. 5B; lane 1). A major transcription initiation site can therefore be identified 37-bp upstream of the translation initiation codon located on exon 2. A computer-assisted inspection of the sequence 1710-bp upstream revealed several cis-acting putative regulatory elements of transcription (Fig. 6A): a putative TATA box (−25/−21); CAAT boxes (−78/−75 and −128/−125) and several GC boxes (−50/−55; −104/−109; −237/−242); NFkB-binding sites (−501/−511 and −958/−967) and a pIRE/GAS (−198/−206) are located in the proximal region of the transcription start site. The putative transcription factor binding sites in the regulatory regions of the chicken and murine ICSBP promoter are compared in Fig. 6B. A highly conserved pIRE/GAS is found in both promoters. This element is responsible for the induction of the ICSBP gene in mouse cells by IFN-c ( Kanno et al., 1993). A similar enhancer element conferred sensitivity for IFN type I and IFN-c to the promoter of the human IRF-1 gene (Sims et al., 1993). Other regulatory regions which could contribute to the regulation of the ChICSBP gene by cytokines may be NFkB-binding sites (Ohmori et al., 1993; Johnson et al., 1994; Drew et al., 1995). Previously, it was shown that the ChICSBP gene was inducible by ChIFN type I in primary CEF and C32 cells (Jungwirth et al., 1995). Expression can also be induced by ChIFN-c (Fig. 7; lanes 2 and 5). RNA blot analysis reveals a ChIFN-c-inducible mRNA of 2150 nt. In the absence of protein synthesis, overexpression of the ChICSBP gene is induced by ChIFN-c ( lanes 3 and 6). Similar observations were made with C32 cells (data not shown). To test the possibility that the

270

E. Dosch et al. / Gene 210 (1998) 265–275

Fig. 3. FISH mapping of the ChISCBP gene to chicken chromosomes. (a, b) DAPI-stained metaphase chromosomes. (a’, b’) Hybridization signals of ChICSBP on the same plates as in (a, b), counterstained with propidium iodide. The arrowheads point to the signal localization on a pair of microchromosomes. (c) Several pairs of microchromosomes demonstrating consistent localization of the genomic ChISCBP probe.

Fig. 4. Fluorescence in situ hybridization of chicken metaphase chromosomes showing the hybridization signal for the ChIRF-1 locus. (a, b) DAPIstained metaphase spreads. (a’, b’) Propidium iodide-stained metaphase chromosomes showing ChIRF-1 signals on a pair of microchromosomes. (c, d) Cut-outs of microchromosomes carrying ChIRF-1 signal from several metaphase spreads.

pIRE/GAS element detected by computational inspection is the functionally active enhancer element responsible for sensitivity of transcription to ChIFNs, chimeric CAT expression plasmids were constructed in which different fragments spanning −1025 to −42 were cloned in front of the truncated HSV Tk promoter driving the

CAT gene (Fig. 8). Promoter constructs are denominated according to the restriction enzymes used to isolate them from the upstream promoter region and their length in bp. The plasmids were transfected into C32 or CEF, IFNs were added 24 h later to part of the cells. Induction ratios were obtained by dividing the amount

E. Dosch et al. / Gene 210 (1998) 265–275

271

Fig. 5. Mapping of the ChICSBP mRNA transcription start site by primer extension analysis of ChIFN-c and ChIFN type I-induced ChICSBP mRNA. 10 mg of total RNA from CEF were annealed with an 18-mer oligonucleotide primer and extended by reverse transcriptase. ChICSBP mRNA was induced by pretreatment with ChIFN-c (1:500) or ChIFN type I (500 u/ml ) with or without cycloheximide (150 mg/ml ) for 18 h. Two different primers were used (see Materials and methods). The arrows demarcate the largest extension product. (A) Primer ICS 19 complementary to position +262 to +279. Lane 1, ChIFN type I; lane 2, ChIFN type I+cycloheximide; lane 3, ChIFN-c; lane 4, ChIFN-c+cycloheximide; GATC: size markers corresponding to a DNA sequence. (B) Primer ICS-1 complementary to cDNA sequence +159 to +176. Lane 1, ChIFNc+cycloheximide; lane 2, no cytokine.

of CAT protein from ChIFN-induced cells by the amount in untreated cells. 48 h after addition of ChIFN treatment the amount of CAT protein was determined by ELISA. Results of multiple independent transfection assays in C32 cells are summarized in Fig. 8. The response of the different constructs to ChIFNs was essentially the same in primary CEF as in C32 cells (data not shown). ChIFN-c inducibility was observed with all constructs containing the sequences between −1025 and −125. Constructs 387P/A and 252P/X also show high inducibility by ChIFN-c, indicating that the sequence between −387 and −125 containing the ISRE/GAS element is critical for ChIFN-c sensitivity. This sequence element is functionally active in both orientations (452X/B). Two constructs containing sequences from −1472 to −618 and −1014 to −618 were not inducible by ChIFN-c (data not shown). None of the constructs could be stimulated by ChIFN type I.

4. Discussion The genomic organization of the mammalian and chicken ICSBP gene show high similarity ( Kanno et al., 1993). Cis elements of transcription found in the promoter of the mouse ICSBP gene are also present in the avian homolog. Otherwise the upstream sequence of the chicken ICSBP promoter shows little resemblance to the mouse ICSBP promoter. In this respect there is similarity to previously studied promoters of the vimentin and N-CAM gene (van de Klundert et al., 1992; Colwell et al., 1992). The sequence of the promoters of the chicken genes differed from that of their mammalian

counterpart. On the other hand, high conservation of the cytotactin promoter sequences between mouse and chicken has been reported (Copertino et al., 1995; Jones et al., 1990). Transcriptional regulation by IFN-c is with respect to cis-elements in mammalian cells more variable than in the IFN type I system (Decker et al., 1997). Sensitivity of mammalian genes to IFN type I and IFN-c is mediated by common enhancer elements to which different transcription factors may bind. Regulation by IFN-c and IFN type I can be mediated by ISRE in some genes, while the GAS sequence seems to be the cis-element solely responsible for the regulation of the promoters of other IFN type I and IFN-c sensitive genes (Seegert et al., 1994; Decker et al., 1991). ChIFN-c was cloned only recently and the transcriptional activation of chicken genes by ChIFN-c has not been studied extensively. The ChICSBP gene appeared to be of interest as its murine counterpart is regulated by IFN-c. For this regulation, a pIRE element with high homology to GAS elements in the promoter is necessary and sufficient ( Kanno et al., 1993). The corresponding human gene is regulated by IFN type I and IFN-c ( Weisz et al., 1992). No genomic segment has been cloned and the IFN regulatory elements in the promoter of the human gene are not known. The sequence conferring sensitivity to ChIFN-c could be localized by transient transfection assays to a 252-bp DNA fragment containing the pIRE/GAS (−198/−206). Interaction of pIRE with ChIFN-cinducible proteins could be detected by EMSA using an oligonucleotide corresponding to the sequence from −198 to −206 of the ChICSBP promoter (unpublished observation). This indicates that cis-elements required

272

E. Dosch et al. / Gene 210 (1998) 265–275

Fig. 6. DNA sequence of the 5∞ end of the ChICSBP gene and comparison of the putative transcriptional cis-regulatory elements of the murine and chicken ICSBP promoter. (A) DNA sequence of the genomic fragment encoding the first exon and 1710-bp upstream of the transcription start site. The initiation site is labelled by (+1). Putative regulatory elements are underlined and first exon is boxed. Putative cis-acting elements were identified by computational analysis using the Genetics Computer Group program, version 7 (Anon., 1991). (B) Comparison of the distribution of cis elements in region 5∞ upstream of the chicken and murine ICSBP promoter. Structural similarities between the promoters of the chicken and mouse ICSBP gene. Several key enhancer elements are conserved in the promoters of both species: the CAAT box, TATA box, NF-kB motif, a pIRE (pIRE/GAS), two GC boxes. The mouse ICSBP promoter sequence was taken from Kanno et al. (1993).

for transcriptional activation by IFN-c have also been highly conserved in evolution. This conclusion is further supported by the observation that an ISRE element contained in the promoter of the functional class I gene BFIV ( Zo¨ller et al., 1992) was responsible for stimulation not only by ChIFN type I but also by ChIFN-c (unpublished observation). It has been shown that this enhancer element in mammalian MHC class I promoters is responsible for transcriptional activation by IFN type

I as well as IFN-c (Sugita et al., 1987; Israel et al., 1986; Korber et al., 1988). In contrast to the murine ICSBP gene the chicken homolog can be induced by ChIFN type I (Jungwirth et al., 1995) and ChIFN-c ( Fig. 7). It was therefore unexpected that none of the chimeric CAT constructs were inducible by ChIFN type I under conditions of transient transfection assays which raised the possibility that an ISRE might be located at another position of

E. Dosch et al. / Gene 210 (1998) 265–275

Fig. 7. Induction of ChICSBP mRNA by ChIFN-c in primary CEF. Effect of cycloheximide. CEF were treated with recombinant IFN-c (1:500) for 4 h or 18 h and total RNA extracted (Brawerman, 1974). In some experiments cycloheximid (150 mg/ml ) was added together with ChIFN-c; pretreatment of cells is indicated at the top of the figure. RNAs were fractionated by formaldehyde agarose gel electrophoresis. After blotting, mRNA was detected by hybridization with DIG labeled ChICSBP RNA-probe under conditions described previously (Anon., 1995). 20 mg were loaded on each lane. Similar results were obtained in C32 cells (data not shown). 28S RNA from C32 cells moves faster than 28S RNA from primary CEF, indicating that it is smaller by approx. 100 nt. RLU, relative units.

the gene. An IFN type I regulatory element has been detected previously in an intron enhancer of certain genes (Hatina et al., 1996; Damore et al., 1996). Computational analysis of the DNA sequence of the intron 2 of the chicken ICSBP gene revealed a sequence element with high homology to the ISRE of mammalian 2∞5 Oligo A synthetase (Rutherford et al., 1988). Transient transfection assays and EMSA, however, did not indicate a functional role of this sequence in the ChIFN type I or ChIFN-c regulation (unpublished observation). Ability to confer sensitivity to IFN type I may depend on flanking regions of the pIRE or on interaction with other cis-elements. A similar interpretation was presented to explain the observation that pIRE of the murine ICSBP gene binds IFN type I-inducible proteins in vitro but was not able to confer IFN type I inducibility on the basal HSV Tk promoter in transient transfection assays ( Kanno et al., 1993). The present study succeeded in locating the chicken ICSBP and IRF-1 genes on two different microchromosomes. These data are the first direct physical mapping evidence of the position of the ICSBP gene using non-

273

Fig. 8. The pIRE/GAS homologous region can confer ChIFN-c sensitivity to the heterologous HSV Tk promoter. Top: schematic representation of the chimeric HSV Tk promoter CAT constructs containing different fragments from the region upstream of the ChICSBP promoter. The putative pIRE/GAS element and the NFkB sites are shown. Sm=SmaI; B=BamHI; P=PstI; X=XbaI; A=AscI. Restriction sites used to construct the promoter deletions and their positions relative to the transcription initiation site are shown. Bottom: induction of chimeric CAT constructs by ChIFN. C32 cells were transfected with recombinant plasmids. After transfection (see Materials and methods), the cells were divided and equal numbers seeded into petri dishes. After incubation for 24 h, one petri dish received ChIFN type I (100 u/ml ) or ChIFN-c (1:500). Control cultures were not treated with cytokines. Cells were harvested and CAT activity determined by ELISA. Assays were done in triplicate. The mean values and standard deviations of CAT enhancement shown. At least three independent transfections were done. Induction factors represent the CAT activity of ChIFN treated cells divided by activity in untreated cells. Essentially similar results were made in primary CEF and C32 cells (data not shown).

radioactive in-situ hybridization methods and not through linkage analysis as in the mapping of murine ICSBP. The chicken IRF-2 gene was previously mapped to chromosome 4 (Marienfeld et al., 1997). Taken together, our results coincide with the observation that all the human IRF family members are located on different chromosomes ( Kanno et al., 1993; Harada et al., 1994). Assignment of these three genes to discrete chromosomal regions further highlights the existence of a similar, functionally conserved IFN-inducible transcription system in mammals and birds.

274

E. Dosch et al. / Gene 210 (1998) 265–275

Acknowledgement We are grateful to Drs G. Pflugfelder, S. Curpilo. P. Staeheli and E. Serfling for advice and many helpful discussions. The donation of IFNs by Drs P. Staeheli and U. Schultz is gratefully acknowledged. We thank Mrs Aulbach-Mueller for preparing the manuscript. This work was supported by VW foundation (C.J.) and by Deutsche Forschungsgemeinschaft (M.S.).

References Anon., 1991. Program Manual; Version 7. Genetics Computer Group, Madison, WI. Anon., 1995. The DIG System User’s Guide for Filter Hybridization. Boehringer Mannheim, Mannheim. Au, W.-C., Moore, P.A., Lowther, P., Juang, Y.-T., Pitha, P.M., 1995. Identification of a member of the interferon regulatory factor family that binds to the interferon-stimulated response element and activates expression of interferon-induced genes. Proc. Natl. Acad. Sci. USA 92, 11657–11661. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidmann, J.G. ( Eds), 1989. Current Protocols in Molecular Biology. Greene Publishing and Wiley Interscience, New York. Bovolenta, C., Driggers, P.H., Marks, M.S., Medin, J.A., Politis, J.A., Vogel, S.N., Levy, D.E., Sakaguchi, K., Appella, E., Coligan, J.E., Ozato, K., 1994. Molecular interactions between interferon consensus sequence binding protein and members of the interferon regulatory factor family. Proc. Natl. Acad. Sci. USA 91, 5046–5050. Brawerman, G., 1974. The isolation of messenger RNA from mammalian cells. In: Moldave, K., Grossman, L. (Eds.), Methods in Enzymology. Academic Press, London, pp. 605–612. Colwell, G., Li, B., Forrest, D., Brackenbury, R., 1992. Conserved regulatory elements in the promoter region of the N-CAM gene. Genomics 14, 875–882. Copertino, D.W., Jenkinson, S., Jones, F.S., Edelman, G.M., 1995. Structural and functional similarities between the promoters for mouse tenascin and chicken cytotactin. Proc. Natl. Acad. Sci. USA 92, 2131–2135. Damore, M.A., Omori, S.A., Well, R., 1996. IFN-c induces the k intron enhancer via an IFN-stimulated response element. J. Immunol. 156, 2451–2457. Darnell Jr., J.E., Kerr, I.M., Stark, G.M., 1994. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264, 1415–1421. Decker, T., Kovarik, P., Meinke, A., 1997. GAS elements: a few nucleotides with a major impact on cytokine-induced gene expression. J. Interferon Cytokine Res. 17, 121–134. Decker, T., Lew, D.J., Darnell Jr., J.E., 1991. Two distinct alphainterferon-dependent signal transduction pathways may contribute to activation of transcription of the guanylate-binding protein gene. Mol. Cell Biol. 11, 5147–5153. Digby, M.R., Lowenthal, J.W., 1996. Cloning and expression of the chicken interferon-c gene. J. Interferon Cytokine Res. 15, 939–945. Drew, P.D., Franzoso, G., Becker, K.G., Bours, V., Carlson, L.M., Siebenlist, U., Ozato, K., 1995. NF kappa B and interferon regulatory factor 1 physically interact and synergistically induce major histocompatibility class I gene expression. J. Interferon Cytokine Res. 15, 1037–1045. Driggers, P.H., Ennist, D.L., Gleason, S.L., Mak, W.H., Marks, M.S., Levi, B.Z., Flanagan, J.R., Apella, E., Ozato, K., 1990. An interferon c-regulated protein that binds the interferon-inducible

enhancer element of major histocompatibility complex class I genes. Proc. Natl. Acad. Sci. USA 87, 3743–3747. Fechheimer, M., Boylan, J.F., Parker, S., Sisken, J.E., Patel, G.L., Zimmer, S.G., 1987. Transfection of mammalian cells with plasmid DNA by scrape loading and sonication loading. Proc. Natl. Acad. Sci. USA 84, 8463–8467. Feinberg, A.P., Vogelstein, B., 1983. A technique for radiolabeling DNA endonuclease fragments to high specific activity. Anal. Biochem. 132, 6–13. Friedman, R.L., Manly, S.P., McMahon, M., Kerr, I.M., Stark, G.R., 1984. Transcriptional and posttranscriptional regulation of interferon-induced gene expression in human cells. Cell 38, 745–755. Frohman, M.A., 1993. Rapid amplification of complementary DNA ends for generation of full-length complementary DNAs: thermal RACE. Methods Enzymol. 218, 340–356. Grant, C.E., Vasa, M.Z., Deeley, R.G., 1995. cIRF-3, a new member of the interferon regulatory factor (IRF ) family that is rapidly and transiently induced by dsRNA. Nucleic Acids Res. 23, 2137–2146. Harada, H., Fujita, T., Miyamoto, M., Kimura, Y., Maruyama, M., Furia, A., Miyata, T., Taniguchi, T., 1989. Structurally similar but functionally distinct factors, IRF-1 and IRF-2, bind to the same regulatory elements of IFN and IFN-inducible genes. Cell 58, 729–739. Harada, H., Takahashi, E., Itoh, S., Harada, K., Hori, T.A., Taniguchi, T., 1994. Structure and regulation of the human interferon regulatory factor 1 (IRF-1) and IRF-2 genes: implications for a gene network in the interferon system. Mol. Cell Biol. 14, 1500–1509. Hatina, V.J., Kralova, J., Jansa, P., 1996. Identification of an intragenic interferon-stimulated response element sequence of the mouse class I major histocompatibility complex H-2Kb gene. Exp. Clin. Immunogenet. 13, 55–60. Holtschke, T., Lohler, J., Kanno, Y., Fehr, T., Giese, N., Rosenbauer, F., Lou, J., Knobeloch, K.P., Gabriele, L., Waring, J.F., Bachmann, M.F., Zinkernagel, R.M., Morse, H.C.r., Ozato, K., Horak, I., 1996. Immunodeficiency and chronic myelogenous leukemia-like syndrome in mice with a targeted mutation of the ICSBP gene. Cell 87, 307–317. Israel, A., Akinori, K., Fournier, A., Fellous, M., Kourilsky, P., 1986. Interferon response sequence potentiate activity of an enhancer in the promoter region of a mouse H-2 gene. Nature 322, 743–746. Johnson, D.R., Pober, J.S., 1994. HLA class I heavy-chain gene promoter elements mediating synergy between tumor necrosis factor and interferons. Mol. Cell Biol. 14, 1322–1332. Jones, F.S., Crossin, K.L., Cunningham, B.A., Edelman, G.M., 1990. Identification and characterization of the promoter for the cytotactin gene. Proc. Natl. Acad. Sci. USA 87, 6497–6501. Jungwirth, C., Rebbert, M., Ozato, K., Degen, H.J., Schultz, U., Dawid, I.B., 1995. Chicken interferon consensus sequence-binding protein (ICSBP) and interferon regulatory factor (IRF )1 genes reveal evolutionary conservation in the IRF gene family. Proc. Natl. Acad. Sci. USA 92, 3105–3109. Kanno, Y., Kozak, C.A., Schindler, C., Driggers, P.H., Ennist, D.L., Gleason, S.L., Darnell Jr., J.E., Ozato, K., 1993. The genomic structure of the murine ICSBP gene reveals the presence of the gamma interferon-responsive element, to which an ISGF3 alpha subunit (or similar) molecule binds. Mol. Cell Biol. 13, 3951–3963. Korber, B., Mermod, N., Hood, L., Stroynowski, I., 1988. Regulation of gene expression by interferons: control of H-2 promoter response. Science 239, 1302–1306. Lichter, P., Tang, C.J., Call, K., Hermanson, G., Evans, G.A., Housman, D., Ward, D.C., 1990. High-resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science 247, 64–69. Lowenthal, J.W., Digby, M.R., York, J.J., 1995. Production of interferon-c by chicken T cells. J. Interferon Cytokine Res. 15, 933–938. Luckow, B., Schu¨tz, G., 1987. CAT constructions with multiple unique

E. Dosch et al. / Gene 210 (1998) 265–275 restriction sites for the functional analysis of eukaryotic promoters and regulatory elements. Nucleic Acids Res. 15, 5490 Marienfeld, R., Nanda, I., Zo¨ller, B., Schmid, M., Rebbert, M., Jungwirth, C., 1997. Cloning of chicken IRF-2 cDNA. Expression and mapping of the IRF-2 gene. J. Interferon Cytokine Res. 17, 219–227. Miyamoto, M., Fujita, T., Kimura, Y., Maruyama, M., Harada, H., Sudo, Y., Miyata, M., Taniguchi, T., 1988. Regulated expression of a gene encoding a nuclear factor, IRF-1, that specifically binds to IFN-beta gene regulatory elements. Cell 54, 903–913. Nanda, I., Tanaka, T., Schmid, M., 1996. The intron-containing ribosomal protein-encoding genes L5, L7a and L37a are unlinked in chicken. Gene 170, 159–164. Ohmori, Y., Hamilton, T.A., Cooperative interaction between interferon (IFN ) stimulus response element and kB sequence motifs controls IFN-c and lipopolysaccharide-stimulated transcription from the murine IP-IO promoter. 1993. J. Biol. Chem. 268, 6677–6688. Rutherford, M.N., Hannigan, G.E., Williams, B.R.G., 1988. Interferon-induced binding of nuclear factors to promoter elements of the 2∞-5∞A synthetase gene. EMBO J. 7, 751–759. Schultz, U., Rinderle, C., Sekellick, M.J., Marcus, P.I., Staeheli, P., 1995. Recombinant chicken interferon from Escherichia coli and transfected COS cells is biologically active. Eur. J. Biochem. 229, 73–76. Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA sequencing with chain-terminating inhibitions. Proc. Natl. Acad. Sci. USA 74, 5463–5467. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schumacher, B., Bernasconi, D., Schultz, U., Staeheli, P., 1994. The chicken Mx promoter contains an ISRE motif and confers interferon inducibility to a reporter gene in chick and monkey cells. Virology 203, 144–148. Seegert, D., Strehlow, I., Klose, B., Levy, D.E., Schindler, C., Decker,

275

T., 1994. A novel interferon-alpha-regulated, DNA-binding protein participates in the regulation of the IFP53/tryptophanyl-tRNA synthetase gene. J. Biol. Chem. 269, 8590–8595. Sekellick, M.J., Ferrandindo, A.F., Hopkins, D.A., Marcus, P.I., 1994. Chicken interferon gene: cloning, expression and analysis. J. Interferon Res. 14, 71–79. Sims, S.H., Cha, Y., Romine, M.F., Gao, P.Q., Gottlieb, K., Deisseroth, A.B., 1993. A novel interferon-inducible domain: structural and functional analysis of the human interferon regulatory factor 1 gene promoter. Mol. Cell. Biol. 13, 690–702. Sugita, K., Miyazaki, J.I., Appella, E., Ozato, K., 1987. Interferons increase transcription of a major histocompatibility class I gene via a 5∞ interferon consensus sequence. Mol. Cell. Biol. 7, 2625–2630. Tanaka, N., Taniguchi, T., 1992. Cytokine gene regulation: regulatory cis-elements and DNA binding factors involved in the interferon system. Adv. Immunol. 52, 263–281. Thornton, A.M., Buller, R.M.L., DeVico, A.L., Wang, I.-M., Ozato, K., 1996. Inhibition of human immunodeficiency virus type I and vaccinia virus infection by a dominant negative factor of the interferon regulatory factor family expressed in monocytic cells. Proc. Natl. Acad. Sci. USA 87, 3743–3787. van de Klundert, F.A., van Eldik, G.J., Pieper, F.R., Jansen, H.J., Bloemendal, H., 1992. Identification of two silencers flanking an AP-1 enhancer in the vimentin promoter. Gene 122, 337–343. Veals, S.A., Schindler, C., Leonard, D., Fu, X.-Y., Aebersold, R., Darnell Jr., J.E., Levy, D.E., 1992. Subunit of an a-interferon responsible transcription factor is related to interferon regulatory factor and Myb families of DNA-binding proteins. Mol. Cell Biol. 12, 3315–3324. Weisz, A., Marx, P., Sharf, R., Apella, E., Driggers, P.H., Ozato, K., Levi, B.-Z., 1992. Human interferon consensus sequence binding protein is a negative regulator of enhancer elements common to interferon-inducible genes. J. Biol. Chem. 267, 25589–25596. Zo¨ller, B., Ozato, K., Kroemer, G., Auffray, C., Jungwirth, C., 1992. Interferon induction of chicken MHC class I gene expression: phylogenetic conservation of the interferon-responsive element. Virology 191, 141–149.