Gpt delta transgenic mouse: A novel approach for molecular dissection of deletion mutations in vivo

Adv. Biophys., Vol.38, pp.9%121 (2004)

GPT DELTA TRANSGENIC MOUSE: A NOVEL APPROACH FOR MOLECULAR DISSECTION OF DELETION MUTATIONS IN VIVO

TAKEHIKO NOHMI AND KEN-ICH1 MASUMURA

Division of Genetics and Mutagenesis, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501, Japan

Cellular DNA is continuously being exposed to various DNA-damaging agents. These include reactive oxygen species (ROS) generated in redox reactions of aerobic metabolism, ionizing radiations (IRs), ultraviolet light (UV) and other natural or man-made environmental mutagens (1). These damaging agents induce oxidation, methylation and deamination of DNA, adduct formation and strand sessions. It is estimated that ROS causes about 1,000 oxidative lesions, i.e., 8-oxo-guanine, per cell per day in humans (2). Of the various DNA lesions, the most detrimental is probably double-strand breaks (DSBs) in DNA because of the mutagenicity and cytotoxicity. DSBs can be caused when two DNA strands are simultaneously broken and the DNA ends are physically separated from one another. They are most typically induced by IRs, anti-cancer therapeutic agents such as mitomycin C (MMC) or when replicative DNA polymerases encounter single-stranded breaks or DNA lesions such as pyrimidine dimers, apurinic sites or modified bases (3). The broken termini often have modified bases, which prevent direct error-free ligation of the broken ends (4). DSBs in DNA trigger a set of cellular responses such as delay of cell cycle and apoptosis, which contributes Correspondence and requests for materials should be addressed to T.N. (e-mail: [email protected])

97

T. NOHMIAND K, MASUMURA

98 to the repair of DSBs and the elimination of damaged cells, respectively (5,6). However, if not properly repaired or eliminated, DSBs enhance the frequency of illegitimate rccorabination, i.e., deletions, amplifications and translocations of chromosomes, leading to genome instability and tumorigenesis (5-8). In addition, they severely inhibit DNA replication, thereby inducing cytotoxicity. Human cells are estimated to suffer about 10 DSBs per cell cycle even without any treatments to damage DNA (9), and approximately 70 DSBs are induced per cell per 1 Gy of irradiation (10). Because of the potent mutagenicity and cytotoxicity, cells possess a number of defense systems against DSBs in DNA. There are two main pathways for DSB repair: homologous recombination (HR) and non-homologous recombination repair (11-14). The latter is also referred to as non-homologous end joining (NHEJ) repair. HR repair copies information of the homologous sequence from sister chromatids or homologous chromosomes to restore the original sequence at the DSB. The identity of DNA sequence requires more than 200 base pairs (bps) homology (12,15). In yeast, this pathway is the major mechanism of DNA DSB repair although evidence suggests this pathway is also important in vertebrate cells (16,17). Human proteins such as RAD51, RAD52, RAD54, XRCC2, XRCC3, BRCA1, BRCA2 and the Rad50/Mrell/Nbsl complex are involved in this pathway (13,14,18). The other pathway, i.e., NHEJ repair, appears to be the prevailing mechanism of DSB repair in mammalian cells. This repair system can rejoin DSB ends directly even without sequence homology or using a short (1 to about 10 bps) region of homologous sequences (15,19-22). NHEJ pathway seems critical where no homologous sequences are available such as in the cell cycle of G Oand Gt. DNA ligase IV-XRCC4 complex and three components of DNA-dependent protein kinase (DNA-PK), i.e., Ku80 (XRCC5), Ku70 (XRCC6) and the catalytic subunit ofDNA-PKcs (XRCC7), are involved in NHEJ pathway (14,23). In addition to these components, the RAD50/MREll/NBS1 complex may be involved (13), It should be noted, however, that there are several sub-pathways of HR and NHEJ repair systems (see below). Although these repair pathways are supposed to protect cells from the threats of DSBs, some of them seem to play important roles in the induction of illegitimate recombination (20,24). For example, NHEJ repair can rejoin non-complementary ends irrespective of their sequence. If two DNA ends having modified bases generated by IRs are processed by nucleases into termini having 5'-phosphate and 3'-hydroxy groups, it will inevitably cause deletion mutations after Abbreviations: 6-4 PP, pyrimidine-(6,4)-pyrimidone photoproducts; 6-TG, 6-thioguanine; bp, base pair; CPD, cyclobutane pyrimidine dimers; DNA-PK, DNA-dependent protein kinase; DSB, double-strand breaks; HR, homologous recombination; IR, ionizing radiation; LET, Linear energy transfer; LOH, loss of hetcrozygosity; MMC, mitomycin C; NHEJ, non-homologous end joining; PhIP, 2-amino-l-methyl-6 -phenyIimidazo[4,5-bJpyridine; MF, mutant ti'equency; ROS, reactive oxygen species; SSA, single-strand annealing; UV, ultraviolet light.

MOLECULAR NATURE OF DELETION MUTATIONS I N V1VO

99

ligation. In this context, it should be noted that an alternative NHEJ repair pathway, which is independent of DNA-PK, may be involved in deletion mutations (see section V, p.l15). In addition to NHEJ repair pathways, single-strand annealing (SSA) mechanism, which is a sub-pathway of HR repair, is also thought to be involved in the induction of deletion mutations. I f a DSB occurs between two flanking homologous regions such as repeat sequences, this mechanism efficiently repairs the broken chromosome and results in a deletion of one copy of the repeats and the intervening sequence (20,25,26). Moreover, it is possible that more than one mechanism is responsible for the induction of deletions and the contribution of each mechanism may vary depending on the stages of cell cycle (G l versus late S phases), organisms (yeast versus mammals) and organs/tissues (somatic cells versus germ cells) (27). Thus, the elucidation of the underlying mechanism of illegitimate recombination in mammals is a major challenge in a field of mutagenesis. To gain insights into the mechanisms of deletion mutations in vivo, we have established a novel transgenic mouse, named gpt delta (28,29). The mice carry tandem repeats of )~EG10 DNA in the chromosome, which are retrievable as phage particles by in vitro packaging reactions. The rescued phages are then subjected to Spi- selection using Escherichia coli host cells for the analysis of mutations. Using the mouse/E, coli shuttle vector mutation assay, deletions can be analyzed at a molecular level in various organs of mice. In this chapter, we summarize the characteristics of deletion mutations induced by IRs in liver and spleen (30-32), UVB in epidermis (33), MMC in bone marrow (34) and 2-amino-l-methyl-6-phenylimidazo[4,5-b]pyridine (PhlP) in colon ofgpt delta mice (35,36) and discuss the possible mechanisms and future directions. I. ESTABLISHMENT OF GPT DELTA TRANSGENIC MOUSE Sequencing of the break points of chromosomes is most helpful in identifying the nature of processing DSBs. Although a number of in vitro mutation assays, using unicellular model organisms such as E. coli, yeast or cultured mammalian cells, have been developed, it is difficult to mimic the complex cellular and tissue interactions present in whole body systems. Several in vivo models are available in experimental animals to study mutations in endogenous genes. Such examples include the hprt mutation assay in splenic lymphocytes (37,38), the mouse aprt assay in kidney epithelia and ear fibroblasts (39,40) and the mouse specific-locus test in germ cells (41). Although these assays are sensitive to spontaneous and 1R-induced mutations, they are highly tissue-specific and are not applicable to a variety of tissues/organs. The narrow tissue/organ specificity could be a problem since most chemical carcinogens exhibit organ specificity in rodents. In addition, molecular characterization of mutations in the surrogate genes is time consuming

100

T. NOHMIANDK. MASUMURA

and laborious because of the size of the target gene (the genomic DNA of the hprt gene is about 50 kb). To overcome the limitation, a number of transgenic animal mutation assays have been developed by introduction of transgenes carrying reporter genes for mutations into the chromosomes of every cell of the animal (28,42). Since the genes can be recovered from any tissue by in vitro packaging reactions or by restriction enzyme digests plus ligation, the mutations can be analyzed in any tissueor organ. The lacZ, lacI or cII genes have been employed as reporter genes (43-45). Despite the difference of the coding sizes, the three genes exhibit very similar high levels of spontaneous mutant frequencies (MFs) in vivo. In the three reporter genes, spontaneous mutations appear to occur in the mid-10 -s range in most tissues. It is suspected that the spontaneous mutations are mainly due to deamination of 5-methylcytosine in the dinucleotide "CpG" sequences since bacterial transgenes are highly methylated in mammalian cells (46). Because of the high background of base substitutions, rare mutations such as deletions are not readily detectable by the selections. In fact, Big Blue mice and Muta Mouse carrying the lacl and lacZ reporter genes, respectively, are insensitive to the genotoxic effects of IRs (47, 48). We have introduced Spi- selection in the transgenic animal mutation assays to efficiently detect and analyze deletion mutations in vivo (Spi stands for sensitive to P2 interference) (29,31). This selection is unique in that it preferentially and positively selects deletion mutants o f k phage (49). Thus, it has been successfully utilized to analyze illegitimate recombination during prophage induction. The selection largely ignores the high incidence of spontaneous and induced base substitutions and hence highlights the low incidence of deletions. Because of the size limitation for in vitro packaging reactions (it must have two cos sites separated by 38-51 kb of DNA), the size of deletions detectable by Spi- selection is less than 10 kb (actually the maximum size of deletion we have identified is 9,198 bps). Thus, they are mostly intra-chromosomal deletions. However, tandem array of 80 copies of about 48 kb )~EG10 DNA in the gpt delta mouse (see below) amounts to a potential target of approximately 3.8 mega bases. To accomplish the Spi- selection, gpt delta transgenic mouse has been developed (29). This mouse was established by microinjection of LEGI0 phage DNA (48 kb) into the fertilized eggs of C57BL/6J mice. It carries about 80 copies of transgene in a head to tail fashion at a single site of chromosome 17 and is maintained as a homozygote (the mouse carries about 160 copies of LEG10 DNA per diploid) (50). In t}le transgenic mutation assay, 6-thioguanine (6-TG) selection as well as Spi- selection is incorporated for the detection of point mutations, i.e., base substitutions and frameshifts (Fig. 1). The 6-TG selection employs the gpt gene ofE. coli as a reporter gene. Since the product of the wild-type gpt converts 6-TG to a toxic substance, only the cells deficient in the gpt gene can survive on

101

MOLECULAR NATURE OF DELETION MUTATIONS IN VIVO

Mutaaer

L

Organ--~ DNA

gpt delta mouse

EG10 phage

48 kb 1

L_

~x%o,c,v,ox~

6-TG r colonies E. coil Cre*

Spi- plaques E. coil P2 lysogen Fig. 1. Protocols ofgpt delta transgenic mouse mutagenicity assay (28). Two distinct E.

coli host cells are infectedwith the rescued kEG10 phages; one is E. coli strain YG6020 expressing Cre recombinase for 6-thioguanine (6-TG) selection and the other is P2 lysogen for Spi selection.In the cells expressingCre recombinase,XEG10DNA is converted to plasmid carrying the gpt and chloramphenicolacetyltransferase(CAT)genes. The E. coli cells harboringthe plasmid carrying mutantgpt can be positivelyselected as bacterial colonies on the plates containing chloramphenicoland 6-TG. Mutant )~EG10 phages lacking red/gam gene functions can be positivelyselected as Spi plaques in P2 lysogens.Inclusionof MgSO4 (10 raM)to the plates during the plaque formationprocess increasesthesi~eofSpi-plaques(132).UsinggptandSpi selections,the frequenciesof point mutationsand deletionsin vivo can be compared in the same DNA sample. a plate containing 6-TG. Thus, E. coli g p t mutant cells can be positively selected using 6-TG. The coding size of g p t is 456 bps, and the gene has been employed as a reporter gene to establish Chinese hamster AS52 cells for in vitro gene mutation assay (51). Hence, two distinct mutations, i.e., deletions and point mutations, are identified by Spi- and 6-TG selections, respectively.

1I. PRINCIPLE OF SPY SELECTION This selection takes advantage of the restricted growth of wild-type )~ phage in P2 lysogens (52,53). Only mutant ;~ phages that are deficient in the functions of both the g a m and redBA genes can grow well in P2 lysogens and display the SpY phenotype as long as they carry a chi site and the host strain is recA +. Simultaneous inactivation of both the gain and redBA genes is usually induced by deletions in the region. It should be stressed that base substitutions, which constitute most of the spontaneous and induced g p t mutations detectable by 6-TG selection, do not induce SpF mutations. The product of gain gene inactivates the exonuclease V encoded by the r e c B C D genes of E. coll. In the prophage P2, there is a gene old whose product

102

T. NOHM1ANDK. MASUMURA

kills the host E. coli cell if the host's exonuclease V is inactivated. Thus, when P2 lysogens are infected with wild-type )~ phage, the oM gene product kills the host cell, thereby preventing the propagation of incoming )~ phage. In the absence of the gain and red gene products, the defective phage has a chance to replicate its DNA in the host cell because the exonuclease V is not inactivated. However, they must carry a chi sequence (GCTGGTGG) to prevent their DNA from the digestion by the potent exonuclease V. The chi sequence inactivates the recD gene product, thereby inhibiting the exonuclease digestion. The red gene is composed of two genes, i.e., redA and redB. The products are involved in the recombination events that resolve the replication form of phage DNA. The Spi-phages that are r e ~ and gain- must be propagated in recA + hosts to allow efficient packaging of DNA. No satisfactory explanation for the role of Red in the Spi selection has been offered. The number of rescued phages can be determined using isogenic E. coli without prophage P2. The Spi ME is calculated by dividing the number of Spi- phages with that of total rescued phages (28). Ill. SEQUENCE CHARACTERISTICS OF SPI MUTANTS RECOVERED FROM MICE We have analyzed more than 400 independent Spi- mutants at a sequence level. They were rescued from the liver, spleen, bone marrow, epidermis and kidney of gpt delta mice and the mutations were induced by IRs (carbon particle, X-ray and ,/-ray radiations), UVB, MMC or PhlR Mutants rescued from untreated mice were also analyzed. We classified the mutants into five classes based on the deletion sizes and the sequence characteristics of the j unction region as described below. Class I mutants included large deletions exceeding 1 kb. The cutoff size of 1 kb was chosen because the size of most of large deletions we identified was more than 1 kb and deletions with the size between 600 bps and ! kb were very rare (3 out of 425 total Spi mutants). We speculated that the size distribution might reflect the differences in the mechanisms involved (see this section, p.108). About half of Class I mutants has short homologous sequences at the junctions of mutants. Thus, we subdivided Class I mutants into Class I-A and I-B. Mutants of Class I-A are large deletions that exhibit short homologous sequences of 1 to 12 bps at the junctions (Fig. 2). The length of the homologous sequence is not related to the size of deletions. Class I-B mutants are large deletions without short homologous sequences. Intriguingly, about 10% of Class I-A and I-B mutants have insertion sequences in the junctions. These extra nucleotides are often called "filler DNA" and the genetic rearrangements that arise by illegitimate recombination in mammalian cells has such sequences at about 10% (54). The length of the insertion sequence is usually 1 or 2 bps but the maximum insertion was 14 bps. These insertion bases or sequences are mostly the same as or complementary to

MOLECULAR NATURE OF DELETION MUTATIONS IN WP-O

103

Original sequence 1 ATGAATGTAACGTAACGGAATTA'!~CACTGTTGATT

Class I-A

Originalsequence 2 GCTTACGATAACGTA~GGAATTAT~TACTATGTAA.A Mutant sequence Class I*B

ATGAATGTA.ACGTAAC~GGAATTA'£TACTATGTAAA

Original sequence 1 ACGCCGGAAGTAA.ATTCAAACAGGGTTCTGGCGTC Original sequence 2 TCTGGTCAAATTATAT~GTTGGAAAACAAGGATGC Mutant sequence

base insertion at the junction

ACGCCGGAAGTAA-ATT~GTTGGA.AAACAAGGATGC

Original sequence 1 GCTCAAAGTCCATGCC~TCAAACTGCTGGTTTTCA Original sequence 2 AAGGTCTATCGGATTT~GTGCGCTTTCTACTCGTG

A Mutant sequence Class III-A

GCTCAAAGTCCATGCCA[~GTGCGCTTTCTACTCGTG AGCAAAAAATCCA - ~

Class III-B

GTGCGTTT

AGCAAAAATCCA

------I~

GTGGTTT

Fig. 2. Sequence characteristics of Spi mutations. Class I-A mutants are large deletions exceeding l kb in size and have short homologous sequences at the junctions. The homologous sequences (8 bps) are boxed, DNA sequences generated by the deletion between original sequences 1 and 2 are presented as "Mutant sequence". Class I-B large deletions do not have such short homologous sequences. The junction is highlighted with a dotted line. About 10% of Class I mutants possess base insertions at the junctions. An example of insertion of C is presented. Class [II-A mutants are single base pair deletions at run sequences such as AAAAAA, Class III-B single base pair deletions occur at non-run sequences. Carbon ion Liver (10 Gy) ,/-ray Spleen (50 Gy) UVB

• Class I-A

N Class I-B

Epidermis (0.5 kJim 2)

[] Class II

-~!,

MMC Bone marrow

[ ,

2:1

gll Class III-A [] Class llI-B

PhlP Colon Untreated

[] Class IV ~

~

[3 Class V

Epidermis

J 0%

50%

100%

Fig. 3. Schematic representation of various classes of Spi- mutations. Class l-A, large deletions with short homologous sequences at the junctions; Class I-B, large deletions without short homologous sequences; Class II, middle size (more than 1 bp but less than 1 kb) deletions; Class III-A, single bp deletions at run sequences; Class HI-B, single bp deletions at non-run sequences; Class IV, complex mutations; Class V, miscellaneous mutations. The references of each treatment are as follows: carbon ion 02); ,bray (31); UVB (33); MMC (34); PhlP (35); untreated (33).

104

T. NOHMIANDK. MASUMURA

the neighboring sequences. Class I-A and I-B mutants delete regions of both the gain and redBA genes or a region in the gain gene and the upstream. They are induced by IRs, UVB and MMC (Fig. 3). Class 1l included middle-size deletions of more than 1 bp but Jess than 1 kb. Some had short homologous sequences but others not as in the case of Class I mutants. Mutations of more than 20 bps but less than 600 bps were frequently identified in the spleen of mice irradiated with ~-ray at a dose of 50 Gy (Fig. 3). Class II1 mutants were I bp deletions in the gain gene. These small deletions are not supposed to induce Spi- mutations. However, translation of the garn and redBA genes is probably linked, and the garn gene is first transcribed so that the 1 bp deletions in the gain gene may interfere with the start of translation of the downstream redBA genes, thereby functionally inactivating not only garn but also redBA (3I). This accounts for how Class II mutants having deletions with the size of 3n+l (n = 1, 2, 3, --) in the gain gene display Spi- phenotypes. We subdivided Class IIl mutants into Class III-A and III-B: the former mutations occur at run sequences such as A A A A A A and the latter at non-repetitive sequences (Fig. 2). Class III-A mutants occurring at A:T repetitive sequences are the most predominant type of mutations in untreated mice (Fig. 3). PhIP induces Class III-A deletions. However, most of them occur at G:C repetitive sequences or beside run sequences (35). Class IV is a complex type of mutations where the exact junctions could not be identified because of the genome rearrangements. This class of mutants is frequently observed in mice irradiated with heavy ion (32). Class V includes miscellaneous mutants, mainly base substitution mutants in the gain gene. These mutants have no deletions in the gain gene. Thus, they are not supposed to be Spi- mutants. The reason for the appearance of Class V base substitution mutants could be the leakiness of the P2 lysogen, i.e., XL-I Blue MRA (P2) strain. In fact, the base substitution mutants do not display Spi phenotypes in another P2 lysogen, i.e., E. coli WL95 (P2). The base substitutions observed in Class V mutants are not typical mutations induced by the examined mutagens. For example, Class V mutants recovered from mice treated with UVB have no C to T transitions at dipyrimidines, suggesting that the mutations are not induced by UVB (33). Most of Class V mutants make plaques on a recA E. coli strain. The phenotype of)v phage that cannot produce a plaque on a r e c A strain is called Fec-. ;~ red and garn double mutants are Fec-. To eliminate the base substitution mutants, we recently introduced WL95 (P2) strain to confirm the phenotype of the Spi- candidates recovered from the mice (55). However, the sequence characteristics shown in this report are based on the results without the confirmation assay using WL95 (P2) strain. Thus, Class V base substitution mutants are included in Fig. 3.

MOLECULARNATUREOF DELETIONMUTATIONSIN VIVO

105

Spi Mutations Induced by IRs IRs are the most powerful source for the induction of DSBs in DNA. Thus, whether Spi mutations are induced by IRs is a crucial examination as to whether the large deletions such as Class I and Class IV mutants are generated by DSBs or they are induced by slippage of DNA replication. In particular, heavy particle radiation, which is a high linear energy transfer (LET) radiation, induces DSBs by direct deposition of energy on DNA (56). Heavy particle radiation accounts for the major component of absorbed cosmic radiation and is regarded as a significant risk in space exploration (57). For these reasons, we irradiated gpt delta transgenic mice with carbon-ion beam and determined Spi- MF in various organs. Mice were exposed to a 10 Gy dose of carbon particle radiation (135 MeV/u) at a dose rate of 1 Gy per rain by the RIKEN Ring Cyclotron, and the organs were collected 2 days following irradiation (30). The whole-body irradiation significantly increased the Spi- MF in the liver, kidney and spleen with similar efficiencies (Fig, 4). Sequencing analyses of Spi- mutants recovered from the liver of mice revealed that the most frequently observed mutations were Class I large deletions (Fig. 3). Class IV complex mutations were also identified. Thus, we concluded that Class I and Class IV mutations are indeed generated during the repair of DSBs in DNA. Unlike Spi mutations, the gpt mutations representing base substitutions and frameshifts were not significantly induced in the liver by carbon particle irradiation. The gpt mutation spectrum was similar to that observed in non-irradiated mice. These results are consistent with the notion that the strand breaks by carbon ion irradiation were induced by direct energy deposition on DNA, but not by ROS. If ROS had been substantially generated by the intracellular interaction of ionizing radiation with water, it would have oxidized DNA and induced gpt point mutations as well. In fact, X-ray radiation, a low LET radiation, significantly induced both Spi- and gpt mutations. X-ray irradiation rnay primarily induce DNA damage by a ROS-mediated indirect mechanism

(30). c~

~1o v

.

e~

co

Liver

.

.

-

--

.

.

oo~J -

-

tlt Ell Spleen

Kidney

Testis

Fig. 4. Frequencyof Spi mutationsin heavy ion beam-irradiatedgpt delta mice. Heavy ion beam radiation at 10 Gy induces Spi- mutations in the liver, spleen and kidney, but not testis. * P<0.05, versus 0 Gy. Bars representmean:kSDvalues of 3 to 5 mice.

106

T. NOHM1 AND K. MASUMURA

In contrast to the induction of Spi- deletions in somatic cells, the Spi MF m testis was not enhanced by carbon particle irradiation (Fig. 4). This result, together with the findings in other organs, suggests the organ-specific induction of deletions by IRs. Since cell division is active in the spleen and testis but not in the liver, and the frequency of DNA replication parallels cell division, it suggests that DNA replication does not play a major role in the induction of Spi- mutations. Instead, we suggest that the difference in the mechanisms of DSB repair between germ cells and somatic cells may account for the results. It is reported that the level of Ku proteins involved in NHEJ repair is remarkably low in mouse cells undergoing meiosis (27). The low level of Ku may enhance the probability of HR enzymes to access the termini of DSBs. Thus, the prevailing mechanism of repairing DSBs in DNA in testis may be different from that in somatic cells such as liver, kidney or spleen. In separate experiments, we examined the dose-response relationship of Spimutations in spleen of mice irradiated with y-ray (29, 31). Whole body irradiation was performed for 10 rain at a dose rate of 0.5, 1.0 and 5.0 Gy per min and the mice were sacrificed 3 days following irradiation. The MFs were 1.4 X 10 -6, 7.0 X 10 -6, 12 X 10 -6 and 20 × 10 -6 at doses of 0, 5, 10 and 50 Gy, respectively. Interestingly, the percentage of Class II mutants (middle size deletions) increased with the radiation dose. Class II mutants constituted more than 60% of Spi- mutants rescued in the mice irradiated with y-ray at a dose of 50 Gy (Fig. 3). The deletion sizes of Class II mutants ranged from 28 bps to 504 bps. Since high-dose irradiation generates clustered damage in DNA (58), we speculate that the size of Class II deletions might represent the length of two clustered DSBs induced by y-irradiation.

Spi Mutations Induced by UVB UV light radiation in sunlight is the most prominent and ubiquitous carcinogen in the environment. Excess exposure to solar UV increases the risk of skin cancer. Although all of the detrimental UVC (wavelength 200 to 280 nm) and most of UVB (280 to 320 nm) radiation are efficiently absorbed by the ozone layer, the residual UVB irradiation that reaches earth is still hazardous to human skin. It is predicted that a 1% reduction in the ozone layer would lead to an increase in the incidence of skin cancer by 2 to 4% (59). UVB irradiation induces the formation of cyclobutane pyrimidine dimers (CPD) and pyrimidine-(6,4)-pyrimidone photoproducts (6-4 PP) in DNA (1), and increases the frequency of base substitutions, i.e., C to T single transitions and CC to TT double transitions, at dipyrimidine sites. In addition to base substitutions, UV irradiation induces deletions and chromosome aberrations in E. coli, yeast and cultured mammalian cells in vitro (60-64). However, whether UVB irradiation actually induces deletions in the skin of rodents remains elusive, and

MOLECULARNATURE OF DELETION MUTATIONSIN V1VO

107

TABLE 1 Spi mutant frequencies of large deletions (Class I-A and Class I-B) and 1 bp deletions (Class III-A and Class III-B) recovered fi'om the epidermis of UVB-irradiated and unirradiated gpt delta mice. Large deletion 1-bp deletion UVB(kJ/m2) (Class I-A and I-B mutants) (Class III-A and 111-Bmutants) Specific MF(×10-6) Fold increase SpecificMF(X10-6) Fold increase 0

1.0

0.1

1.0

1.0

0.3

7.0

0.7

1.6

1.6

0.5

17.0

1.7

1.2

1.2

1.0

9.0

0.9

1.6

1.6

4.0

0.4

1.4

1.4

2.0

0.2

0.8

0.8

1.5 2.0

t

Specific mutant frequency was calculated by multiplying the mutant frequency by the ratio of the number of Class I-A and I-B (or Class III-A and III-B) mutants among the total number of Spi mu-

the molecular characteristics of the U V B - i n d u c e d deletions are still undefined. To address these issues, gpt delta mice were exposed to UVB irradiation at single doses o f 0.3, 0.5, 1.0, 1,5 or 2.0 kJ per m 2. At 4 weeks after irradiation, the Spi- M F s in the epidermis were determined (33). Although the total M F did not increase by more than 3-fold, the specific M F o f large deletions, i.e., Class I-A and I-B, was 17 times higher than the control at the dose of 0.5 kJ per m 2 (Table l). We postulate the following mechanisms for the induction of Class I - A and I-B mutations by U V B irradiation (Fig. 5): UVB irradiation induces CPD and 6-4 PP at dipyrimidine sites, which block D N A replication and may cause daughterstrand gaps in DNA. DSBs may occur as a result o f breaks in the gap region, possibly through the attack of an endonuclease specific for single-strand DNA (63, 65). The assumption that DSBs are induced by replication of U V - d a m a g e d template D N A is consistent with the fact that U V i r r a d i a t i o n induces strand breaks during D N A replication, and hence it is called an " S - p h a s e - d e p e n d e n t agent" (66). The resulting double-strand ends could be digested by exonucleases, thereby generating 3' or 5' protruding ends. D i p y r i m i d i n e sites where UV photoproducts are generated may be removed in this step. Some of Class I-B mutants had one or two bp insertions at the junctions. They may play a role in the efficient joining of two flush D N A ends during N H E J repair. Since DSBs are related to various genetic alterations, they might cause not only Spi mutations but also larger deletions such as loss of heterozygosity (LOH) often observed in human skin cancers (67- 69). A n interesting observation is the b e l l - s h a p e d d o s e - r e s p o n s e curve o f Spi M F in response to the dose of U V B irradiation (Table 1). It is largely due to the apparent suppression o f large deletions in higher doses o f UVB. Since Spi- muta-

108

Y. NOHMIAND K. MASUMURA

UV a

~ I

A I

I

I

TO.

Photoproduct I

I

I

I

4, ,

,

,

A , TC ~ I I

DNA Replication/ Repair

areakd

DSBs

.............. *

LOH

I ~'

Nuclease digestion

Short homology ~r "~i~F C l a s s I-A m u t a n t s

Ligation

~' No homology ~' I I I I I I C l a s s I-B m u t a n t s

Fig. 5. Proposed mechanisms for the induction o1" deletions by UVB irradiation in the murine epidermis. UVB irradiation induces UV photoproducts at dipyrimidine sites, which block DNA replication and may cause daughter-strand gaps in DNA. DNA double-strand breaks may occur as a result of breaks in the gap, possibly through the cleavage by an endonuclease (63). Alternatively, double-strand breaks may be induced during the repair of UV-induced lesions (133). The resulting double-strand ends are digested by exonucleases, thereby generating 3' or 5' protruding ends. The ends are joined with or without the short direct-repeat sequences, thereby generating Class I-A and Class I-B mutants, respectively. The double-strand breaks might be related to induction of loss ofhcterozygosity (LOH) as well as SpFmutations.

tions require DNA replication for mutagenesis, DNA replication might be severely inhibited at higher UVB doses. It is also possible that the high efficiency of DNA repair against daughter-strand gap in DNA is induced in the skin at higher UVB doses, or that mutated cells are selectively killed. Alternatively, Spi mutants are not recovered because the extent of deletions induced at the high doses is lethal. Further work is needed to establish the reason(s) for the fall in MFs of deletions in the mouse skin at higher UVB doses.

Spi Mutations induced by MMC Several chemotherapeutic agents induce strand breaks in DNA. MMC is a natural cytotoxic and genotoxic agent used in clinical anticancer chemotherapy. The reductive metabolites alkylate DNA in several different ways. Alkylation of two guanine bases on the same DNA strand results in the formation of intrastrand cross-links, and the alkylation of guanine bases on opposite DNA strands leads to the formation of interstrand cross-links (70-74). DNA interstrand cross-links are formed exclusively between two guanine bases in the 5 ' - C G - 3 ' / 3 ' - G C - 5 ' sequences (75). We examined the in vivo mutations induced by MMC and demonstrated that MMC induces large deletions (Class 1 mutations) in the bone marrow (34,76).

109

MOLECULAR NATURE OF DELETION MUTATIONS 1N VIVO

gpt delta mice were treated with MMC at a dose of 1 mg per kg tbr five successive days, and the Spi- and gpt mutations were characterized one week after the last treatment (34). Although the specific MF of 1 bp deletions (Class III-A and Ill-B) in the MMC-treated group was only about 1.3 times higher than that in the control, the specific MF of large deletions (Class I-A and Class l-B) mutants in the MMC-treated group was about 20 times higher than that of the control. We speculate that MMC induces interstrand cross-links in complementary DNA strands, which strongly block DNA replication and DNA strand separation, thereby playing an important role in the formation of DSB (77). DSB formation could be caused either by two closely separated incisions on opposite strands or by replication of nicked DNA (78). Since intrastrand cross-links or even monoadducts block DNA replication (79), they may induce DNA strand breaks as well. The resulting double-stranded broken ends can be digested by exonucleases, generating 3'- or 5'-protruding ends as in the case of UVB-induced deletions (Fig. 5). Interestingly, most of the deletion sizes of Classes I-A and I-B mutants are more than 2 kb. The deletion sizes of the Spi- mutants in the skin of mice irradiated with UVB are mostly more than l kb (33). Thus, the deletion sizes, i.e., more than 1 to 2 kb, may represent the unit of exonuclease digestion once DSBs are induced in the chromosomes. The MFs in both Spi- and 6-TG selections were elevated by MMC one week after the last injection but decreased to the control levels four weeks after the treatment (Fig. 6). Similar kinetics of MF after dosing in bone marrow have been also reported for other chemicals in lacZ transgenic mice (80,81). Hematopoietic ¢O

X >, 0r O"

0

6

×

5

O C

4

0"

1

3

E 2 E .m

D.

E

1 0 Vehicle

MMC 1 week

MMC 4 week

Vehicle

MMC 1 week

MMC 4 week

Fig. 6. Mutant frequencies in the bone marrow of MMC-treated and vehicle-treated gpt delta mice: (A) Spi- mutant frequencies. (B) gpt mutant frequencies. The samples were taken one week after the last treatment (MMC 1 week) or four weeks after the last treatment (MMC 4 weeks). MMC was administered by intraperitoneal injection at a dose of 1 mg/kg for five consecutive days. Control cells were collected four weeks after the mice received five consecutive injections of saline (Control). ~<0.001, **p<0.0001 (Chi-square test). Data represent mean=~SD.

T. NOHMI AND K. MASUMURA 110

stem cells differentiate in the bone marrow, and the resulting mature cells move to peripheral blood within two to three weeks (82). The bone marrow cells damaged by MMC might move to peripheral blood or die within two to three weeks, resulting in a decrease in MFs in the bone marrow four weeks after the last injection. These results underscore the importance of manifestation time (a time period between the last treatment and the sampling, during which DNA damage is converted to mutations within cells) to optimally detect mutations in vivo.

Spi Mutations lnduced by' PhlP A number of mutagenic/carcinogenic heterocyclic amines have been identified in cooked food (83-85). PhIP is the most abundant heterocyclic amine in the daily diet and is known to induce colon and prostate cancers in male rats and mammary carcinoma in female rats (86-89). gpt delta mice were treated with PhIP (400 ppm in diet) for 13 weeks and the MFs were determined in the colon, spleen, liver, testis, brain and bone marrow (36), The highest MFs were observed in the colon, followed by the spleen and liver in both male and female mice. Thus, the colon appears to be the most sensitive organ with respect to the mutagenicity of PhlP in

vivo. To better understand the molecular mechanisms of PhIP-induced deletion mutations, we analyzed Spi- and 6-TG (gpt) mutants rescued from the colon of mice treated with PhlP (35). The most frequently occurring Spi mutations were single G:C base pair deletions in the gain gene (Fig. 3). The mutation at G:C bps could be due to PhIP-DNA adduct, i.e., N-(deoxyguanosin-8-yl)-PhIP (dG-C8PhIP) (90). Since large deletions were not frequently observed in the Spi- mu-

A

8

C GG5' - C G G G G C C - 3

A GA5' - T T T T T T G CT-3'

C GG5' -CGGq CC-3

U CCC GG5' - C G G G C C - 3 q¢

A GA-

5" - T T T T T T C T - 3 ' "g ~ GA5' - T T T T T T CT-3' W

Fig. 7. Proposed mechanisms for single base pair (bp) deletions in run or beside run sequences induced by PhIP. (a) In G run sequences, incorporation of cytosine opposite a PhlP adduct leads to a misaligned intermediate by looping out the adducted guanine. The intermediate is stabilized by the formation of correct G:C bps at the template/primer terminus. (b) In the case o f - I frameshift beside run sequences, adenine is first misincorporated opposite an adduct, and then forms correct base pairs with the neighboring thymine in the template strand. Slipped mutagenic intermediates are stabilized by the following monotonous run sequences.

MOLECULAR NATURE OF DELETION MUTATIONS IN VIVO

lll

tants recovered from PhlP-treated mice, we suggest that PhIP does not substantially induce DSBs in DNA. The single G:C deletions occurred in long G:C runs or beside runs of identical bases. In the latter cases, the deleted guanine is at Y-side of runs, such as 5'-TTTTTTG__-3'. These results indicate that run sequences are important for PhIP-induced G:C deletions, and that neighboring sequences strongly influence these events. We suggest that a slipped mutagenic intermediate is formed after the incorporation of cytosine opposite the dG-C8-PhlP adduct for the induction of 1 bp frameshifts in run sequences (Fig. 7A). In the case of deletions beside A:T run sequences, adenine is first incorporated opposite the dG-C8-PhlP, and then adenine correctly pairs with the neighboring thymine in the template strand by looping out the adducted guanine (Fig. 7B). Replication from the correctly paired A:T primer terminus, with the adducted dG-C8-PhlP looped-out, could generate single G:C deletions. It seems reasonable to assume that adenine is incorporated opposite dG-C8-PhIP because G:C to T:A transversions are the most predominant type of gpt mutation observed in these same PhIP-treated mice (35). The run sequences may stabilize the slipped mutagenic intermediates when they are at the 5'-side of the adducted guanine. These single G:C deletions beside run sequences have not been observed in systems using the gpt, lacI or lacZ loci.

Spi Mutations in Untreated Mice We have analyzed more than 40 Spi mutants rescued from the liver, epidermis, bone marrow and colon of untreated gpt delta mice (30,33-35). The most predominant mutation is 1 bp deletions in the repetitive sequences, i.e., Class III-A, in the gam gene (Figs. 2 and 3). The percentage of Class II1 mutants in untreated mice varies from organ to organ but they form at least 56% of the mutants in the liver (5 out of 9 total Spi mutants) and at most 77% in bone marrow (10 per 13 total Spi- mutants). These numbers may be underestimated values because we regard identical mutations recovered from the same mice as a result of clonal expansion and count them as one mutation. However, they could be independent hot spot mutations. In fact, there are several hot spots of spontaneously occurring Spi- mutations. The most prominent one is Class III-A mutants, A6 to A5 at position 295 to 300 in the gain gene (the nmnber starts from the first ATG of the gam gene). The mutation is repeatedly identified in all organs examined. Other examples include 1 bp deletions of A5 to A4 at position 227 to 231, G4 to G3 at position 286 to 289 and C4 to C3 at position 238 to 241 in the gain gene. We suggest these events are most likely induced by slippage errors of DNA polymerases during DNA replication (91). We did not identify hot spot large deletions (Class I-A or I-B) either in untreated or treated mice. This may indicate that DSBs are randomly induced in the transgene region. However, further work is required before making definite conclusions.

112

T. NOHM1AND K. MASUMURA

IV. SEQUENCE C H A R A C T E R I S T I C S OF GPT MUTATIONS IN VIVO In a d d i t i o n to Spi selection, we a n a l y z e d in vivo p o i n t m u t a t i o n s b y 6-TG selection. Here, we briefly s u m m a r i z e the sequence characteristics o f the gpt mutations (Fig. 8). The dose o f mutagens and the treatment conditions are the same as those described for SpV selection unless otherwise indicated. ~/-ray: The mice were exposed to whole body irradiation of y-ray at a dose o f 10 G y and the liver was collected 2 days following irradiation(30). The y-irradiation significantly induced gpt mutations in the liver o f mice and the spectrum was distinct from that o f u n i r r a d i a t e d mice. The most characteristic mutation was a short deletion with the size mostly less than 10 bp. These deletions occur at non-repetitive sequences. Short deletions in non-repetitive sequences are also observed in lacZ and lacl transgenic mice exposed to X-rays and ,/-rays, respectively (92,93). A n o t h e r c h a r a c t e r i s t i c mutation was G:C to T:A transversion. Since it is a typical mutation induced by 8-oxo-guanine in D N A (94), we suggest that ),-irradiation induces mutations in the gpt gene p r i m a r i l y through the generation o f ROS. U V B : The most frequent gpt mutations in the e p i d e r m i s o f U V B - i r r a d i ated transgenic mice were G:C to A:T transitions at dipyrimidine sites such as 5 ' - T C - Y and 5 ' - C C - 3 ' (underlined C is changed to T) (95). CC to TT double transitions were also identified. The C to T and CC to TT transitions at dipyrimitandem be

"~.3~:0 "prays

complex

~ UVB

MNC

~

A:T to G:C

B

G:C to T:A

~

G:C to C:G A:T to T:A

deletions ~ G:C to

deletions

~./~ tandem base changes

PhIP

ENU

Untreated

Fig. 8. Schematic reprcsentation of various types ofgpt mutations. The organ where mutations were analyzed and the references are as follows: -~-rayin the liver (30); UVB in the epidermis (95); MMC in the bone marrow (34); PhIP in the colon (35); ENU in the bone marrow (50); untreated in the epidermis (95).

MOLECULARNATUREOF DELETIONMUTATIONSIN VIVO

113

dine sites are predominantly found in the p53 tumor suppressor gene in human skin cancers (96). The gpl MF at a UVB dose of 0.5 kJ per m 2 (120.6 × l0 6) is more than 70 times higher than the specific MF of Class I large deletions of Spi (1.7 × 10 -~) (33,95). This result indicates that UVB induces base substitutions more efficiently than deletions. MMC: MMC specifically induced tandem-base substitutions, mainly in 5'-GG-3' sequences in the bone marrow of mice. No single-base substitutions or single-guanine-base deletions were induced by the treatment (34). Unlike UVB, MMC poorly induces base substitutions compared to large deletions because the specific MF of tandem-base substitutions (3.4 X10 -6) w a s only about 40% higher than that of Class 1 Spi- mutants (2.4 × 10-6). PhIP: Treatment of mice with PhlP-containing diet induced G:C to T:A transversion mutations in the colon (35). Single bp frameshifts at G:C were also identified. More than half of these single bp frameshifts occurred at G:C sites in 5'-GGG-3' or 5'-GG-3'. The base substitutions and frameshifts could be induced by translesion bypass replication of template dG-C8-PhIP adduct. The specific MF of G:C to T:A transversions in the colon (57.8 X 10 -6) was about four times higher than that of single bp deletions at G:C (15.5 × 10-6), suggesting PhlP induces more base substitutions than frameshifts. The specific MF of single bp deletions in the gpt gene (15.5 X l0 -6) was comparable to that of single bp deletions at runs (Class III-A) in the gain gene (23.0 × 10 "6) detected by Spi- selection. N-ethyl-nitrosourea (ENU): Mice were treated by a single intraperitoneal injection of ENU at a dose of 150 mg per kg and the gpt mutations in the bone marrow were analyzed 7 days following the injection (50). ENU induced A:T to T:A transversion mutations, suggesting the importance of modified thymine base such as O2-ethylthymine for the induction of mutations (97). Spontaneous mutations: The most prominent mutations observed in untreated mice are G:C to A:T transition mutations. More than half of these occur at 5'-CpG-3' sites, namely at position 64, 110 and 115 of the gpt gene (the number starts from the first ATG of the gpt gene). This suggests that deamination of 5-methylcytosine at CpG sites contributes to the spontaneous gpt mutations. Besides G:C to A:T mutation, G:C to T:A transversions were also frequently observed in the spontaneous gpt mutants. The remaining mutants were frameshifts or short deletions. These characteristics are largely consistent with the spontaneous mutation spectra of the lacl gene of Big Blue mice (46). V. POSSIBLE MECHANISMS OF DELETION MUTATIONS IN VIVO Deletions with short (Class I-A) or no (Class I-B) homologous sequences at their junctions have been observed in a number of mutant genes implicated in human diseases including cancer. Examples include the retinoblastoma

T. NOHMIAND K. MASUMURA

114

(98), c ~ - g a l a c t o s i d a s e A (99), [ 3 - g l o b i n (100), f a c t o r V I I I (101) a n d a s p a r t y l g l u c o s a m i n i d a s e genes (102). Indeed, about 40% o f large d e l e t i o n s in human disorders are characterized by the presence o f very short sequence homologies at the breakpoints (21). On the basis o f the sequence characteristics observed in the junctions o f Spi mutants, we suggest that NHEJ repair plays an important role in the generation o f intra-chromosomal deletions such as Spi-Class I mutants. To get insight into this process, gpt delta mice were crossed with p53 lmice (103) or A t m -/ mice (104), and S p i mutations were analyzed following IRs. We summarize the results in the following section.

Effects of p53 and ATM on 1R-induced Spi Mutations The tumor suppressor gene p53 is known to be involved in various aspects o f genome stability, such as signal transduction, cell cycle checkpoint, apoptosis and D N A repair, and is referred to as "the guardian o f the genome" (105). To examine the roles of p53 in in vivo mutations, lacI transgenic mice were crossed with p53 -/- mice. Contrary to the expectation, no statistically difference in lacI mutant frequency and spectrum was observed between p53 +/+and p53 -/- mice (106). It was concluded that the contribution o f p53 to the suppression o f point mutations is little, i f any. It is known, however, that p53 expression is regulated in an organspecific manner (107). The level o f expression of p53 is higher in the kidney than in the liver after y-ray irradiation. To examine the organ-specific roles of p53 in suppressing deletions induced by radiations, p53 -/ gpt delta mice were exposed to whole carbon-ion irradiation at a dose o f 10 G y and then sacrificed 2 days

p53 */+ Liver

• Class I-A

9,8

~ Class I-B

p53 #-

[] Class II

9,8

Liver

I~1Class III-A

p53*/* Kidney

Class III-B

7.3

ZI Class IV

p53"/-

12.3

Kidney

C] Class V

L

L

I

J

0

5

10

15

Specific Spi- mutant frequency (x 10 "8) Fig. 9. Specific Spi mutant frequencies in the liver and kidney of p53+/+and p53-/- gpt delta mice irradiated with carbon ion. The values adjacent to the bars represent the total Spi mutant frequencies. The Spi mutant frequencies of unirradiated p53+/+liver, p53 -/ liver, p53+/+kidney and p53-/-kidney are 3.6 × 10-6, 3.3 X 10-6, 2.6 X 10-6, 2.8 X 10-6, respectively (32).The symbols are the same as those described in the legend of Fig. 3.

MOLECULARNATUREOF DELETIONMUTATIONSIN VIVO

115

following irradiation (32). The p53 defect enhanced the Spi MF in the kidney of mice; Spi MF increased 4.4- and 2.8-fold over the background level after irradiation in p53 /- and p53 +/+ mice, respectively (Fig. 9). Sequence analysis of the SpF mutants indicated that the enhancement was primarily due to an increase in complex (Class IV) deletions. In contrast to the kidney, the p53 defect had no effects on Spf- MF in the liver; Spi MF increased 3.0-fold and 2.7-fold after the irradiation in p53 -/- and p53 +/+mice, respectively. These results suggest that p53 suppresses deletion mutations in an organ-specific manner. Ataxia telangiectasia (AT) is an autosomal recessive hereditary disease characterized by progressive cerebellar ataxia, oculocutaneous telangiectasia, immunodeficiency, chromosome instability, sensitivity to IR and increased incidence of cancer (]08). The gene responsible for AT was cloned and designated as ATM (Ataxia-telangiectasia-mutated) (109). The ATM protein is a member of Pl-3 kinase family, which includes DNA-PK. ATM appears to play a crucial role in cell-cycle growth control and DNA repair by phosphorylation of a number of proteins including p53, Chk2, Brcal and Nbsl (]10,111). ATM is inactive in unirradiated cells as a dimer but it phosphorylates its partner at position serine 1981 in a rapid response to IR damage, which causes dimer dissociation (]12). The ATM monomers phosphorylate p53 at position serine 15 (]13,114). Thus, if p53 is "the guardian of the genome", ATM could be considered as "the guardian of the guardian of the genome" (115). Knockout Atm mice (Arm /-) are cancer-prone, immunodeficient and sensitive to IRs (104). To examine the roles of ATM in suppressing deletion mutations in vivo, Atm -/- gpt delta mice as well as control, i.e., Atm +/+gpt delta mice, were exposed to whole body radiation of X-ray at doses of 5, 10 and 50 Gy and the Spi- MFs were determined in the liver 3 days after the irradiation (116). The MFs increased in a dose-dependent manner in both Arm -land Atm +/+ mice and the dose-response curves were virtually identical between them. Structural analysis revealed no significant difference in the proportion of large deletions and 1 bp frameshifts between Atm -/- and Atm +/+mice. These results suggest that ATM does not affect IR-induced deletions in the liver. However, this does not necessarily mean that ATM is not involved in the suppression of IR-induced intra-chromosomal deletions. As in the case of p53, which appears to suppress deletion mutations in an organ-specific manner, Atm disruption might affect induction of mutations in other organs. Mouse liver is a slowly dividing organ. In this regard, it will be interesting to examine the effects of Atm deficiency on Spi mutations in proliferating organs such as spleen or thymus.

DNA-PK-dependent and DNA-PK-independent NHEJ Pathways NHEJ repair appears to be involved in the induction of large deletions detected by Spi- selection. This pathway involves the DNA end-binding heterodimer KuT0/Ku80, DNA-PKcs, XRCC4 and DNA ligase IV (14,23). Although some of

116

T. NOHMIANDK. MASUMURA

these proteins play an essential role in the maintenance of genome stability and suppression of tumorigenesis, NHEJ repair pathway has the potential to induce deletion mutations as described in the Introduction. If two incompatible ends are generated by IRs, they first have to be converted to ligatable ends by enzymatic processing which often causes small deletions (20). Since the coding region in mammalian DNA is only a few percent and the expressed essential genes are rare, small deletions associated with NHEJ repair may be tolerable in mammalians. Ku70/80 heterodimer proteins may function as the alignment factor by protecting DNA ends from excess degradation and enhancing the ligation (117). Thus, it is possible that Class l large deletions of Spi mutants are generated during the processing of DSBs by the proteins involved in NHEJ repair. Increasing biochemical and genetic evidence suggests, however, that there is an alternative NHEJ pathway (15,20). This pathway is independent of Ku70/ Ku80 (DNA-PK) and entails deletions whose break points are flanked by microhomologies (2 to 6 bps). This mechanism occasionally accomplishes rejoining with an insertion of DNA at the deletion sites. When the sequences at the breakends are not complementary like DSBs produced by IR, breaks are rejoined by either the short homology-dependent mechanism or by a process of blunting the ends be~bre ligation. This pathway has been designated error-prone NHEJ (20), direct-repeat end-joining (15), micro-homology-based NHEJ (118), modified single-strand annealing (SSA) (119,120) or micro-homology-driven SSA (121). In yeast, when both Rad52-dependent HR pathway and yeast Ku70 homologue (Yku70p) are inactivated, DSBs bearing cohesive termini are deleted up to several hundreds bps before ligation and rejoined with short homologies between two recombining molecules (122). Taken together, it appears that this DNA-PKindependent error-prone NHEJ pathway plays an important role in the induction of Class I Spi mutants, which may represent intra-chromosomal deletions. However, the genetic factors involved in the DNA-PK-independent NHEJ pathway remain elusive. In this respect, gpt delta transgenic mouse and cell lines derived from the lung could help the identification of genes involved in the mutagenic pathway in mammals. It is also important to examine IR-induced Spi mutations in sicdgpt delta mice, where DNA-PKcs is inactivated, to distinguish which NHEJ repair pathway is primarily involved in the induction of Spi- mutations. VI. FUTURE DIRECTIONS Altered oxidative metabolism is a property of many tumor cells. Oxidation of DNA and its precursors, i.e., dNTP pool, is the main source of genome instability (123). 8-oxo-guanine is a major oxidative damage in DNA and induces G:C to T:A transversion mutations (94). To counteract the mutagenic lesion, eukaryotic cells possess 8-oxo-guanine DNA glycosylase, which excises 8-oxo-guanine in DNA

MOLECULAR NATURE OF DELETION MUTAT[ONS IN V1VO

117

(124,125). This enzyme is encoded by the Oggl gene in eukaryotes including humans. E. coli cells possess functionally similar 8-oxo-guanine DNA glycosylase but the amino acid sequence is distinct form the eukaryotic counterparts (126). E. coli 8-oxo-guanine DNA glycosylase is encoded by the mutM gene. In addition to 8-oxo-guanine DNA glycosylases, adenine mispaired with 8-oxo-guanine in DNA is removed by MYH protein, which is a functional homologue of E. coli MutY (127). gpt delta mice were crossed with Oggl -/- mice (128). It was shown that the spontaneous gpt MF in the liver was significantly higher in Oggl / mice than in the wild-type mice. In addition, administration of potassium bromate, which induces oxidative damage in DNA, enhances the amount of 8-oxo-gaunine in the kidney and liver DNA of Oggl 4- mice and increases the gpt MF (129,130). Further studies are necessary to investigate whether oxidative damage in DNA and the dNTP pool induces deletion mutations in mammals and determine the molecular characteristics of such deletions. Genome rearrangements associated with oxidative stress are important in the field of mutagenesis and carcinogenesis. Oxidation o f DNA is often caused indirectly by malnutrition. Hence, the relationship between nutrition and genome rearrangements mediated via oxidative stress could be an important and interesting area for future research. In this regard, gpt delta rat (131) could be important because most of carcinogenesis studies are undertaken in rats rather than mice. SUMMARY Human genome is continuously exposed to various DNA damaging agents including reactive oxygen species. Of various forms of DNA damage, doublestrand breaks (DSBs) in D N A are the m o s t detrimental because of the mutagenicity and cytotoxicity. To combat the serious threats posed by DSBs, cells evolved various homologous and non-homologous recombination repair mechanisms. However, some repair mechanisms appear to be involved in the induction of genome rearrangements such as deletions. To analyze the deletion mutations in a whole body system, gpt delta mice were established. In this mouse model, deletions in ;~ DNA integrated in the chromosome are preferentially selected as Spi phages, which can then be subjected for molecular analysis. Here, we reported the sequence characteristics of deletions induced by ionizing radiations in the liver, ultraviolet light B in the epidermis, mitomycin C in the bone marrow and heterocyclic amine PhlP in the colon. To our knowledge, this is the first report in which in vivo deletion mutations are systematically analyzed at the molecular level. About half of the large deletions occur between short direct-repeat sequences and the remainder had flush ends, suggesting that they are generated during the repair of DSBs in DNA. The results also suggest that mutation induction and repair mechanisms may vary depending on the

T. NOHMIAND K. MASUMURA 118 organs/tissues exanrined, i.e., germ cells versus somatic cells or h i g h l y type Ol:" proliferating cells versus s l o w l y proliferating cells. Possible m e c h a n i s m s o f intrac h r o m o s o m a l deletion mutations are discussed. Acknowledgments The w o r k was supported by Grants-in-Aid for Cancer Research from the Ministry o f Health, Labour and Welfare, Japan, C r o s s o v e r Research from the Ministry o f Education, Sports, Culture, S c i e n c e and Technology, Japan, and Basic R e s e a r c h f r o m the Japan Health S c i e n c e Foundation.

REFERENCES I E.C.Friedberg~G.C.Wa~km~andW.Siede~"DNAr~airandMutagenesis~ÈASMPress~`ashingt~n~ D.C., p.l (1995). 2 T.A.Kunkel, Trends Genet., 15, 93 (1999). 3 G.C.Smith and S.P.Jackson, Genes"Dev., 13, 916 (1999). 4 W.D.Hermer, L.O.Rodriguez, S.M.flecht, and W.A.Haseltine, J.Biol. Chem., 258, 711 (1983). 5 K.K.Khanna and S.P.Jackson, Nature Genet., 27, 247 (2001). 6 B.B,Zhou aM S.J.Elledge, Nature, 408, 433 (2000). 7 C.Richardson and M.Jasin, Nature, 405, 697 (2000). 8 S.Vamvakas, E.H.Vock, and W.K.Lutz, CritRe~Tbxicol., 27, 155 (1997). 9 J.E.Habm; Trends Biochem.Sei., 24, 271 (1999). 10 M.Frankenberg-Schwager, Radiat.Environ.fliophys., 29, 273 (1990). 11 M.Takata, M.S.Sasaki, E.Sonoda, C.Morrison, M.Hashimoto, H.Utsumi, Y.Yamaguchi-Iwai, A.Shinohara, and S.Takeda, EM90 J., 17, 5497 (1998). 12 J.E.Haber, Trends' Genet., 16, 259 (2000). 13 S.P.Jackson, Carcinogenesis, 23, 687 (2002). 14 D.C.van Gent, J.H.Hoeijmakers, and R.Kanaa~, Nat.Rev.Getlet., 2, 196 (2001). 15 J.Thacker, CR.Acad.Sci.III, 322, 103 (1999). 16 E.Sonoda, M,S.Sasaki0 J.M.Buerstedde, O.Bezzubova, A,Shinohara, H.Ogawa, M.Takata, Y.Yamaguchi-lwai, and S.Takeda, EMBOJ., 17, 598 (1998) 17 T.Tsuzuki, Y.Fujii, K.Sakumi, Y.Tominaga, K.Nakao, M.Sekiguchi, A.Matsushiro, Y.Yoshimura, and T.Morita, Proc.Natl.Acaa(Sci. USA, 93, 6236 (1996). 18 P.Karran, Curr.Opin.Genet.Dev., 10, 144 (2000). 19 S.E.Critchlow and S.P.Jackson, Trends Biochem.Sei., 23,394 (1998). 20 P.Pfeiffer, W.Goedecke, and G.Obe, Mutagenesis, 15, 289 (2000). 21 T.Mowisand J.Thackm; Proc.Natl.Acad.Sei. USA, 90, 1392 (1993). 22 Y.Tsukamotoand H.Ikeda, Genes Cells° 3, 135 (1998). 23 R,Kanaar, J.H.Hoeijmakers, and D.C.van Gent, Trends Cell Biol., 8, 483 (1998). 24 D.O.Ferguson and F.W.Alt, Oneogene, 20, 5572 (2001). 25 F.L.Lin, K.Sperle, and N.Sternberg, Mol.CellBiol., 4, 1020 (1984). 26 F.Paques and J.E.Habel; Mierobiol.Mol.Biol.Rev., 63, 349 (1999). 27 W.Goedecke, M.Eijpe, I-I.H.Offenberg, M.van Aalderen, and C.Heyting, Nature Genet., 23, 194 (1999). 28 T.Nohmi,T.Suzul¢i;and K.Masumura, Mutat.Res., 455, 19l (2000). 29 T.Nohmi, M.Katoh, H.Suzuki, M.Matsui, M.Yamada, M.Watanabe, M.Suzuki, N.I-Ioriya, O.Ueda, T.Shibuya, H.Ikeda, and T.Sofuni, Environ.MoLMutagen., 28, 465 (1996). 30 K.Masumura, K.Kuniya, T.Kurobe, M.Fukuoka, F.Yatagai, and T.Nohmi, Environ.MoLMutagen., 40, 207 (2002).

MOLECULAR NATURE OF DELETION MUTATIONS IN VIVO

119

31 T.Nohmi, M.Suzuki, K.Masumura, M.Yamada, K.Matsui, O.Ueda, H.Suzuki, M.Katoh, II.Ikeda, and T.Sofuni, Environ.Mol.Mutagen., 34, 9 (1999). 32 F.Yatagai, T.Kurobe, T.Nohrni, K.Masunrura, T.Tsukada, H.Yamaguchi, K.Kasai-Eguchi, and N.Fukunishi, Environ.Mol.Mutagen., 40, 216 (2002). 33 M.Horiguchi, K.I.Masumura, H.lkehata, T.Ono, Y.Kanke, and T.Nohmi, Cancer Res., 61, 3913 (2001). 34 A.Takeiri, M.Mishima, K.Tanaka, A.Sbioda, O.Ueda, H.Suzuki, M.Inoue, K.Masumura, and T.Nohmi, Chem.Res'.Toxicol., 16, 171 (2003). 35 K.Masumura, K.Matsui, M.Yamada, M.Horiguchi, K.lshida, M.Watanabe, K.Wakabayashi, and T.Nohmi, Carcinogenesis, 21, 2049 (2000). 36 K.Masumura, K.Matsui, M.Yamada, M.Horiguchi, K.Ishida, M.Watanabe, O.Ueda, H.Suzuki, Y.Kanke, K.R.Tindall, K.Wakabayashi, T.Sothni, and T.Nohmi, Cancer Lett., 143,241 (1999). 37 Y.Kataoka, J.Perrin, and D.J.Grdina, Radiat.Res., 136, 289 (1993). 38 R.Lorenz, W.Deubel, K.Leuner, T.Go/lner, E.Hochhauser, and K.Hempel, lnt.J.Radiat.Biol., 66, 319 (1994). 39 N.H.Khattar, C.D.Jennings, K.A.Walker, and M.S.Turker, Adv.Exp.Med.Biol., 370, 665 (1994). 40 O.N.Ponomareva, J.A.Rose, M.Lasarev, J.Rasey, and M.S.Turker, Cancer Res., 62, 1518 (2002). 41 L.B.Russell and B.E.Matter, Mutat.Res., 75, 279 (1980). 42 J.A.Heddle, S.Dean, T.Nohmi, M.Boerrigter, D.Casciano, G.R.Douglas, B.W.Glickman, N.J.Gorelick, J.C.Mirsalis, H.J.Marms, T.R.Skopek, V.Thybaud, K.R.Tindall, and N.Yajima, Environ. Mol.3/futagen., 35, 253 (2000). 43 J.A.Gossen, W.J.de Leeuw, C.H.Tan, E.C.Zwarthofl; F.Berends, P.H.Lohman, D.L.Knook, and J.Vijg, Proc.Natl.AcadSci.USA, 86, 7971 (1989). 44 J.L.Jakubczak, G.Merlino, J.E.French, W.J.Muller, B.Paul, S.Adhya, and S.Garges, Proc.Natl.Acad Sci.USA, 93, 9073 (1996). 45 S.W.Kohler, G.S.Provost, A.Fieck, RL.Kretz, W.O.Bullock, .I.A.Sorge, D.L.Putman, and J.M.Sbort, Proc.Natl.Acad.Sci.USA, 88, 7958 (1991). 46 J.G.de Boer, S.Provost, N.Gorelick, K.Tindall, and B.W.Glickman, Mutagenesis, 13, 109 (1998). 47 T.Suzuki, M.Hayashi, T.Sofuni, and B.C.Myhr, Mutat.Res., 288, 219 (1993). 48 K.S.Tao, C.Urlando, and J.A.Heddle, Proc.Natl.Acad.Sci.USA, 90, 10681 (1993) 49 H.[keda, H.Shimizu, T.Ukita, and M.Kumagai, Adv.Biophys., 31, 197 (1995). 50 K.Masumura, M.Matsui, M.Katoh, N.Horiya, O.Ueda, H.Tanabe, M.Yamada, H.Suzuki, T.Sofuni, and T.Nohmi, Environ.Mol.Mutagen., 34, 1 (1999). 51 K.R.Tindall, L.F.Stankowski, Jr., R.Machanoff, and A.W.Hsie, Mutat.Res., 160, 121 (1986). 52 J.Sambrook, E.F.Fritsch, and T.Maniatis, "Molecular Clonipg", Cold Spring Harbor Laboratory Press, New York, 2nd Ed. (1989). 53 G.R.Smith, "Lambda II," ed. by R.W.Hendrix, J.W.Roberts, F.W.Stahl and R.A.Weisberg, Cold Spring Harbor Laboratory Press, New York, p.176 (1983). 54 D.B.Roth, G.N.Proctor, L.K.Stewart, and J.H.Wilson, NueleicAcids Res., 19, 7201 (1991). 55 K.Masumura, Y.Totsuka, K.Wakabayashi, and T.Nohmi, Carcinogenesis, 24,1985 (2003). 56 M.Lobrich, RK.Cooper, and B.Rydberg, Int.J.Radiat.Biol., 70, 493 (1996). 57 G.D.Badhwar, Radiat.Res., 148, $3 (1997). 58 M.Gulston, J.Fulford, T.Jenner, C.de Lara, and P.O'Neill, Nucleic Acids' Res., 30, 3464 (2002). 59 G.Kelfkens, F.R.de Gruijl, and J.C.van der Leun, Photochem.Photobiol., 52, 819 (1990). 60 A.Galli and R.H.Schiestl, Mol.Gen.Genet., 248, 301 (1995). 61 Y.lshii and T.Ikushima, Mutat.Res., 427, 99 (1999). 62 L.R.Seguin, R.E.Tarone, K.H.Liao, and J.H.Robbins, Am.J.Hum.Genet., 42, 468 (1988). 63 T.Ukita and H.lkeda, J.Bacteriol., 178, 2362 (1996). 64 H.Yamaguchi, T.Yarnashita, H.Shimizu, and H.lkeda, Mol.Gen.Genet., 248, 637 (1995). 65 T.C.Wang and K.C.Smith, Mutat.Res., 165, 39 (1986). 66 T.Ikushima, Y.Shima, and Y.Ishii, Mutat.Res., 404, 35 (1998). 67 M.R.Gailani, D.J.Leffell, A.Ziegler, E.G.Gross, D.E.Brash, and A.E.Bale, J.Natl.Cancer Inst., 88, 349 (1996).

120

T. NOHM[AND K. MASUMURA

68 A.Ahmadian, Z.ERen, C.Williams, F.Ponten, d.Odeberg, J.Ponten, M.Uhlen, and J.Lundeberg, Oncogene, 17, 1837 (1998). 69 p.M.Pollock, F.Yu, L.Qiu, P.G.Parsons, and N.K.Hayward, Oncogene, 11, 663 (1995). 70 M.Tomasz, R.Lipman, D.Chowdary, J.Pawlak, G.L.Verdine, and K.Nakanishi, Science, 235, 1204 (1987). 71 M.Tomasz, A.K.Chawla, and R.Lipman, Biochemistry, 27, 3182 (1988). 72 K.G.Suresh, R.Lipman, J.Curnmings, and M.Tomasz, Biochemislw, 36, 14128 (1997). 73 Y.Palom, R.Lipman, S.M.Musser, and M.Tomasz, Chem.Res.Toxicol., 11,203 (1998). 74 Y.Palom, M.F.Belcourt, S.M.Musser, A.C.Sartorelli, S.Rockwell, and M.Tomasz, Chem. Rex. Toxicol., 13,479 (2000). 75 M.Tomasz and YiPalom, Pharmacol.Ther., 76, 73 (1997). 76 N.Okada, K.Masumura, T.Nohmi, and N.Yajima, Environ.Mol.Mutagen., 34, 106 (1999). 77 I.U.De Silva, RJ.McHugh, RH.Clingen, and J.A.Hartley, Mol.CellBiol., 20, 7980 (2000). 78 M.L.Dronkert and R.Kanaal; Mutat.Res., 486, 217 (2001). 79 A.K.Basu, C.J.Hanrahan, S.A.Malia, S.Kumar, R.Bizanek, and M.Tomasz, Biochemistry, 32, 4708 (1993). 80 T.Hara, K.Hirano, N.Hirano, H.Tamura, H.Sui, T.Shibuya, A.Hyogo, T.Hirashio, H.Tokai, Y.Yamashita, and K.Kura, Mutal.Res., 444, 297 (1999). 81 M.Nakajima, M.Kikuchi, K.Saeki, Y.Miyata, M,Terada, F.Kishida, R.Yamamoto, C.Furihata, and S.W.Dean, Mz~tat.Res., 444, 32I (1999). 82 S.Okada, K.Nagayoshi, H.Nakauchi, S.Nishikawa, Y.Miura, and T.Suda, Blood, 81, 1720 (1993). 83 T.Sugimura, Cancer, 49, 1970 (1982). 84 B.Commoner, A,J.Vithayathil, RDolara, S.Nair, P.Madyastha, and G.C.Cuca, Science, 201, 913 (1978). 85 J.S.Felton and M.G.Knize, Mutat.Res., 259, 205 (1991). 86 TSugimura, M.Nagao, and K.Wakabayashi, J.Natl.Cancerlnst., 86, 2 (1994). 87 M.Nagao, T.Ushijima, M.Toyota, R.Inoue, and T.Sugimura, Mutat.Res., 376, I61 (1997). 88 J.S.Felton, M.G.Knize, N.H.Shen, B.D.Andresen, L.F.Bjeldanes, and F.T.Hatch, Environ.ttealth Perspect., 67, 17 (1986). 89 D.W.Layton, K.T.Bogen, M.G.Knize, F.T.Hatch, V.M.Johnson, and J.S.Felton, Carcinogenesis, 16, 39 (1995). 90 H.A,Schut and E.G.Snyderwine, Calrinogenesis, 20, 353 (1999). 91 G.Streisinger, Y.Okada, J.Emrich, J.Newton, A.Tsugita, E.Terzaghi, and M.Inouye, Cold Spring Harb.Symp.Quant.Biol., 31, 77 (1966). 92 T.Ono, H.Ikehata, S.Nakamura, Y.Saito, J.Komura, Y.Hosoi, and K.Yamamoto, Environ. Mol.Mutagen., 34, 97 (1999). 93 R.A.Winegar, L.H.Lutze, J.D.ttamer, K.G.O'Loughlin, and J.C.Mirsalis, Mutat.Res., 307, 479 (1994). 94 H.Kasai, M.H.Chung, F.Yamamoto, E.Ohtsuka, J.Laval, A.P.Grollman, and S.Nishimura, Basic.L{fe Sci., 61,257 (1993). 95 M.Horiguchi, K.Masumura, H.lkehata, T.Ono, Y.Kanke, T.Sofuni, and T.Nohmi, Environ. Mol.Mutagen., 34, 72 (1999). 96 S.Kress, C.Sutter, RT.Strickland, H.Mukhtar, J.Schweizer, and M.Schwarz, Cancer Res., 52, 6400 (1992). 97 RC.Grevatt, J.J.Solomon, and O.S.Bhanot, Biochemistry, 31, 4181 (1992). 98 S.Canning and T.RDryja, Proc.NatLAeadSci. USA., 86, 5044 (1989). 99 R.Kornreich, D.F.Bishop, and R.J.Desnick, ~Biol. Chem., 265, 9319 (1990). 100 RS.Henthorn, O.S]nithies, and D.L.Mager, Genomics, 6, 226 (1990). 101 S.P.Woods, J.Kazazian-HH, and S.E.Antonarakis, Genomics, 10, 94 (1991). 102 A.Jalanko, T.Manninen, and L.Peltonen, Hum.MoLGenet., 4, 435 (1995). 103 T.Tsukada, Y.Tomooka, S.Takai, Y.Ueda, S.Nishikawa, T.Yagi, T.Tokunaga, N.Takeda, Y.Suda, S.Abe, I. Matsuo, Y. Ikawa and S. Aizawa, Oncogene, 8, 33/3 (1993). 104 C.Barlow, S.Hirotsune, R.Paylor, M.Liyanage, M.Eckhaus, F.Collins, Y.Shiloh, J.N.Crawley,

MOLECULAR NATURE OF DELETION MUTATIONSIN VIVO 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128

129 130 131 132 133

121

T.Ried, D.Tagle, and A.Wynshaw-Boris, Cell, 86, 159 (1996). N.D.Lakin and S.P.Jackson, Oncogene, 18, 7644 (1999). V.L.Buettner, H.Nishino, J.Haavik, A.Knoll, K.Hill, and S.S.Sommer, Mutat.Res., 379, 13 (1997). E.A.Komarova, K.Christov, A.I.Faennan, and A.V.Gudkov, Oncogene, 19, 3791 (2000). T.J.Jorgensen and Y.Shiloh, Int.J.Radiat.Biol., 69, 527 (1996). K.Savitsky, A.Bar-Shira, S.Gilad, G.Rotman, Y.Ziv, L.Vanagaite, D.A.Tagle, S.Smith, T.Uziel, S.Sfcz, et al., Science, 268, 1749 (1995). D.Durocher and S.P.Jackson, Cur~Opin.CellBiol., 13,225 (2001). Y.Shilohand M.B.Kastan, Adv.CancerRes., 83, 209 (2001). C.J.Bakkenist and M.B.Kastan, Nature, 421,499 (2003). S.Banin, L.Moyal, S.Shieh, Y.Taya, C.W.Anderson, L.Chessa, N.I.Smorodinsky, C.Prives, Y.Reiss, Y.Shiloh, and Y.Ziv, Science, 281, 1674 (1998). C.E.Canman, D.S.Lim, K.A.Cimprich, Y.Taya, K.Tamai, K.Sakaguchi, E.Appella, M,B.Kastan, and J.D.Siliciano, Science, 281, 1677 (1998). R,A.Gatti, S.Becker-Catania, H.H.Chun, X.Sun, M.Mitui, C.H.Lai, N.Khanlou, M.Babaci, R.Cheng, C.Clark, Y.Huo, N.C.Udar, and R.K.Iyer, Clin.Rev.Allergy lmmunol., 20, 87 (2001). I.Furuno-Fukushi, K.Masumura, T.Furuse, Y.Noda, M.Takahagi, T.Saito, Y.Hoki, H.Suzuki, A.Wynshaw-Boris, T.Nohmi, and K.Tatsumi, Radiat.Res., 160, 549 (2003). E.Feldrllann, V.Schmiemann, W.Goedecke, S.Reichenberger, and RPfeiffer, Nucleic Acids Res., 28, 2585 (2000). C.W.Lehman, J.K.Trautman, and D.Carroll, Nucleic Acids Res., 22, 434 (1994). A.L.Nicolas and C,S.Young, Mol.CelIBiol., 14, 170 (1994). A.L.Nicolas, RL.Munz, and C.S.Young, Nucleic Acids Res., 23, 1036 (1995). B.Gottlich, S.Reichenberger, E.Feldmann, and EPfeiffer, Eu~J.Biochem., 258, 387 (1998). SJ.Boulton and S.P.Jackson, EMBO.L, 15, 5093 (1996). M.Sekiguchi and T.Tsuzuki, Oncogene, 21, 8895 (2002). K.Shinmura and J.Yokota, Antioxid.Redox.Signal., 3, 597 (2001). S.Nishimura, Prog.Nucleic AcidRes.Mol.Biol., 68, 107 (2001). M.L.Michaels, C.Cruz, A.RGrollman, and J.H.Miller, Proc.Natl.AcadSci. USA, 89, 7022 (1992). Y.Nakabeppu, Prog.NucleicAcidRes.Mol.Biol., 68, 75 (200l). O.Minowa, T.Arai, M.Hirano, Y.Monden, S.Nakai, M.Fukuda, M.Itoh, H.Takano, Y.Hippou, H.Aburatani, K.Masumura, T.Nohmi, S.Nishimura, and T.Noda, P1ve.Natl.Acad.Sci. USA, 97, 4156 (2000). T.Arai,V.RKelly, O.Minowa, T.Noda, and S.Nishimura, Carcinogenesis, 23, 2005 (2002). T.Arai, V.RKelIy,K.Komoro, O.Minowa, T.Noda, and S.Nishimura, Cancer Res., 63, 4287 (2003). H.Hayashi, H.Kondo, K.Masumura, Y.Shindo, and T.Nohmi, Environ.Mol.3/Iutagen., 41,253 (2003), A.Shibata, M.Masutani, T.Nozaki, N.Kamada, It.Fujihara, K.Masumura, H.Nakagama, T.Sugimura, S.Kobayashi, H.Suzuki, and T.Nohmi, Environ.Mol.Mutagen., 41,370 (2003). M.Berneburg, J.E.Lowe, T.Nardo, S.Araujo, M.l.Fousteri, M.H.Green, J.Krutmann, R.D.Wood, M.Stef'anini, and A.R.Lehmann, EMBO J., 19, 1157 (2000).