ABA

Journal of Plant Physiology 240 (2019) 153007

Contents lists available at ScienceDirect

Journal of Plant Physiology journal homepage: www.elsevier.com/locate/jplph

Graphene oxide and ABA cotreatment regulates root growth of Brassica napus L. by regulating IAA/ABA

T

Ling-Li Xiea,1, Fan Chena,1, Xi-Ling Zoub, Si-Si Shena, Xin-Gang Wangc, Guo-Xin Yaod, ⁎ Ben-Bo Xua, a

Hubei Key Laboratory of Waterlogging Disaster and Agricultural Use of Wetland, College of Life Science, Yangtze University, Jingzhou, 434025, China Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences/Key Laboratory of Biology and Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan, 430062, China c Hubei Provincial Seed Management Bureau, Wuhan, 430070, Hubei, China d School of Life and Science Technology, Hubei Engineering University, Xiaogan, 432000, Hubei, China b

A R T I C LE I N FO

A B S T R A C T

Keywords: ABA GO IAA Root growth SA

Previous studies have proven that graphene oxide (GO) regulates abscisic acid (ABA) and indole-3-acetic acid (IAA) contents and modulates plant root growth. To better understand the mechanism of plant growth and development regulated by GO and crosstalk between ABA and GO, Zhongshuang No. 9 seedlings were treated with GO and ABA. The results indicated that GO and ABA significantly affected the morphological properties and endogenous phytohormone contents in seedlings, and there was significant crosstalk between GO and ABA. ABA treatments combined with GO led to a rapid decrease in triphenyltetrazolium chloride (TTC) reduction intensity, and the inhibitory effect was enhanced with increasing ABA concentration. The treatments significantly affected the transcriptional levels of some key genes involved in the ABA, IAA, cytokinin (CTK), salicylic acid (SA), and ethane (ETH) pathways and increased the ABA and gibberellin (GA) contents in rapeseed seedlings. The effects of the treatments on the IAA and CTK contents were complex, but, importantly, the treatments suppressed root elongation. Correlation analysis also indicated that the relationship between root length and IAA/ABA could be described by a polynomial function: y = 88.11x2 − 25.15x + 4.813(R² = 0.912). The treatments increased the ACS2 transcript abundance for ETH biosynthesis and the ICS1 transcriptional level of the key genes involved in salicylic acid (SA) biosynthesis, as well as the downstream signaling genes CBP60 and SARD1. This finding indicated that ABA is an important factor regulating the effects of GO on the growth and development of Brassica napus L., and that ETH and SA pathways may be potential pathways involved in the response of rape seedlings to GO treatment.

1. Introduction As new emerging technology, nanomaterials have many excellent physical and chemical properties (Nel et al., 2006). Nanomaterials are widely used in the fields of medicine, information technology, environmental monitoring, new energy, and agriculture (Guo et al., 2018; Mukherjee et al., 2016; Remiao et al., 2018). GO is a new type of

nanomaterial and one of the most important graphene derivatives that has been extensively studied in recent years (Xing et al., 2018). Since the discovery of GO in 2004 (Wang et al., 2011), it has been increasingly used in our daily life due to its good solubility compared to graphene (Chong et al., 2014). Research indicates that nanomaterials influence seed germination, root and shoot growth, leaf number, chlorophyll content, enzyme

Abbreviations: AAO, Abscisic acid aldehyde oxidase; ABA, Abscisic acid; ACS, 1-aminocy clopropane-1-carboxylate synthase; ARF, Auxin response factor; BAK1, Brassinosteroid insensitive 1-associated receptor kinase 1; AOS, Allene oxide synthase; BRS1, Serine carboxypeptidase; CBP60, Cam-binding protein 60-like G; CKX, Cytokinin oxidase/dehydrogenase; CPD, Cytochrome P450 superfamily protein; CTK, Cytokinin; DET2, Steroid 5-alpha-reductase; IAA, Indole-3-acetic acid; ICS1, Isochorismate synthase 1; GAMYB, Transcription factor MYB65; GA, Gibberellin; IPT, Adenosine phosphate isopentenyl transferase; LOX, Lipoxygenase; MDA, Malondialdehyde; NCED, 9-cis-epoxycarotenoid dioxygenase; SA, Salicylic acid; SARD1, Calmodulin binding protein-like protein 1; RGA, DELLA protein; SPY, UDPN-acetyl glucosamine-peptide N-acetylglucosaminyl transferase; TTC, triphenyl tetrazolium chloride; ZEP, Zeaxanthin epoxidase ⁎ Corresponding author. E-mail address: [email protected] (B.-B. Xu). 1 These authors contributed equally to this study. https://doi.org/10.1016/j.jplph.2019.153007 Received 20 March 2019; Received in revised form 26 June 2019; Accepted 30 June 2019 Available online 09 July 2019 0176-1617/ © 2019 Elsevier GmbH. All rights reserved.

Journal of Plant Physiology 240 (2019) 153007

L.-L. Xie, et al.

from those cotreated with GO and ABA for 10 days. The root length and stem height were determined with a ruler, and the fresh root weight was measured according to a previously described method (Cheng et al., 2016).

activity, amino acid metabolization, and sugar levels (Siddiqi and Husen, 2017). ZnO nanomaterials promote the root growth of soiltreated plants but inhibit the root growth of foliar-treated plants (Raliya et al., 2015). CeO2 nanomaterials increase the root growth of corn and cucumber but decrease the root growth of alfalfa and tomato (LopezMoreno et al., 2010). Numerous researchers have examined the mechanism of underlying plant growth and development by GO and have made some progress. Investigations have shown that nanomaterials are a type of stress for plants, depending on the nanomaterial type and particle size among other characteristics, which can produce excess reactive oxygen species (ROS) and can affect the metabolism of proteins, lipids, sugar, and DNA (Liu et al., 2013, 2010). In 2014, investigators found that carbon nanomaterials enter the tissues of plants and are difficult to degrade (Hu et al., 2014a, 2014b). RNA-seq in Arabidopsis thaliana revealed that nanomaterials inhibit the expression of hair-growth-related genes but up-regulate ABA and other hormone-related genes (Garcia-Sanchez et al., 2015), which indicated that nanomaterials affected the hormone levels in plants. Although much work has been done to reveal the mechanism underlying plant growth and development by GO, this mechanism remains unclear. In our previous experiments (Cheng et al., 2016), the GO treatments significantly affected the growth and ABA contents of rape seedlings. GO treatments had different effects on the root growth of wild-type (WT) tomato germplasm ‘New Yorker’ and corresponding transgenic plants (Prd29A::LeNCED1) due to the rapid accumulation of ABA in the transgenic plants (Jiao et al., 2016). Other results also indicated that ABA treatment before nanomaterial treatment resulted in retarded inhibition of nanomaterials with respect to root hair development (Garcia-Sanchez et al., 2015). To better understand the mechanism of plant growth and development regulated by GO and the crosstalk between ABA and GO, rape seedlings of Zhongshuang No. 9 were cotreated with GO and ABA, and the protective enzyme activity, ABA IAA, CTK, and GA contents, and related gene transcription levels were measured in experiments.

2.2.2. Determination of the enzyme activities of POD, CAT, SOD, TTC, and the MDA content After 10 days of GO and ABA cotreatment, the whole seedlings were used as samples and frozen at −80 °C. Then, 0.3 g sample was ground with pre-cold mortar and pestle to powder in 3 mL extraction buffer (50 mM PBS, pH = 7.8, 0.1 mM EDTA, and 4% (w/v) of polyvinyl pyrrolidone). After centrifugation for 30 min at 4 °C and 12,000g, the supernatant was collected and used for activities analysis. POD (EC 1.11.1.7), CAT (EC 1.11.1.6), and SOD (EC 1.15.1.1) enzyme activity was measured with the guaiacol oxidation method (Chen et al., 2014), H2O2 method (Cakmak and Marschner, 1992), and NBT method (Wang and Si, 2013), respectively. The MDA content was measured with the 2-thiobarbituric acid method (Cakmak and Marschner, 1992), and root activity was analyzed by the TTC method (Sheng et al., 2009). 2.2.3. Hormone quantification The whole seedlings cotreated with GO and ABA for 10 days were used as samples and frozen at −80 °C for measuring hormone content. Plant hormones were measured with high-performance liquid chromatography (HPLC). Hormones were extracted and purified according to the reported method (Ma et al., 2015) and that described in a previous study (Cheng et al., 2016).The extracts were analyzed by HPLC (Agillant1100, Waldbronn, Germany) using a C18 column, 5-μm particle size, equipped with an ultraviolet light (UV) detector (254-nm wavelength for ABA, GA, CTK, IAA) (Yao et al., 2014). The mobile phase consisted of methanol and 0.6% acetic acid solution (methanol:acetic acidsolution = 1:1) at a flow rate of 1.0 mL min−1 at 35 °C. Each HPLC sample was replicated three times. 2.2.4. Determination of transcript abundance Total RNA was extracted with Trizol reagent (Invitrogen, US). Firststrand complementary DNA (cDNA) was synthesized, and mixed genomic DNA was degraded according to the HiScript®II Q RT SuperMix for qPCR (+gDNA wiper) manual (Vazyme, China). Quantitative realtime PCR was performed with a 7300 Real-Time PCR System (Applied Biosystems, US) with AceQ Universal SYBR qPCR Master Mix (Vazyme, China), and the β-actin gene was used to normalize the sample variance. Relative quantification of the transcript abundance was calculated with the reported method (Livak and Schmittgen, 2001). The primers used for determining transcript abundance are listed in Table 2.

2. Materials and methods 2.1. Materials All experiments were performed on the main cultivar “Zhongshuang No. 9″ from the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences. Rapeseeds germinated at 25 ± 1 °C in the dark, under a 24 h photoperiod. 2.2. Methods

2.2.5. Statistical analysis of data DPS 7.05 software (Tang and Zhang, 2013) was used for significance testing, and Excel 2007 was used to construct the tables. The values are reported as the means and their standard errors. Differences were considered significant at P < 0.05 or P < 0.01.

2.2.1. Plant growth and treatments More than 360 B. napus seedlings (4 d) with uniform growth were chosen for the experiments. Eight seedlings were used in each treatment, and each treatment was conducted independently three times. The selected seedlings were moved onto a sterilized sponge in a plastic bowl in the growth chamber under a 16 h day/8 h night photoperiod with a photosynthetic photon flux density of 52 μmol/m2/s at 25 ± 1 °C. The sponges were soaked with GO (0, 5, and 25 mg/L) and ABA (0, 0.5, 5, 10, and 25 mg/L) incompletely randomized trials (Table 1). Significance was analyzed using Student’s t-test according to previous research (Cheng et al., 2016). More than three independent seedlings were randomly selected

3. Results 3.1. Effect of GO and ABA cotreatment on the growth and development of B.nAapus seedlings The effect of the GO and ABA cotreatment on plant root growth and development was examined after 10 days. Variance analysis indicated that the morphological characteristics and endogenous phytohormone contents in treated seedlings were significantly affected by GO and ABA (Table 3), and there was significant crosstalk between GO and ABA. The root length, stem length, number of adventitious roots, and contents of IAA, CTK, and ABA in rape seedlings were significantly regulated by GO and ABA treatments (P < 0.01), and ABA treatments significantly

Table 1 GO and ABA cotreatment concentrations. GO (mg/L)

0

ABA (mg/L)

0

5 0.5

5

10

25

0

25 0.5

5

10

25

0

0.5

5

10

25

2

Journal of Plant Physiology 240 (2019) 153007

L.-L. Xie, et al.

Table 2 Sequences of qPCR primers. Gene name

Primers

Sequence(5’-3’)

Accession Numbers

ACT

ACTF ACTR CKX1F CKX1R CKX5F CKX5R CKX6F CKX6R CKX7F CKX7R IPT2F IPT2R IPT3F IPT3R IPT5F IPT5R IPT7F IPT7R SPYF SPYR RGAF RGAR GAMYBF GAMYBR GA3F GA3R GA5F GA5R ARF2F ARF2R ARF8F ARF8R IAA2F IAA2R IAA3F IAA3R IAA4F IAA4R IAA7F IAA7R ZEPF ZEPR AAOF AAOR NCEDF NCEDR DET2F DET2R BAK1F BAK1R BRS1F BRS1R TCP1F TCP1R CPDF CPDR CBP60F CBP60R SARD1F SARD1R ICSF ICSR AOSF AOSR LOX2F LOX2R ACS2F ACS2R PDF1F PDF1R HELF HELR

CTGGAATTGCTGACCGTATGAG ACTTGTTGGAAAGTGCTGAGGG CCTTTCTCCCCTCTGCAGTGCA GCCTTTTGGAAGATTCTGTGACCA ACTTCACCTTCAAGCCTTCCGACT CTCATCTCCACCACCACACCGT TGGCGATCCTTACATCGGCTGT TGAGGAGTGTGGTGAGACTACTGGTGA GTTAGACGTTGTGACGGGAAATGGA GTGGTCTGGGTGGAGTGGAACTGTA ACGTATCTCCCAGACACAAATCAGTC TGTTGCATCAACGTGATGGATATTC GCTTCCAATCATCGTTGGAGGTT TCTCTAGCTTCTTCGACCATTCCAT GACGAGGTTCGCCGCATCTT GGTGCATGTTCCACTTCCACTG ACCGAAGCAGGTACAACCAATCT TCCGAGCAAGTGGTGAGGCA GCGGCTATTGATGCTTATGAGGAA CTGTGGGTGTAATCTTGTGAAACG CCCTTACCTCAAGTTCGCTCACT GACCACCTTCTCTCAACGCAAG GATAGTATTGGCGGTTATGGATGC GATTAGCCCACCTGAGACGACA ACTCAACCGAAACCGCCAAA CACCCAATAGACCATTCAAGATGC TGGTCAATCACGGCATCAGC CCCAACGCATCGCAGAAGTA CAGAGGTTTACTGGCACAATCGTT CTCAAAGCAGGAGGAGAAAGAGC CCCTGGGAGTCATTTGTGAGTAAC GGAGAGAGAGAGAGATGCGACGAA AGCGATAACGAGGAAGAATCTACACC ACCAACCAACATCCAATCTCCATC GCTTTCTTCTCTTCTCCTCCCAC GCCATCCAACAATCTGAGCCTT AACAGCCTCTCCTCCAAAGG CTCCAACAAGCATCCAGTCAC CTGCTAAGCCTCCTGCTAAAGC CCTTGTGCTCCATAGTTTCCCATA ATACTTTCACTCCTGCGGCGTC TTCTCAAGCACCACCGTTACCTAA GATTTAGGACAGGTGGAAGGAGC CACAATGAACCGAAGCCGCT GTCGCGTCAACCTCCAAGCT TCTGTTTCTCCCCGGAGAGG ATCTCTCCTCCTCTTCTCACCTTACC TCCGTCGTCGTAGTCGTTCTTG TCGTCTTCGTGGCTTCTGTATGAC CGGCTTCAAAGTCCTCGTCCAA AAGACCTGGAAAGATTCGGACAAG TCCTCCCACCTGGTTATCAGTGT CCAAATGGTATCAGCAGTGCCT AAGACCTTGTGCCGTGTGAATC CTTACCGCAAAGCCATCCAAG AGCCACCAAGAAGTCAACAATCTC GGACGCCACCACAAACACTCTA AGCATCACCGTTAGGTCTCCAGT AATCGGTGCGAAAGTTGCGA CAGTGTTGATGTGGCGAGAGGA GAATGATGCTCTTCCTCGCAGTT TCGGAGACAGAAACCTTCGGAT GCTGCTCACAACCTTCTCTTCG CATCTGCTCAATCCCTCCCATC TGCCCTTCCCACACTTCAAG TCTGGCGAACAAACTCGTCG TGCCGCATTTGATAGAGACTTGAG CGGATTTGATGGGTTGGTGAAG CATCACCCTTCTCTTCGCTGC ATGTCCCACTTGACCTCTCGC GCTGATAAACCATACTCGTGGC CGTCCAAATCCAATCCTCCATT

DQ370142

CKX1 CKX5 CKX6 CKX7 IPT2 IPT3 IPT5 IPT7 SPY RGA GAMY GA3 GA5 ARF2 ARF8 IAA2 IAA3 IAA4 IAA7 ZEP AAO NCED DET2 BAK1 BRS1 TCP1 CPD CBP60 SARD1 ICS AOS LOX ACS2 PDF1 HEL

3

Song et al. (2015)

XM_013789304 GU550519 XM_013894677 XM_013788321 NM_001341731 XM_013790234 XM_013886509 XM_013857323 XM_013874508 XM_013806290 XM_013893765 GU561839 XM_013887010 HQ260434 XM_013843569 XM_013808757 BT002334 XM_013866974 NM_120651 NM_122574 NM_106040 XM_013801791 XM_013870609 AY162143 HM450312 AY884023 FG577475

Journal of Plant Physiology 240 (2019) 153007

L.-L. Xie, et al.

Table 3 The effect of GO and ABA cotreatmenton the morphology and plant hormone content of B. napus after 10 days of treatments. Variation source

GO ABA GO × ABA

Root length (cm)

Stem length (cm)

NO. of Adventitious roots

Root fresh weight (g)

−1

ABA content (ng g FW)

−1

IAA content (ng g FW)

−1

CTK content (ng g FW)

−1

5.35** 3.89** 3.44**

1.68** 1.35** 1.24*

12.21** 8.73** 5.27**

0.15 0.17** 0.12*

161.51** 426.76** 225.37**

38.46** 33.89** 39.52**

133.37** 260.89** 152.05**

5.64** 16.93** 31.52**

GA content (mg g FW)

“*” Indicating a significant impact P < 0.05, “**” Indicating a significant impact P < 0.01.

Fig. 1. The effect of GO and ABA cotreatment on the growth of B.napus seedlings on the 10th (a) and 30th day (b) after treatment.

GO and ABA for 10 days were measured. The 5 and 25 mg/L GO treatments significantly increased the root MDA content of the seedlings. The results also showed that the 0.5–25 mg/L ABA treatments increased the MDA content. In the ABA and 5 mg/L GO cotreatment, the MDA was significantly increased with increasing ABA concentration compared with the GO treatment alone (Fig. 3a). The 5 mg/L GO treatment significantly increased the root TTC reduction intensity, but the 25 mg/L GO treatment significantly decreased the root TTC reduction intensity of the rape seedlings. The 0.5 mg/L ABA treatment increased the TTC reduction intensity, but the 5–25 mg/ L ABA treatments significantly decreased the TTC reduction intensity. Cotreatment with ABA led to a rapid decrease in the TTC reduction activity, and the inhibitory effect increased with increasing ABA concentration (Fig. 3b).

influenced the fresh weight. GO and ABA cotreatment significantly regulated the root length, root fresh weight, adventitious roots, stem length, and the contents of IAA, CTK, and ABA in rape seedlings. The root length, root fresh weight, stem length, and number of lateral roots of the seedlings treated with GO and ABA for 10 days were measured. The results indicated that the 5 mg/L GO treatment had no significant effect on root length, but the 25 mg/L GO treatment inhibited root growth (Figs. 1 and 2a). ABA cotreatment strengthened the effect of the 5–10 mg/L GO treatments, and the inhibitory effect was enhanced with increasing ABA concentration. The low-concentration ABA treatment (0.5 mg/L) had no significant effect on the number of adventitious roots, but the adventitious roots were significantly reduced under higher concentration ABA treatments (≥5 mg/L). However, the application of 0.5–25 mg/L ABA with GO decreased the number of adventitious roots and the root fresh weight of the rape seedlings (Fig. 2b and c).

3.3. Effect of GO and ABA cotreatment on the contents of ABA, IAA, CTK, and GA

3.2. Effect of GO and ABA cotreatment on the MDA content and root activities

The IAA, CTK, and ABA contents in the rape seedlings were measured after 10 days of GO and ABA cotreatment. The 25 mg/L GO

Root TTC activity and MDA content in rape seedlings treated with 4

Journal of Plant Physiology 240 (2019) 153007

L.-L. Xie, et al.

Fig. 2. The effect of GO and ABA cotreatment on root length (a), root fresh weight (b), adventitious root number (c), and stem length (d) of rape seedlings after 10 days. Values with different letters are significantly different (Student’s t-test, P < 0.01).

Fig. 3. The effect of GO and ABA treatments on MDA contents (a) and TTC reduction intensity (b) in seedlings after 10 days. Values with different letters are significantly different (Student’s t-test, P < 0.01).

significantly increased the GA content in the rape seedlings, but the 5 mg/L GO treatment had no significant effect on the GA content. GO and ABA cotreatment increased the GA content with increasing ABA concentration (Fig. 4d). These results indicated that GO enhanced the effects of ABA on the GA content.

treatment significantly increased the ABA content in treated seedlings, and the 5–25 mg/L ABA treatments also significantly increased the ABA content, but the 0.5 mg/L ABA and 5 mg/L GO treatments had no significant effect on the ABA content. The 5 mg/L GO and 5–25 mg/L ABA treatments significantly increased the ABA content (Fig. 4a). The results indicated that the 0.5–10 mg/L ABA treatments significantly reduced the content of IAA in rape seedlings, but the 25 mg/L ABA treatment significantly increased the IAA content (Fig. 4b). In the treatment in which 5 mg/L GO was combined with 0.5 or 5 mg/L ABA, there was a significant reduction in the IAA content in the rape seedlings, but 5 mg/L GO combined with 10 mg/L ABA significantly increased the IAA content (Fig. 4b). These results indicated that GO enhanced the effect of ABA on the IAA content. ABA treatment significantly increased the CTK content. GO (5 mg/ L) combined with 0.5 or 5 mg/L ABA significantly reduced the content of CTK, but 5 mg/L GO combined with 10–25 mg/L ABA significantly increased the CTK content. However, in the ABA and 25 mg/L GO cotreatment, the change in the CTK content was complex (Fig. 4c). The results indicated that 25 mg/L GO and 5–10 mg/L ABA

3.4. Effect of GO and ABA cotreatment on the transcriptional level of key genes involved in phytohormone biosynthesis The transcriptional level of key genes involved in ABA, CTK, GA, and IAA biosynthesis in seedlings subjected to cotreatment with 25 mg/ L GO and 10 mg/L ABA solution for 10 days was measured with qPCR. The 25 mg/L GO treatment increased the transcript abundance of ZEP, AAO, and NCED, which are the key genes involved in ABA synthesis (Fig. 5a). Cotreatment with 25 mg/L GO and 10 mg/L ABA increased the transcript abundance of AAO but decreased the transcript abundance of ZEP compared with GO-treated plants, but the transcript abundance remained higher than that in CK. Cotreatment with 25 mg/L GO and 10 mg/L ABA decreased the NCED transcript abundance 5

Journal of Plant Physiology 240 (2019) 153007

L.-L. Xie, et al.

Fig. 4. The effect of different concentrations of GO and ABA treatments on ABA (a), IAA (b), CTK (c), and GA (d) contents in rape seedlings after 10 days. Values with different letters are significantly different (Student’s t-test, P < 0.01).

(Fig. 5b). Cotreatment with 25 mg/L GO and 10 mg/L ABA further increased the transcript abundance of CKX1 and ITP3 but decreased the transcript abundance of CKX7, IPT5, and IPT7 compared with GOtreated plants, but the transcript abundance remained higher than that in CK. The 25 mg/L GO treatment increased the transcript abundance of

compared with CK. This result indicated that ABA treatment reduced the increased transcriptional level of key genes involved in the ABA pathway that resulted from GO treatment. The 25 mg/L GO treatment increased the transcript abundance of IPT2, ITP3, IPT5, IPT7, CKX1, and CKX7 but decreased the transcript abundance of CKX5 and CKX6 (key genes involved in the CTK pathway)

Fig. 5. The effect of 25 mg/L GO and 10 mg/L ABA treatments on the synthesis or signal transduction-related genes of ABA (a), CTK (b) and GA (c),and IAA (d) of B. napus seedlings grown under hydroponic conditions for 10 days. Values with different letters are significantly different (Student’s t-test, P < 0.05). 6

Journal of Plant Physiology 240 (2019) 153007

L.-L. Xie, et al.

4.2. ABA regulates root growth and development by crosstalk with IAA and CTK Carbon nanomaterials can affect the metabolic pathways in plants (Hu et al., 2014a, 2014b) and can regulate the germination of plant seeds and the growth of roots (Khodakovskaya et al., 2009; Lin and Xing, 2007; Zhao et al., 2015b). In previous experiments (Cheng et al., 2016), GO treatment had a significant effect on the transcriptional level of key genes related to IAA and enhanced the transcriptional level of key genes involved in ABA biosynthesis as well as significantly increased the ABA content but decreased the IAA content to regulate plant growth. Cotreatment of ABA and GO significantly decreased the NCED transcriptional level (Fig. 4a), which suggests that the response of plants to GO stress may be through the ABA pathway. A suitable ABA concentration is necessary for root development, but high concentrations of ABA may inhibit root growth (Geng et al., 2013; Wang et al., 2011). Research has shown that ABA inhibits root growth through the overproduction of reactive oxygen species (ROS) (He et al., 2012), interacting with auxin to modulate auxin transport or signaling (Wang et al., 2011; Zhao et al., 2015a). In plants, auxin regulates the transcriptional level of many auxin-responsive genes through Aux/ IAA–AUXIN RESPONSE FACTOR (ARF) auxin-signaling modules (De Smet et al., 2010). There are 22 ARFs and 29 Aux/IAA proteins in Arabidopsis (Goh et al., 2012; Guilfoyle and Hagen, 2007). The GO and ABA treatments increased the transcript abundance of ARF2, ARF8, IAA2, and IAA7 but decreased the transcript abundance of IAA3 and IAA4 involved in IAA biosynthesis (Fig. 4b). Correlation analysis indicated that the relationship between root length and IAA/ABA could be described by a polynomial function: y = 88.11x2 − 25.15x + 4.813 (R² = 0.912) (Fig. 6). This indicates that IAA/ABA is closely related to the growth of roots and that plants respond to GO stress through ABA, resulting in changes in the IAA content and thus an adjustment of the IAA/ABA ratio to regulate root growth.

Fig. 6. Correlation analysis of root length and IAA/ABA.

SPY, RGA, GAMYB, GA3, and GA5 (key genes involved in the GA pathway) (Fig. 5c). Cotreatment with 25 mg/L GO and 10 mg/L ABA decreased the transcript abundance of SPY, RGA, and GA3 but increased the transcript abundance of GAMYB and GA5 compared with the GO treatment applied alone. The results indicated that the 25 mg/L GO treatment increased the transcript abundance of ARF2, ARF8, IAA2, IAA3, IAA4, and IAA7, but cotreatment of 25 mg/L GO and 10 mg/L ABA had no significant effect on the transcript abundance of ARF2, ARF8, IAA2, IAA4, and IAA7 except for a decrease in the IAA3 transcript abundance (Fig. 5d). This result indicated that ABA treatment decreased the increased transcriptional level that resulted from GO treatment. The 25 mg/L GO treatment increased the transcript abundance of SPY, RGA, and GAMYB, GA3, and GA5, which are key genes involved in GA synthesis. Cotreatment with 25 mg/L GO and 10 mg/L ABA increased the transcript abundance of RGA and GA5 but decreased the transcript abundance of GA3 compared with GO-treated plants, but the transcript abundance remained higher than that in CK. Cotreatment with 25 mg/L GO and 10 mg/L ABA had no significant effect on the transcript abundance of SPY or GAMYB compared with CK.

4.3. Ethylene and SA pathways may be potential pathways for response to GO treatment Root growth and development are controlled by the cell division and differentiation activities of the root apical meristem (RAM) that are maintained by multiple cross talk connections between auxin and CTK (Vanstraelen and Benková, 2012). Auxin and CTK define the root apical meristem size by promoting cell division and differentiation, respectively (Vanstraelen and Benková, 2012). CTK activates transcription of the auxin repressor IAA3, which results in decreased expression of PIN FORMED (PIN) to limit auxin transport to the RAM (Vanstraelen and Benková, 2012). High CTK levels improve auxin biosynthesis in the roots, but auxin feeds back to CTK biosynthesis (Jones et al., 2010). Auxin increases cytokinin oxidase (CKX) levels to catalyze CTK degradation (Carabelli et al., 2007; Werner et al., 2006). Isopentenyl transferase (IPT) is the limiting enzyme in the biosynthesis of CTK (Brugière et al., 2008; Song et al., 2012). GO and ABA treatment increased the transcript abundance of IPT7, ITP5, IPT3, IPT2, CKX7, CKX5, and CKX1 but decreased the transcript abundance of CKX6 involved in CKX biosynthesis (Fig. 4b). The CTK level increased with increasing ABA concentration and resulted in a high IAA level. The CTK level increased with increasing GO concentration from 0 to 5 mg/L and resulted in a high IAA level. However, the CTK level remained unchanged with increasing GO concentration from 5 to 25 mg/L. In addition, the cotreatment of ABA and GO had a complex effect on CTK and IAA levels. This indicated that ABA was an important factor in the response to GO treatment, but the effect was complex, and ABA regulated root growth and development by crosstalk with IAA and CTK. Recent studies have provided substantial evidence for crosstalk among ABA, SA, JA,ET, auxins, BR, GA, and CTK in the regulation of plant defense responses (Lata and Prasad, 2011; Nakashima and Yamaguchi-Shinozaki, 2013). GO and ABA treatments affected the

4. Discussion 4.1. ABA is a key factor in the response of B.napus to GO treatments A previous study demonstrated that GO treatments affected the germination rate, root elongation, biomass, and cell morphology of cabbage, tomato, and red spinach (Zhao et al., 2015b). In previous experiments (Cheng et al., 2016), we also found that 25–100 mg/L GO treatment inhibited the root growth of rape seedlings, similar to the results of the research on rice and lettuce (Liu et al., 2015; Zhao et al., 2015b). Research has proven that nanomaterial treatments increased the activity of SOD, POD, and CAT in plants (Hu et al., 2014a, 2014b), but the mechanism is not very clear. ABA is a key hormone involved in the plant response to abiotic stresses (Fujii and Zhu, 2009). Research has shown that ABA can inhibit root growth (Finkelstein et al., 2002), and our results indicated that the 25 mg/L GO treatment increased the ABA content in B.napus. Our results also showed that a relatively high concentration of ABA (≥5 mg/ L) decreased the root length and inhibited the TTC reduction intensity of B. napus. The 5 mg/L GO treatment had no significant effect on the root length compared with the control, but cotreatment with 5 or 10 mg/L ABA inhibited rape seedling growth compared with plants treated with only 5 or 10 mg/L ABA. These results suggest that ABA is an important factor that regulates the effects of GO on the growth and development of rape seedlings, and ABA enhances the effect of GO.

7

Journal of Plant Physiology 240 (2019) 153007

L.-L. Xie, et al.

Fig. 7. The effect of 25 mg/L of GO and 10 mg/L of ABA solution on the synthesis or signal transduction-related genes of JA, BR, SA, and ETH. Values with different letters are significantly different (Student’s t-test, P < 0.05).

transcriptional level of key genes involved in BR, ETH, JA, and SA biosynthesis (Fig. 7). GO and ABA treatments increased the transcript abundance of DET2, CPD, and TCP1 but had no significant effect on the transcript abundance of BAK1 and BRS1 involved in BR biosynthesis. GO and ABA treatments had no significant effect on the transcript abundance of LOX2 and AOS involved in JA biosynthesis and had no significant effect on the transcript abundance of the JA and ETH coregulated defense-related genes HEL and PDF1 but increased the transcript abundance of ACS2 involved in ETH biosynthesis Studies have shown that ethylene affects the formation of lateral roots and adventitious roots by regulating auxin transport (Da Costa et al., 2013; Vanstraelen and Benková, 2012). The treatment increased the transcriptional level of ICS1 but decreased the transcript abundance of ICS, which are the key genes involved in SA biosynthesis (Garcion et al., 2008; Strawn et al., 2007). In addition, the treatment decreased the transcript levels of the downstream signaling genes CBP60 and SARD1. These results indicate that ethylene and SA pathways may be potential pathways for the response to GO treatment.

controls of adventitious rooting in cuttings. Front. Plant Sci. 4, 133. De Smet, I., Lau, S., Voss, U., Vanneste, S., Benjamins, R., Rademacher, E.H., Schlereth, A., De Rybel, B., Vassileva, V., Grunewald, W., Naudts, M., Levesque, M.P., Ehrismann, J.S., Inze, D., Luschnig, C., Benfey, P.N., Weijers, D., Van Montagu, M.C., Bennett, M.J., Jurgens, G., Beeckman, T., 2010. Bimodular auxin response controls organogenesis in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 107 (6), 2705–2710. Finkelstein, R.R., Gampala, S.S., Rock, C.D., 2002. Abscisic acid signaling in seeds and seedlings. Plant Cell S15–S45. Fujii, H., Zhu, J.K., 2009. Arabidopsis mutant deficient in 3 abscisic acid-activated protein kinases reveals critical roles in growth, reproduction, and stress. Proc. Natl. Acad. Sci. U. S. A. 106 (20), 8380–8385. Garcia-Sanchez, S., Bernales, I., Cristobal, S., 2015. Early response to nanoparticles in the Arabidopsis transcriptome compromises plant defence and root-hair development through salicylic acid signalling. BMC Genomics 16, 341. Garcion, C., Lohmann, A., Lamodiere, E., Catinot, J., Buchala, A., Doermann, P., Metraux, J.P., 2008. Characterization and biological function of the isochorismate synthase2 gene of Arabidopsis. Plant Physiol. 147 (3), 1279–1287. Geng, Y., Wu, R., Wee, C.W., Xie, F., Wei, X., Chan, P.M.Y., Tham, C., Duan, L., Dinneny, J.R., 2013. A spatio-temporal understanding of growth regulation during the salt stress response in Arabidopsis. Plant Cell 25 (6), 2132–2154. Goh, T., Kasahara, H., Mimura, T., Kamiya, Y., Fukaki, H., 2012. Multiple AUX/IAA-ARF modules regulate lateral root formation: the role of Arabidopsis SHY2/IAA3-mediated auxin signalling. Philosophical transactions of the Royal Society of London. Series B, Biol. Sci. 367 (1595), 1461–1468. Guilfoyle, T.J., Hagen, G., 2007. Auxin response factors. J. Plant Growth Regul. 10 (5), 453–460. Guo, R., Jiao, T.F., Li, R.F., Chen, Y., Guo, W.C., Zhang, L.X., Zhou, J.X., Zhang, Q.R., Peng, Q.M., 2018. Sandwiched Fe3O4/carboxylate graphene oxide nanostructures constructed by layer-by-layer assembly for highly efficient and magnetically recyclable dye removal. Acs. Sustain. Chem. Eng. 6 (1), 1279–1288. He, J., Duan, Y., Hua, D., Fan, G., Wang, L., Liu, Y., Chen, Z., Han, L., Qu, L.J., Gong, Z., 2012. DEXH box RNA helicase-mediated mitochondrial reactive oxygen species production in Arabidopsis mediates crosstalk between abscisic acid and auxin signaling. Plant Cell 24 (5), 1815–1833. Hu, X., Kang, J., Lu, K., Zhou, R., Mu, L., Zhou, Q., 2014a. Graphene oxide amplifies the phytotoxicity of arsenic in wheat. Sci. Rep. 4, 6122. Hu, X., Lu, K., Mu, L., Kang, J., Zhou, Q., 2014b. Interactions between graphene oxide and plant cells: regulation of cell morphology, uptake, organelle damage, oxidative effects and metabolic disorders. Carbon 80, 665–676. Jiao, J., Cheng, F., Zhang, X., Xie, L., Li, Z., Yuan, C., Xu, B., Zhang, L., 2016. Preparation of graphene oxide and its mechanism in promoting tomato roots growth. J. Nanosci. Nanotechnol. 16 (3), 1–8. Jones, B., Gunneras, S.A., Petersson, S.V., Tarkowski, P., Graham, N., May, S., Dolezal, K., Sandberg, G., Ljung, K., 2010. Cytokinin regulation of auxin synthesis in Arabidopsis involves a homeostatic feedback loop regulated via auxin and cytokinin signal transduction. Plant Cell 22 (9), 2956–2969. Khodakovskaya, M., Dervishi, E., Mahmood, M., Xu, Y., Li, Z., Watanabe, F., Biris, A.S., 2009. Carbon nanotubes are able to penetrate plant seed coat and dramatically affect seed germination and plant growth. ACS Nano 3 (10), 3221–3227. Lata, C., Prasad, M., 2011. Role of DREBs in regulation of abiotic stress responses in plants. J. Exp. Bot. 62 (14), 4731–4748. Lin, D., Xing, B., 2007. Phytotoxicity of nanoparticles: inhibition of seed germination and root growth. Environ. Pollut. 150 (2), 243–250. Liu, Q., Zhang, X., Zhao, Y., Lin, J., Shu, C., Wang, C., Fang, X., 2013. Fullerene-induced increase of glycosyl residue on living plant cell wall. Environ Sci Tech 47 (13), 7490–7498. Liu, Q., Zhao, Y., Wan, Y., Zheng, J., Zhang, X., Wang, C., Fang, X., Lin, J., 2010. Study of the inhibitory effect of water-soluble fullerenes on plant growth at the cellular level. ACS Nano 4 (10), 5743–5748. Liu, S., Wei, H., Li, Z., Li, S., Yan, H., He, Y., Tian, Z., 2015. Effects of graphene on germination and seedling morphology in rice. J. Nanosci. Nanotechnol. 15 (4), 2695–2701. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2− ΔΔ CT method. Methods 25 (4), 402–408. Lopez-Moreno, M.L., de la Rosa, G., Hernandez-Viezcas, J.A., Peralta-Videa, J.R., GardeaTorresdey, J.L., 2010. X-ray absorption spectroscopy (XAS) corroboration of the uptake and storage of CeO2 nanoparticles and assessment of their differential toxicity in four edible plant species. J. Agric. Food Chem. 58 (6), 3689–3693.

5. Conclusion The results indicated that ABA was an important factor in the response to GO treatment and that ABA regulated root growth and development through crosstalk with IAA and CTK. SA and ETH may be potential factors involved in the response of B. napus seedlings to GO treatments. Acknowledgement This work was supported by the National Key R&D Program of China (2017YFD0101700), The Scientific Research Foundation for Returned Overseas Chinese Scholars, State Education Ministry, and Educational Commission of Hubei Province of China (D20151303). References Brugière, N., Humbert, S., Rizzo, N., Bohn, J., Habben, J.E., 2008. A member of the maize isopentenyl transferase gene family, Zea mays isopentenyl transferase 2 (ZmIPT2), encodes a cytokinin biosynthetic enzyme expressed during kernel development. Plant Mol. Biol. 67 (3), 215–229. Cakmak, I., Marschner, H., 1992. Magnesium deficiency and high light intensity enhance activities of superoxide dismutase, ascorbate peroxidase, and glutathione reductase in bean leaves. Plant Physiol. 98 (4), 1222–1227. Carabelli, M., Possenti, M., Sessa, G., Ciolfi, A., Sassi, M., Morelli, G., Ruberti, I., 2007. Canopy shade causes a rapid and transient arrest in leaf development through auxininduced cytokinin oxidase activity. Gene Dev 21 (15), 1863–1868. Chen, G.Y., Chen, C.L., Tuan, H.Y., Yuan, P.X., Li, K.C., Yang, H.J., Hu, Y.C., 2014. Graphene oxide triggers Toll-like receptors/autophagy responses in vitro and inhibits tumor growth in vivo. Adv. Healthc Mater. 3 (9), 1486–1495. Cheng, F., Liu, Y.F., Lu, G.Y., Zhang, X.K., Xie, L.L., Yuan, C.F., Xu, B.B., 2016. Graphene oxide modulates root growth of Brassica napus L. And regulates ABA and IAA concentration. J. Plant Physiol. 193, 57–63. Chong, Y., Ma, Y.F., Shen, H., Tu, X.L., Zhou, X., Xu, J.Y., Dai, J.W., Fan, S.J., Zhang, Z.J., 2014. The in vitro and in vivo toxicity of graphene quantum dots. Biomaterials 35 (19), 5041–5048. Da Costa, C.T., De Almeida, M.R., Ruedell, C.M., Schwambach, J., Maraschin, F.S., FettNeto, A.G., 2013. When stress and development go hand in hand: main hormonal

8

Journal of Plant Physiology 240 (2019) 153007

L.-L. Xie, et al.

Arabidopsis isochorismate synthase functional in pathogen-induced salicylate biosynthesis exhibits properties consistent with a role in diverse stress responses. J. Biol. Chem. 282 (8), 5919–5933. Tang, Q.Y., Zhang, C.X., 2013. Data Processing System (DPS) software with experimental design, statistical analysis and data mining developed for use in entomological research. Insect Sci. 20 (2), 254–260. Vanstraelen, M., Benková, E., 2012. Hormonal interactions in the regulation of plant development. Annu. Rev. Cell Dev. Biol. 28, 463–487. Wang, L., Hua, D., He, J., Duan, Y., Chen, Z., Hong, X., Gong, Z., 2011. Auxin Response Factor2 (ARF2) and its regulated homeodomain gene HB33 mediate abscisic acid response in Arabidopsis. PLoS Genet. 7 (7), e1002172. Wang, S.E., Si, S.H., 2013. A Fluorescent nanoprobe based on graphene oxide fluorescence resonance energy transfer for the rapid determination of oncoprotein Vascular Endothelial Growth Factor (VEGF). Appl. Spectrosc. 67 (11), 1270–1274. Werner, T., Köllmer, I., Bartrina, I., Holst, K., Schmülling, T., 2006. New insights into the biology of cytokinin degradation. Plant Biol. 8 (03), 371–381. Xing, L.M., Xu, W.Y., Qu, Y.Y., Zhao, M.J., Zhu, H.L., Liu, H., Wang, H.Q., Su, X., Shao, Z.H., 2018. miR-150 regulates B lymphocyte in autoimmune hemolytic anemia/ Evans syndrome by c-Myb. Int. J. Hematol. 107 (6), 666–672. Yao, Y.Y., Dong, C.H., Yi, Y.J., Li, X., Zhang, X.M., Liu, J.Y., 2014. Regulatory function of AMP1 in ABA biosynthesis and drought resistance in Arabidopsis. J. Plant Biol. 57 (2), 117–126. Zhao, F.Y., Cai, F.X., Gao, H.J., Zhang, S.Y., Wang, K., Liu, T., Wang, X., 2015a. ABA plays essential roles in regulating root growth by interacting with auxin and MAPK signaling pathways and cell-cycle machinery in rice seedlings. Plant Growth Regul. 75 (2), 535–547. Zhao, S., Wang, Q., Zhao, Y., Rui, Q., Wang, D., 2015b. Toxicity and translocation of graphene oxide in Arabidopsis thaliana. Environ. Toxicol. Phar. 39 (1), 145–156.

Ma, C., Meir, S., Xiao, L.T., Tong, J.H., Liu, Q., Reid, M.S., Jiang, C.Z., 2015. A KNOTTED1-LIKE HOMEOBOX protein regulates abscission in tomato by modulating the auxin pathway. Plant Physiol. 167 (3), 844–853. Mukherjee, A., Majumdar, S., Servin, A.D., Pagano, L., Dhankher, O.P., White, J.C., 2016. Carbon nanomaterials in agriculture: a critical review. Front. Plant Sci. 7, 172. Nakashima, K., Yamaguchi-Shinozaki, K., 2013. ABA signaling in stress-response and seed development. Plant Cell Rep. 32 (7), 959–970. Nel, A., Xia, T., Madler, L., Li, N., 2006. Toxic potential of materials at the nanolevel. Science 311 (5761), 622–627. Raliya, R., Nair, R., Chavalmane, S., Wang, W.N., Biswas, P., 2015. Mechanistic evaluation of translocation and physiological impact of titanium dioxide and zinc oxide nanoparticles on the tomato (Solanum lycopersicum L.) plant. Metallomics 7 (12), 1584–1594. Remiao, M.H., Segatto, N.V., Pohlmann, A., Guterres, S.S., Seixas, F.K., Collares, T., 2018. The potential of nanotechnology in medically assisted reproduction. Front. Pharmacol. 8, 994. Sheng, M., Tang, M., Chen, H., Yang, B.W., Zhang, F.F., Huang, Y.H., 2009. Influence of arbuscular mycorrhizae on the root system of maize plants under salt stress. Can. J. Microbiol. 55 (7), 879–886. Siddiqi, K.S., Husen, A., 2017. Plant response to engineered metal oxide nanoparticles. Nanoscale Res. Lett. 12, 92. Song, J., Jiang, L., Jameson, P.E., 2012. Co-ordinate regulation of cytokinin gene family members during flag leaf and reproductive development in wheat. BMC Plant Biol. 12 (1), 78. Song, J., Jiang, L., Jameson, P.E., 2015. Expression patterns of Brassica napus genes implicate IPT, CKX, sucrose transporter, cell wall invertase, and amino acid permease gene family members in leaf, flower, silique, and seed development. J. Exp. Bot. 66 (16), 5067–5082. Strawn, M.A., Marr, S.K., Inoue, K., Inada, N., Zubieta, C., Wildermuth, M.C., 2007.

9