- Email: [email protected]
Growth hormone induces apelin mRNA expression and secretion in mouse 3T3-L1 adipocytes
Regulatory Peptides 139 (2007) 84 – 89 www.elsevier.com/locate/regpep
Growth hormone induces apelin mRNA expression and secretion in mouse 3T3-L1 adipocytes Susan Kralisch, Ulrike Lossner, Matthias Bluher, Ralf Paschke, Michael Stumvoll, Mathias Fasshauer ⁎ University of Leipzig, Department of Internal Medicine III, 04103 Leipzig, Germany Received 21 April 2006; received in revised form 17 October 2006; accepted 18 October 2006 Available online 28 November 2006
Abstract Recently, apelin was characterised as a novel adipose-expressed factor which is upregulated in rodent and human obesity and influences cardiovascular function, as well as insulin secretion. To clarify expression and regulation of this adipokine, apelin mRNA was measured by quantitative real-time reverse transcription-polymerase chain reaction in mouse 3T3-L1 adipocytes after treatment with various hormones known to induce insulin resistance. Interestingly, apelin synthesis was significantly upregulated by growth hormone (GH) and insulin in these cells whereas TNFα and isoproterenol did not have any effect. Thus, 500 ng/ml GH acutely induced apelin mRNA by up to 4-fold in a time-dependent fashion with significant stimulation seen at concentrations as low as 5 ng/ml effector. Furthermore, apelin secretion was assessed by enzymelinked immunoassay in mouse adipocytes. Here, secretion of this adipokine was induced 2.85-fold by GH. Studies using pharmacological inhibitors suggested that the positive effect of GH on apelin mRNA synthesis is at least in part mediated by janus kinase 2 and phosphatidylinositol 3-kinase. Taken together, our results show a significant induction of apelin mRNA synthesis and protein secretion by GH. © 2006 Elsevier B.V. All rights reserved. Keywords: 3T3-L1 adipocyte; Adipokine; Apelin; Growth hormone; Insulin; Obesity
1. Introduction About 150 million people worldwide are affected by type 2 diabetes which is characterised by insulin resistance of peripheral tissues and insufficient insulin secretion from pancreatic βcells [1]. Insulin resistance is often associated with central obesity, hypertension, polycystic ovarian syndrome, dyslipidemia, and atherosclerosis [2,3]. A better understanding of the connection between increased adiposity and impaired insulin sensitivity has been obtained in recent years [4,5]. Thus, adipocytes secrete various proteins called adipokines which profoundly influence glucose metabolism [4]. Among those, apelin is a 36 amino-acid bioactive peptide identified in 1998 as the endogenous ligand of the orphan G protein-coupled receptor, APJ [6]. In rodents and humans, mRNA
⁎ Corresponding author. Ph.-Rosenthal-Str. 27, 04103 Leipzig, Germany. Tel.: +49 341 9713318; fax: +49 341 9713389. E-mail address: [email protected] (M. Fasshauer). 0167-0115/$ - see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.regpep.2006.10.009
expression of apelin and its receptor APJ has been detected in several tissues [7–9]. Recently, apelin was suggested as a novel adipose-expressed factor involved in the regulation of cardiovascular function, fluid homeostasis, vessel formation, and cell proliferation [10]. Furthermore, apelin inhibited insulin secretion in pancreatic islets of C57BL6J mice [11], suggesting a link between this adipokine and glucose homeostasis. Furthermore, Boucher et al. demonstrated that adipocyte apelin mRNA levels, as well as plasma apelin concentrations, were not only increased in genetically obese mice as compared to lean controls but were also associated with hyperinsulinemia [12]. In accordance with these findings, adipocytes of streptozotocin-treated, insulindeficient mice showed lower apelin mRNA levels as compared to controls [12]. Higher plasma apelin levels were also found in obese humans with hyperinsulinemia as compared to lean controls [12] and a positive correlation between plasma apelin levels and the body mass index existed [13]. In recent years, it has been shown that insulin resistanceinducing hormones including catecholamines, insulin, tumor necrosis factor (TNF) α, and growth hormone (GH) mediate
S. Kralisch et al. / Regulatory Peptides 139 (2007) 84–89
85
part of their effects on insulin sensitivity by altering adipokine expression in fat cells [14]. In the current study, we investigated the effects of various hormones including GH on apelin expression in mouse 3T3-L1 adipocytes to further elucidate its role as a novel adipokine. We demonstrate for the first time that GH induces apelin mRNA expression and protein secretion. Furthermore, we present evidence that this stimulatory effect is mediated via janus kinase (Jak) 2 and phosphatidylinositol (PI) 3-kinase. 2. Materials and methods 2.1. Materials Cell culture reagents were obtained from Life Technologies, Inc. (Grand Island, NY), oligonucleotides from MWG-Biotech (Ebersberg, Germany). GH, insulin, isobutylmethylxanthine, isoproterenol, and TNFα were purchased from Sigma Chemical Co. (St. Louis, MO). AG490, Akt inhibitor, LY294002, PD98059, and rapamycin were from Calbiochem (Bad Soden, Germany). 2.2. Culture and differentiation of mouse 3T3-L1 cells Mouse 3T3-L1 cells (American Type Culture Collection, Rockville, MD) were differentiated as described [15]. In brief, confluent preadipocytes were cultured for three days in DMEM containing 25 mM glucose (DMEM-H), 10% fetal bovine serum, and antibiotics (culture medium) further supplemented with 1 μM insulin, 0.5 mM isobutylmethylxanthine, and 0.1 μM dexamethasone. After this period, they were grown for three days in culture medium with 1 μM insulin and for three to six more days in culture medium without insulin. Various effectors were added to cells starved in DMEM-H only for the indicated periods of time. At the time of the stimulation experiments at least 95% of the cells had accumulated fat droplets.
Fig. 2. GH stimulates apelin mRNA synthesis in mouse 3T3-L1 fat cells. Fully differentiated mouse 3T3-L1 adipocytes were serum-deprived overnight before GH (500 ng/ml), insulin (100 nM), isoproterenol (10 μM), and TNFα (20 ng/ml) were added for (A) 1 h or (B) 24 h. Total RNA was extracted and subjected to quantitative real-time RT-PCR determining apelin mRNA levels normalised to 36B4 expression relative to untreated control (Con) cells (=100%) as described in Materials and methods. Results are the means ± SE of at least three independent experiments. ⁎ denotes p b 0.05 comparing effector-treated with non-treated cells.
2.3. Analysis of apelin secretion Apelin secretion into 3T3-L1 cell culture supernatants was quantified with a commercially available enzyme-linked immunoassay from Phoenix Pharmaceuticals, Inc., (Belmont, USA) according to the manufacturer's instructions. 2.4. Analysis of apelin mRNA
Fig. 1. Apelin secretion is stimulated by GH. Mouse 3T3-L1 cells were serumstarved for 16 h before GH (500 ng/ml) was added for 4 h. After this period, apelin protein levels in the supernatants were determined as described in Materials and methods. Results are the means ± SEM of three independent experiments. ⁎ denotes p b 0.05 comparing GH-treated with untreated (Con) adipocytes.
Apelin mRNA synthesis was determined by quantitative realtime RT-PCR in a fluorescent temperature cycler (ABI Prism 7000, Applied Biosystems, Darmstadt, Germany) as described previously [16]. Briefly, total RNA was isolated from mouse 3T3-L1 adipocytes with TRIzol reagent (Invitrogen, Life Technologies, Inc., Carlsbad, CA) and 1 μg RNA was reverse transcribed using standard reagents (Invitrogen, Life Technologies, Inc., Carlsbad, CA). 2 μl of each RT reaction was amplified in a 26 μl PCR. After initial denaturation at 95 °C for 10 min, 40 PCR
86
S. Kralisch et al. / Regulatory Peptides 139 (2007) 84–89
2.5. Western blotting Cells were harvested in lysis buffer (50 mM HEPES, 137 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 10 mM Na4P2O7, 10 mM NaF, 2 mM EDTA, 10% glycerol, 1% Igepal CA-630, 2 mM vanadate, 2 mM phenylmethylsulfonyl fluoride, 10 μg/ml leupeptin, 10 μg/ ml aprotinin, pH 7.4) and lysates were clarified. Equal amounts of protein were resolved by SDS-PAGE, transferred to nitrocellulose membranes, blocked for 1 h, and immunoblotted with phosphospecific Akt antibodies (Cell Signaling Technology, Beverly, MA, USA) for 2 h. Specifically bound primary antibodies were detected with peroxidase-coupled secondary antibody and enhanced chemiluminescence. 2.6. Statistical analysis Results are shown as mean ± SE. The number of independent experiments performed is given in the Figure legends. Differences between various treatments were analyzed by unpaired Student's t tests with p values b0.05 considered significant. 3. Results 3.1. GH induces apelin secretion
Fig. 3. Time- and dose-dependent stimulation of apelin mRNA expression by GH. Fully differentiated mouse 3T3-L1 adipocytes were serum-deprived overnight before (A) GH (500 ng/ml) was added for the indicated periods of time or (B) various concentrations of GH were added for 1 h. Total RNA was extracted and subjected to quantitative real-time RT-PCR determining apelin mRNA levels normalised to 36B4 expression relative to untreated control cells (=100%) as described in Materials and methods. Results are the means ± SE of at least three independent experiments. ⁎ denotes p b 0.05 comparing effectortreated with non-treated cells.
cycles were performed using the following conditions: 95 °C for 15 s, 60 °C for 1 min, and 72 °C for 1 min. The following primer pairs were used: mouse apelin (accession no. NM_013912) CCCCTTTTAAGTCCTTTGGCATCT (sense) and CTCGCTAAAAAGTCCCGAAAGTAT (antisense); mouse 36B4 (accession no.NM007475) AAGCGCGTCCTGGCATTGTCT (sense) and CCGCAGGGGCAGCAGTGGT (antisense). SYBR Green I fluorescence emissions were monitored after each cycle and synthesis of apelin and 36B4 mRNA was quantified using the second derivative maximum method of the ABI Prism 7000 software (Applied Biosystems, Darmstadt, Germany). This method determines the crossing points of individual samples by an algorithm identifying the first turning point of the fluorescence curve. Apelin expression was calculated relative to 36B4 which was used as an internal control due to its resistance to hormonal regulation [17]. Specific transcripts were confirmed by melting curve profiles (cooling the sample to 68 °C and heating slowly to 95 °C with measurement of fluorescence) at the end of each PCR and the specificity of the PCR was further verified by subjecting the amplification products to agarose gel electrophoresis.
Apelin secretion into the medium was quantified in differentiated mouse 3T3-L1 cells after 4 h GH (500 ng/ml) treatment. Interestingly, GH induced apelin secretion into 3T3-L1 adipocyte supernatants 2.85-fold as compared to control conditions ( p b 0.05) (Fig. 1). 3.2. GH induces apelin mRNA synthesis in mouse 3T3-L1 fat cells We tested whether GH (500 ng/ml), insulin (100 nM), isoproterenol (10 μM), and TNFα (20 ng/ml) influence apelin
Fig. 4. Apelin mRNA induction by GH is mediated via Jak2. After overnight serumstarvation, mouse 3T3-L1 adipocytes were cultured in the presence or absence of the Jak2 inhibitor AG490 (AG, 10 μM) for 1 h before GH (500 ng/ml) was added for another 1 h. Total RNA was extracted and subjected to quantitative real-time RTPCR to determine apelin normalised to 36B4 expression as described in Materials and methods. Data are expressed relative to non-treated control (Con) cells (=100%). Results are the means ± SE of four independent experiments. ⁎ denotes p b 0.05 comparing untreated with inhibitor-pretreated or hormone-treated cells, as well as comparing hormone-treated with inhibitor-pretreated adipocytes.
S. Kralisch et al. / Regulatory Peptides 139 (2007) 84–89
mRNA expression after 1 h and 24 h of treatment. Interestingly, apelin expression increased significantly more than 4-fold after 1 h of GH treatment ( p b 0.05) (Fig. 2A) but not after 24 h (Fig. 2B). Furthermore, 100 nM insulin significantly stimulated apelin expression with a 7.5-fold induction seen after 24 h of treatment ( p b 0.05) (Fig. 2B). In contrast, isoproterenol and TNFα did not significantly influence apelin mRNA synthesis at either 1 h (Fig. 2A) or 24 h (Fig. 2B) of treatment.
87
3.3. Apelin mRNA expression is induced time- and dosedependently by GH in mouse 3T3-L1 adipocytes Treatment with 500 ng/ml GH rapidly increased apelin mRNA in a time-dependent manner with significant almost 4-fold upregulation seen after 1 h of GH-stimulation ( p b 0.05) and apelin synthesis returning to basal values as early as 4 h after effector addition (Fig. 3A). Furthermore, GH induced apelin synthesis in a dose-dependent manner after 1 h of treatment (Fig. 3B). Thus, significant 2.1-fold stimulation was observed at GH concentrations as low as 5 ng/ml and maximal 4.3-fold upregulation was seen at 50 ng/ml effector ( p b 0.05) (Fig. 3B). 3.4. Signaling molecules mediating the effect of GH on apelin expression We elucidated which signaling molecules implicated in GH signaling might mediate the positive effect on apelin expression. To this end, mouse 3T3-L1 adipocytes were pretreated with specific pharmacological inhibitors of Jak2 (AG490, 10 μM), p44/42 MAP kinase (PD98059, 50 μM), PI 3-kinase (LY294002, 10 μM), Akt (Akt inhibitor, 100 μM), and mTOR (rapamycin, 1 μM) for 1 h before GH (500 ng/ml) was added for 1 h. Treatment of mouse 3T3-L1 adipocytes with AG490 for 2 h significantly suppressed basal apelin expression to 68% of control levels ( p b 0.05) (Fig. 4). In contrast, PD98059, LY294002, Akt inhibitor, and rapamycin alone for 2 h did not significantly influence basal apelin mRNA synthesis (Fig. 5A, B). Again, apelin mRNA expression was significantly increased after 1 h of GH treatment ( p b 0.05) (Figs. 4 and 5A, B). This induction was significantly blunted to 180% of control levels in cells pretreated with the Jak2 inhibitor AG490 ( p b 0.05) (Fig. 4). Furthermore, GH-induced apelin mRNA induction was significantly blocked to 160% of untreated controls by pharmacological inhibition of PI 3-kinase with LY294002 ( p b 0.05) (Fig. 5A). In contrast, PD98059 (Fig. 5A), as well as Akt inhibitor and rapamycin (Fig. 5B), treatment did not significantly influence GH-induced apelin expression. GH time-dependently induced Akt phosphorylation with maximal effects observed after 10 min of hormonal treatment (Fig. 5C).
Fig. 5. Signaling molecules mediating induction of apelin by GH. After serum starvation, mouse 3T3-L1 cells were cultured in the presence or absence of (A) PD98059 (PD, 50 μM) and LY294002 (LY, 10 μM) or (B) Akt inhibitor (Akt-I, 100 μM) and rapamycin (Rapa, 1 μM) for 1 h before GH (500 ng/ml) was added for 1 h. Total RNA was extracted and subjected to quantitative real-time RT-PCR to determine apelin normalised to 36B4 expression as described in Materials and methods. Data are expressed relative to non-treated control (Con) cells (= 100%). Results are the means ± SE of four independent experiments. ⁎ denotes p b 0.05 comparing untreated with inhibitor-pretreated or hormone-treated cells, as well as comparing hormone-treated with inhibitorpretreated adipocytes. (C) Serum-starved mouse 3T3-L1 adipocytes were stimulated with GH (500 ng/ml) for different periods of time and Western blotting with phosphorylation-specific Akt antibodies was performed as described in Materials and methods. Insulin (Ins, 100 nM, 5 min) was included as a positive control. A representative blot of two independent experiments is shown.
4. Discussion The physiological role of apelin has been better elucidated in recent years. Thus, cardiovascular homeostasis appears as the primary target for apelin since it decreases blood pressure [8,18] and increases heart rate [18] after i.v. administration in rodents. Apelin also exerts potent positive inotropic effects in rats [19] and expression of apelin and its receptor APJ is changed in human cardiac dysfunction [20,21]. In the hypothalamus apelin and its receptor APJ seem to play a potential role in the control of pituitary hormone release [8]. Furthermore, they stimulate drinking behavior [8] and reduce food intake in rodents [22]. Beyond these well-studied functions, apelin has been suggested as a novel adipokine which is induced in human and
88
S. Kralisch et al. / Regulatory Peptides 139 (2007) 84–89
rodent obesity and impairs glucose tolerance [12]. In the current study, we demonstrate for the first time that GH significantly stimulates apelin mRNA expression and protein secretion in mouse 3T3-L1 adipocytes. GH is produced as a 22 kDa polypeptide in the anterior pituitary gland and potently antagonizes insulin signal transduction in insulin sensitive tissues such as fat, liver, and muscle in vitro [23]. Thus, patients with GH excess due to pituitary tumors are insulin resistant [24,25] and nocturnal GH secretion in diabetic patients contributes to nocturnal hyperglycemia [26]. In vivo studies have convincingly shown that insulin resistance in rats caused by chronic GH treatment is accompanied by a decrease in insulin-stimulated insulin receptor (IR) activity and IR substrate (IRS) protein phosphorylation [27,28]. Receptor dimerization and activation of the cytosolic tyrosine kinase, Jak2 is the result of GH binding to its receptor monomer [29]. Since inhibition of Jak2 by AG490 blunts basal and GH-induced apelin mRNA expression, this signaling molecule appears as a primary positive mediator of apelin expression. Downstream of Jak2, GH stimulates p44/42 MAP kinase and PI 3-kinase activity [30,31]. Since inhibition of PI 3kinase by the pharmacological inhibitor LY294002 significantly reverses the positive effect of GH on apelin mRNA, it is likely that this signaling intermediate contributes to GH-induced apelin expression. Direct activation of PI 3-kinase by GH in mouse 3T3-L1 adipocytes has already been shown recently [32]. Furthermore, we demonstrate in the current study that phosphorylation of Akt, a well-defined downstream target of PI 3-kinase, is induced by GH in these cells. However, pharmacological inhibition of Akt and mTOR is not sufficient to reverse GH-induced apelin expression. These results indicate that other downstream molecules of PI 3-kinase mediate the positive effect of GH on apelin. Here, further work is needed to more clearly define these signaling proteins. Moreover, additional work is needed to better elucidate the transcription factors involved in GH-induced apelin expression. Our data suggest that p44/42 MAP kinase is probably not involved in the regulation of apelin by GH. Besides GH, insulin has been shown to induce apelin mRNA expression and secretion in mouse adipocytes in vitro [12,33]. In accordance with these studies, we find significant stimulation of apelin mRNA synthesis after 24 h of insulin treatment. Furthermore, catecholamines and TNFα impair insulin sensitivity profoundly and contribute to obesity-related insulin resistance [4]. In the current study, both effectors do not influence apelin mRNA expression. However, it has to be pointed out that Daviaud et al. find a significant induction of apelin after TNFα treatment in vivo and in vitro [34]. In this study, TNFα induces apelin mRNA in mouse 3T3-F442A adipocytes dependent on PI 3-kinase, c-jun, JNK, and MAP kinase but not protein kinase C [34]. Differences in the adipogenic cell line and the methodology used might explain the different results in our study. Taken together, we demonstrate for the first time that GH besides insulin is a potent stimulator of apelin mRNA expression and secretion in mouse 3T3-L1 adipocytes in vitro. Furthermore, we present evidence that the positive effect of GH is mediated via Jak2 and PI 3-kinase.
Acknowledgements This study was supported by a grant from the Deutsche Forschungsgemeinschaft (DFG), KFO 152: “Atherobesity”, project FA476/4-1 (TP 4) to M.F. and the Deutsche Diabetes Gesellschaft to S.K. References [1] Matthaei S, Stumvoll, Kellerer, Haring. Pathophysiology and pharmacological treatment of insulin resistance. Endocr Rev 2000;21:585–618. [2] Saltiel AR. The molecular and physiological basis of insulin resistance: emerging implications for metabolic and cardiovascular diseases. J Clin Invest 2000;106:163–4. [3] Reaven GM. Banting Lecture 1988. Role of insulin resistance in human disease. Nutrition 1988;13:65. [4] Fasshauer M, Paschke. Regulation of adipocytokines and insulin resistance. Diabetologia 2003;46:1594–603. [5] Kahn BB, Flier. Obesity and insulin resistance. J Clin Invest 2000;106: 473–81. [6] Tatemoto K, Hosoya, Habata, Fujii, Kakegawa, Zou, Kawamata, Fukusumi, Hinuma, Kitada, Kurokawa, Onda, Fujino. Isolation and characterization of a novel endogenous peptide ligand for the human APJ receptor. Biochem Biophys Res Commun 1998;251:471–6. [7] Kawamata Y, Habata, Fukusumi, Hosoya, Fujii, Hinuma, Nishizawa, Kitada, Onda, Nishimura, Fujino. Molecular properties of apelin: tissue distribution and receptor binding. Biochim Biophys Acta 2001;1538: 162–71. [8] Lee DK, Cheng, Nguyen, Fan, Kariyawasam, Liu, Osmond, George, O'Dowd. Characterization of apelin, the ligand for the APJ receptor. J Neurochem 2000;74:34–41. [9] Medhurst AD, Jennings, Robbins, Davis, Ellis, Winborn, Lawrie, Hervieu, Riley, Bolaky, Herrity, Murdock, Darker. Pharmacological and immunohistochemical characterization of the APJ receptor and its endogenous ligand apelin. J Neurochem 2003;84:1162–72. [10] Masri B, Knibiehler, Audigier. Apelin signalling: a promising pathway from cloning to pharmacology. Cell Signal 2005;17:415–26. [11] Sorhede WM, Magnusson, Ahren. The apj receptor is expressed in pancreatic islets and its ligand, apelin, inhibits insulin secretion in mice. Regul Pept 2005;131:12–7. [12] Boucher J, Masri, Daviaud, Gesta, Guigne, Mazzucotelli, Castan-Laurell, Tack, Knibiehler, Carpene, Audigier, Saulnier-Blache, Valet. Apelin, a newly identified adipokine up-regulated by insulin and obesity. Endocrinology 2005;146:1764–71. [13] Heinonen MV, Purhonen, Miettinen, Paakkonen, Pirinen, Alhava, Akerman, Herzig. Apelin, orexin-A and leptin plasma levels in morbid obesity and effect of gastric banding. Regul Pept 2005;130:7–13. [14] Takano A, Haruta, Iwata, Usui, Uno, Kawahara, Ueno, Sasaoka, Kobayashi. Growth hormone induces cellular insulin resistance by uncoupling phosphatidylinositol 3-kinase and its downstream signals in 3t3-l1 adipocytes. Diabetes 2001;50:1891–900. [15] Kralisch S, Klein, Lossner, Bluher, Paschke, Stumvoll, Fasshauer. Hormonal regulation of the novel adipocytokine visfatin in 3T3-L1 adipocytes. J Endocrinol 2005;185:R1–8. [16] Kralisch S, Klein, Lossner, Bluher, Paschke, Stumvoll, Fasshauer. Interleukin-6 is a negative regulator of visfatin gene expression in 3T3L1 adipocytes. Am J Physiol Endocrinol Metab 2005;289:E586–90. [17] Laborda J. 36B4 cDNA used as an estradiol-independent mRNA control is the cDNA for human acidic ribosomal phosphoprotein PO. Nucleic Acids Res 1991;19:3998. [18] Cheng X, Cheng, Pang. Venous dilator effect of apelin, an endogenous peptide ligand for the orphan APJ receptor, in conscious rats. Eur J Pharmacol 2003;470:171–5. [19] Szokodi I, Tavi, Foldes, Voutilainen-Myllyla, Ilves, Tokola, Pikkarainen, Piuhola, Rysa, Toth, Ruskoaho. Apelin, the novel endogenous ligand of the orphan receptor APJ, regulates cardiac contractility. Circ Res 2002;91: 434–40.
S. Kralisch et al. / Regulatory Peptides 139 (2007) 84–89 [20] Chen MM, Ashley, Deng, Tsalenko, Deng, Tabibiazar, Ben Dor, Fenster, Yang, King, Fowler, Robbins, Johnson, Bruhn, McDonagh, Dargie, Yakhini, Tsao, Quertermous. Novel role for the potent endogenous inotrope apelin in human cardiac dysfunction. Circulation 2003;108:1432–9. [21] Foldes G, Horkay, Szokodi, Vuolteenaho, Ilves, Lindstedt, Mayranpaa, Sarman, Seres, Skoumal, Lako-Futo, deChatel, Ruskoaho, Toth. Circulating and cardiac levels of apelin, the novel ligand of the orphan receptor APJ, in patients with heart failure. Biochem Biophys Res Commun 2003;308:480–5. [22] Sunter D, Hewson, Dickson. Intracerebroventricular injection of apelin-13 reduces food intake in the rat. Neurosci Lett 2003;353:1–4. [23] Frank SJ. Growth hormone signalling and its regulation: preventing too much of a good thing. Growth Horm IGF Res 2001;11:201–12. [24] Hansen I, Tsalikian, Beaufrere, Gerich, Haymond, Rizza. Insulin resistance in acromegaly: defects in both hepatic and extrahepatic insulin action. Am J Physiol 1986;250:E269–73. [25] Rizza RA, Mandarino, Gerich. Effects of growth hormone on insulin action in man. Mechanisms of insulin resistance, impaired suppression of glucose production, and impaired stimulation of glucose utilization. Diabetes 1982;31:663–9. [26] Campbell PJ, Bolli, Cryer, Gerich. Pathogenesis of the dawn phenomenon in patients with insulin-dependent diabetes mellitus. Accelerated glucose production and impaired glucose utilization due to nocturnal surges in growth hormone secretion. N Engl J Med 1985;312:1473–9. [27] Smith TR, Elmendorf, David, Turinsky. Growth hormone-induced insulin resistance: role of the insulin receptor, IRS-1, GLUT-1, and GLUT-4. Am J Physiol 1997;272:E1071–9.
89
[28] Thirone AC, Carvalho, Brenelli, Velloso, Saad. Effect of chronic growth hormone treatment on insulin signal transduction in rat tissues. Mol Cell Endocrinol 1997;130:33–42. [29] Ridderstrale M, Groop. Differential phosphorylation of Janus kinase 2, Stat5A and Stat5B in response to growth hormone in primary rat adipocytes. Mol Cell Endocrinol 2001;183:49–54. [30] Love DW, Whatmore, Clayton, Silva. Growth hormone stimulation of the mitogen-activated protein kinase pathway is cell type specific. Endocrinology 1998;139:1965–71. [31] Ridderstrale M, Degerman, Tornqvist. Growth hormone stimulates the tyrosine phosphorylation of the insulin receptor substrate-1 and its association with phosphatidylinositol 3-kinase in primary adipocytes. J Biol Chem 1995;270:3471–4. [32] Sakaue H, Ogawa, Takata, Kuroda, Kotani, Matsumoto, Sakaue, Nishio, Ueno, Kasuga. Phosphoinositide 3-kinase is required for insulin-induced but not for growth hormone- or hyperosmolarity-induced glucose uptake in 3T3-L1 adipocytes. Mol Endocrinol 1997;11:1552–62. [33] Wei L, Hou, Tatemoto. Regulation of apelin mRNA expression by insulin and glucocorticoids in mouse 3T3-L1 adipocytes. Regul Pept 2005;132: 27–32. [34] Daviaud D, Boucher, Gesta, Dray, Guigne, Quilliot, Ayav, Ziegler, Carpene, Saulnier-Blache, Valet, Castan-Laurell. TNFalpha up-regulates apelin expression in human and mouse adipose tissue. FASEB J 2006;20:1528–30.
Growth hormone induces apelin mRNA expression and secretion in mouse 3T3-L1 adipocytes Susan Kralisch, Ulrike Lossner, Matthias Bluher, Ralf Paschke, Michael Stumvoll, Mathias Fasshauer ⁎ University of Leipzig, Department of Internal Medicine III, 04103 Leipzig, Germany Received 21 April 2006; received in revised form 17 October 2006; accepted 18 October 2006 Available online 28 November 2006
Abstract Recently, apelin was characterised as a novel adipose-expressed factor which is upregulated in rodent and human obesity and influences cardiovascular function, as well as insulin secretion. To clarify expression and regulation of this adipokine, apelin mRNA was measured by quantitative real-time reverse transcription-polymerase chain reaction in mouse 3T3-L1 adipocytes after treatment with various hormones known to induce insulin resistance. Interestingly, apelin synthesis was significantly upregulated by growth hormone (GH) and insulin in these cells whereas TNFα and isoproterenol did not have any effect. Thus, 500 ng/ml GH acutely induced apelin mRNA by up to 4-fold in a time-dependent fashion with significant stimulation seen at concentrations as low as 5 ng/ml effector. Furthermore, apelin secretion was assessed by enzymelinked immunoassay in mouse adipocytes. Here, secretion of this adipokine was induced 2.85-fold by GH. Studies using pharmacological inhibitors suggested that the positive effect of GH on apelin mRNA synthesis is at least in part mediated by janus kinase 2 and phosphatidylinositol 3-kinase. Taken together, our results show a significant induction of apelin mRNA synthesis and protein secretion by GH. © 2006 Elsevier B.V. All rights reserved. Keywords: 3T3-L1 adipocyte; Adipokine; Apelin; Growth hormone; Insulin; Obesity
1. Introduction About 150 million people worldwide are affected by type 2 diabetes which is characterised by insulin resistance of peripheral tissues and insufficient insulin secretion from pancreatic βcells [1]. Insulin resistance is often associated with central obesity, hypertension, polycystic ovarian syndrome, dyslipidemia, and atherosclerosis [2,3]. A better understanding of the connection between increased adiposity and impaired insulin sensitivity has been obtained in recent years [4,5]. Thus, adipocytes secrete various proteins called adipokines which profoundly influence glucose metabolism [4]. Among those, apelin is a 36 amino-acid bioactive peptide identified in 1998 as the endogenous ligand of the orphan G protein-coupled receptor, APJ [6]. In rodents and humans, mRNA
⁎ Corresponding author. Ph.-Rosenthal-Str. 27, 04103 Leipzig, Germany. Tel.: +49 341 9713318; fax: +49 341 9713389. E-mail address: [email protected] (M. Fasshauer). 0167-0115/$ - see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.regpep.2006.10.009
expression of apelin and its receptor APJ has been detected in several tissues [7–9]. Recently, apelin was suggested as a novel adipose-expressed factor involved in the regulation of cardiovascular function, fluid homeostasis, vessel formation, and cell proliferation [10]. Furthermore, apelin inhibited insulin secretion in pancreatic islets of C57BL6J mice [11], suggesting a link between this adipokine and glucose homeostasis. Furthermore, Boucher et al. demonstrated that adipocyte apelin mRNA levels, as well as plasma apelin concentrations, were not only increased in genetically obese mice as compared to lean controls but were also associated with hyperinsulinemia [12]. In accordance with these findings, adipocytes of streptozotocin-treated, insulindeficient mice showed lower apelin mRNA levels as compared to controls [12]. Higher plasma apelin levels were also found in obese humans with hyperinsulinemia as compared to lean controls [12] and a positive correlation between plasma apelin levels and the body mass index existed [13]. In recent years, it has been shown that insulin resistanceinducing hormones including catecholamines, insulin, tumor necrosis factor (TNF) α, and growth hormone (GH) mediate
S. Kralisch et al. / Regulatory Peptides 139 (2007) 84–89
85
part of their effects on insulin sensitivity by altering adipokine expression in fat cells [14]. In the current study, we investigated the effects of various hormones including GH on apelin expression in mouse 3T3-L1 adipocytes to further elucidate its role as a novel adipokine. We demonstrate for the first time that GH induces apelin mRNA expression and protein secretion. Furthermore, we present evidence that this stimulatory effect is mediated via janus kinase (Jak) 2 and phosphatidylinositol (PI) 3-kinase. 2. Materials and methods 2.1. Materials Cell culture reagents were obtained from Life Technologies, Inc. (Grand Island, NY), oligonucleotides from MWG-Biotech (Ebersberg, Germany). GH, insulin, isobutylmethylxanthine, isoproterenol, and TNFα were purchased from Sigma Chemical Co. (St. Louis, MO). AG490, Akt inhibitor, LY294002, PD98059, and rapamycin were from Calbiochem (Bad Soden, Germany). 2.2. Culture and differentiation of mouse 3T3-L1 cells Mouse 3T3-L1 cells (American Type Culture Collection, Rockville, MD) were differentiated as described [15]. In brief, confluent preadipocytes were cultured for three days in DMEM containing 25 mM glucose (DMEM-H), 10% fetal bovine serum, and antibiotics (culture medium) further supplemented with 1 μM insulin, 0.5 mM isobutylmethylxanthine, and 0.1 μM dexamethasone. After this period, they were grown for three days in culture medium with 1 μM insulin and for three to six more days in culture medium without insulin. Various effectors were added to cells starved in DMEM-H only for the indicated periods of time. At the time of the stimulation experiments at least 95% of the cells had accumulated fat droplets.
Fig. 2. GH stimulates apelin mRNA synthesis in mouse 3T3-L1 fat cells. Fully differentiated mouse 3T3-L1 adipocytes were serum-deprived overnight before GH (500 ng/ml), insulin (100 nM), isoproterenol (10 μM), and TNFα (20 ng/ml) were added for (A) 1 h or (B) 24 h. Total RNA was extracted and subjected to quantitative real-time RT-PCR determining apelin mRNA levels normalised to 36B4 expression relative to untreated control (Con) cells (=100%) as described in Materials and methods. Results are the means ± SE of at least three independent experiments. ⁎ denotes p b 0.05 comparing effector-treated with non-treated cells.
2.3. Analysis of apelin secretion Apelin secretion into 3T3-L1 cell culture supernatants was quantified with a commercially available enzyme-linked immunoassay from Phoenix Pharmaceuticals, Inc., (Belmont, USA) according to the manufacturer's instructions. 2.4. Analysis of apelin mRNA
Fig. 1. Apelin secretion is stimulated by GH. Mouse 3T3-L1 cells were serumstarved for 16 h before GH (500 ng/ml) was added for 4 h. After this period, apelin protein levels in the supernatants were determined as described in Materials and methods. Results are the means ± SEM of three independent experiments. ⁎ denotes p b 0.05 comparing GH-treated with untreated (Con) adipocytes.
Apelin mRNA synthesis was determined by quantitative realtime RT-PCR in a fluorescent temperature cycler (ABI Prism 7000, Applied Biosystems, Darmstadt, Germany) as described previously [16]. Briefly, total RNA was isolated from mouse 3T3-L1 adipocytes with TRIzol reagent (Invitrogen, Life Technologies, Inc., Carlsbad, CA) and 1 μg RNA was reverse transcribed using standard reagents (Invitrogen, Life Technologies, Inc., Carlsbad, CA). 2 μl of each RT reaction was amplified in a 26 μl PCR. After initial denaturation at 95 °C for 10 min, 40 PCR
86
S. Kralisch et al. / Regulatory Peptides 139 (2007) 84–89
2.5. Western blotting Cells were harvested in lysis buffer (50 mM HEPES, 137 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 10 mM Na4P2O7, 10 mM NaF, 2 mM EDTA, 10% glycerol, 1% Igepal CA-630, 2 mM vanadate, 2 mM phenylmethylsulfonyl fluoride, 10 μg/ml leupeptin, 10 μg/ ml aprotinin, pH 7.4) and lysates were clarified. Equal amounts of protein were resolved by SDS-PAGE, transferred to nitrocellulose membranes, blocked for 1 h, and immunoblotted with phosphospecific Akt antibodies (Cell Signaling Technology, Beverly, MA, USA) for 2 h. Specifically bound primary antibodies were detected with peroxidase-coupled secondary antibody and enhanced chemiluminescence. 2.6. Statistical analysis Results are shown as mean ± SE. The number of independent experiments performed is given in the Figure legends. Differences between various treatments were analyzed by unpaired Student's t tests with p values b0.05 considered significant. 3. Results 3.1. GH induces apelin secretion
Fig. 3. Time- and dose-dependent stimulation of apelin mRNA expression by GH. Fully differentiated mouse 3T3-L1 adipocytes were serum-deprived overnight before (A) GH (500 ng/ml) was added for the indicated periods of time or (B) various concentrations of GH were added for 1 h. Total RNA was extracted and subjected to quantitative real-time RT-PCR determining apelin mRNA levels normalised to 36B4 expression relative to untreated control cells (=100%) as described in Materials and methods. Results are the means ± SE of at least three independent experiments. ⁎ denotes p b 0.05 comparing effectortreated with non-treated cells.
cycles were performed using the following conditions: 95 °C for 15 s, 60 °C for 1 min, and 72 °C for 1 min. The following primer pairs were used: mouse apelin (accession no. NM_013912) CCCCTTTTAAGTCCTTTGGCATCT (sense) and CTCGCTAAAAAGTCCCGAAAGTAT (antisense); mouse 36B4 (accession no.NM007475) AAGCGCGTCCTGGCATTGTCT (sense) and CCGCAGGGGCAGCAGTGGT (antisense). SYBR Green I fluorescence emissions were monitored after each cycle and synthesis of apelin and 36B4 mRNA was quantified using the second derivative maximum method of the ABI Prism 7000 software (Applied Biosystems, Darmstadt, Germany). This method determines the crossing points of individual samples by an algorithm identifying the first turning point of the fluorescence curve. Apelin expression was calculated relative to 36B4 which was used as an internal control due to its resistance to hormonal regulation [17]. Specific transcripts were confirmed by melting curve profiles (cooling the sample to 68 °C and heating slowly to 95 °C with measurement of fluorescence) at the end of each PCR and the specificity of the PCR was further verified by subjecting the amplification products to agarose gel electrophoresis.
Apelin secretion into the medium was quantified in differentiated mouse 3T3-L1 cells after 4 h GH (500 ng/ml) treatment. Interestingly, GH induced apelin secretion into 3T3-L1 adipocyte supernatants 2.85-fold as compared to control conditions ( p b 0.05) (Fig. 1). 3.2. GH induces apelin mRNA synthesis in mouse 3T3-L1 fat cells We tested whether GH (500 ng/ml), insulin (100 nM), isoproterenol (10 μM), and TNFα (20 ng/ml) influence apelin
Fig. 4. Apelin mRNA induction by GH is mediated via Jak2. After overnight serumstarvation, mouse 3T3-L1 adipocytes were cultured in the presence or absence of the Jak2 inhibitor AG490 (AG, 10 μM) for 1 h before GH (500 ng/ml) was added for another 1 h. Total RNA was extracted and subjected to quantitative real-time RTPCR to determine apelin normalised to 36B4 expression as described in Materials and methods. Data are expressed relative to non-treated control (Con) cells (=100%). Results are the means ± SE of four independent experiments. ⁎ denotes p b 0.05 comparing untreated with inhibitor-pretreated or hormone-treated cells, as well as comparing hormone-treated with inhibitor-pretreated adipocytes.
S. Kralisch et al. / Regulatory Peptides 139 (2007) 84–89
mRNA expression after 1 h and 24 h of treatment. Interestingly, apelin expression increased significantly more than 4-fold after 1 h of GH treatment ( p b 0.05) (Fig. 2A) but not after 24 h (Fig. 2B). Furthermore, 100 nM insulin significantly stimulated apelin expression with a 7.5-fold induction seen after 24 h of treatment ( p b 0.05) (Fig. 2B). In contrast, isoproterenol and TNFα did not significantly influence apelin mRNA synthesis at either 1 h (Fig. 2A) or 24 h (Fig. 2B) of treatment.
87
3.3. Apelin mRNA expression is induced time- and dosedependently by GH in mouse 3T3-L1 adipocytes Treatment with 500 ng/ml GH rapidly increased apelin mRNA in a time-dependent manner with significant almost 4-fold upregulation seen after 1 h of GH-stimulation ( p b 0.05) and apelin synthesis returning to basal values as early as 4 h after effector addition (Fig. 3A). Furthermore, GH induced apelin synthesis in a dose-dependent manner after 1 h of treatment (Fig. 3B). Thus, significant 2.1-fold stimulation was observed at GH concentrations as low as 5 ng/ml and maximal 4.3-fold upregulation was seen at 50 ng/ml effector ( p b 0.05) (Fig. 3B). 3.4. Signaling molecules mediating the effect of GH on apelin expression We elucidated which signaling molecules implicated in GH signaling might mediate the positive effect on apelin expression. To this end, mouse 3T3-L1 adipocytes were pretreated with specific pharmacological inhibitors of Jak2 (AG490, 10 μM), p44/42 MAP kinase (PD98059, 50 μM), PI 3-kinase (LY294002, 10 μM), Akt (Akt inhibitor, 100 μM), and mTOR (rapamycin, 1 μM) for 1 h before GH (500 ng/ml) was added for 1 h. Treatment of mouse 3T3-L1 adipocytes with AG490 for 2 h significantly suppressed basal apelin expression to 68% of control levels ( p b 0.05) (Fig. 4). In contrast, PD98059, LY294002, Akt inhibitor, and rapamycin alone for 2 h did not significantly influence basal apelin mRNA synthesis (Fig. 5A, B). Again, apelin mRNA expression was significantly increased after 1 h of GH treatment ( p b 0.05) (Figs. 4 and 5A, B). This induction was significantly blunted to 180% of control levels in cells pretreated with the Jak2 inhibitor AG490 ( p b 0.05) (Fig. 4). Furthermore, GH-induced apelin mRNA induction was significantly blocked to 160% of untreated controls by pharmacological inhibition of PI 3-kinase with LY294002 ( p b 0.05) (Fig. 5A). In contrast, PD98059 (Fig. 5A), as well as Akt inhibitor and rapamycin (Fig. 5B), treatment did not significantly influence GH-induced apelin expression. GH time-dependently induced Akt phosphorylation with maximal effects observed after 10 min of hormonal treatment (Fig. 5C).
Fig. 5. Signaling molecules mediating induction of apelin by GH. After serum starvation, mouse 3T3-L1 cells were cultured in the presence or absence of (A) PD98059 (PD, 50 μM) and LY294002 (LY, 10 μM) or (B) Akt inhibitor (Akt-I, 100 μM) and rapamycin (Rapa, 1 μM) for 1 h before GH (500 ng/ml) was added for 1 h. Total RNA was extracted and subjected to quantitative real-time RT-PCR to determine apelin normalised to 36B4 expression as described in Materials and methods. Data are expressed relative to non-treated control (Con) cells (= 100%). Results are the means ± SE of four independent experiments. ⁎ denotes p b 0.05 comparing untreated with inhibitor-pretreated or hormone-treated cells, as well as comparing hormone-treated with inhibitorpretreated adipocytes. (C) Serum-starved mouse 3T3-L1 adipocytes were stimulated with GH (500 ng/ml) for different periods of time and Western blotting with phosphorylation-specific Akt antibodies was performed as described in Materials and methods. Insulin (Ins, 100 nM, 5 min) was included as a positive control. A representative blot of two independent experiments is shown.
4. Discussion The physiological role of apelin has been better elucidated in recent years. Thus, cardiovascular homeostasis appears as the primary target for apelin since it decreases blood pressure [8,18] and increases heart rate [18] after i.v. administration in rodents. Apelin also exerts potent positive inotropic effects in rats [19] and expression of apelin and its receptor APJ is changed in human cardiac dysfunction [20,21]. In the hypothalamus apelin and its receptor APJ seem to play a potential role in the control of pituitary hormone release [8]. Furthermore, they stimulate drinking behavior [8] and reduce food intake in rodents [22]. Beyond these well-studied functions, apelin has been suggested as a novel adipokine which is induced in human and
88
S. Kralisch et al. / Regulatory Peptides 139 (2007) 84–89
rodent obesity and impairs glucose tolerance [12]. In the current study, we demonstrate for the first time that GH significantly stimulates apelin mRNA expression and protein secretion in mouse 3T3-L1 adipocytes. GH is produced as a 22 kDa polypeptide in the anterior pituitary gland and potently antagonizes insulin signal transduction in insulin sensitive tissues such as fat, liver, and muscle in vitro [23]. Thus, patients with GH excess due to pituitary tumors are insulin resistant [24,25] and nocturnal GH secretion in diabetic patients contributes to nocturnal hyperglycemia [26]. In vivo studies have convincingly shown that insulin resistance in rats caused by chronic GH treatment is accompanied by a decrease in insulin-stimulated insulin receptor (IR) activity and IR substrate (IRS) protein phosphorylation [27,28]. Receptor dimerization and activation of the cytosolic tyrosine kinase, Jak2 is the result of GH binding to its receptor monomer [29]. Since inhibition of Jak2 by AG490 blunts basal and GH-induced apelin mRNA expression, this signaling molecule appears as a primary positive mediator of apelin expression. Downstream of Jak2, GH stimulates p44/42 MAP kinase and PI 3-kinase activity [30,31]. Since inhibition of PI 3kinase by the pharmacological inhibitor LY294002 significantly reverses the positive effect of GH on apelin mRNA, it is likely that this signaling intermediate contributes to GH-induced apelin expression. Direct activation of PI 3-kinase by GH in mouse 3T3-L1 adipocytes has already been shown recently [32]. Furthermore, we demonstrate in the current study that phosphorylation of Akt, a well-defined downstream target of PI 3-kinase, is induced by GH in these cells. However, pharmacological inhibition of Akt and mTOR is not sufficient to reverse GH-induced apelin expression. These results indicate that other downstream molecules of PI 3-kinase mediate the positive effect of GH on apelin. Here, further work is needed to more clearly define these signaling proteins. Moreover, additional work is needed to better elucidate the transcription factors involved in GH-induced apelin expression. Our data suggest that p44/42 MAP kinase is probably not involved in the regulation of apelin by GH. Besides GH, insulin has been shown to induce apelin mRNA expression and secretion in mouse adipocytes in vitro [12,33]. In accordance with these studies, we find significant stimulation of apelin mRNA synthesis after 24 h of insulin treatment. Furthermore, catecholamines and TNFα impair insulin sensitivity profoundly and contribute to obesity-related insulin resistance [4]. In the current study, both effectors do not influence apelin mRNA expression. However, it has to be pointed out that Daviaud et al. find a significant induction of apelin after TNFα treatment in vivo and in vitro [34]. In this study, TNFα induces apelin mRNA in mouse 3T3-F442A adipocytes dependent on PI 3-kinase, c-jun, JNK, and MAP kinase but not protein kinase C [34]. Differences in the adipogenic cell line and the methodology used might explain the different results in our study. Taken together, we demonstrate for the first time that GH besides insulin is a potent stimulator of apelin mRNA expression and secretion in mouse 3T3-L1 adipocytes in vitro. Furthermore, we present evidence that the positive effect of GH is mediated via Jak2 and PI 3-kinase.
Acknowledgements This study was supported by a grant from the Deutsche Forschungsgemeinschaft (DFG), KFO 152: “Atherobesity”, project FA476/4-1 (TP 4) to M.F. and the Deutsche Diabetes Gesellschaft to S.K. References [1] Matthaei S, Stumvoll, Kellerer, Haring. Pathophysiology and pharmacological treatment of insulin resistance. Endocr Rev 2000;21:585–618. [2] Saltiel AR. The molecular and physiological basis of insulin resistance: emerging implications for metabolic and cardiovascular diseases. J Clin Invest 2000;106:163–4. [3] Reaven GM. Banting Lecture 1988. Role of insulin resistance in human disease. Nutrition 1988;13:65. [4] Fasshauer M, Paschke. Regulation of adipocytokines and insulin resistance. Diabetologia 2003;46:1594–603. [5] Kahn BB, Flier. Obesity and insulin resistance. J Clin Invest 2000;106: 473–81. [6] Tatemoto K, Hosoya, Habata, Fujii, Kakegawa, Zou, Kawamata, Fukusumi, Hinuma, Kitada, Kurokawa, Onda, Fujino. Isolation and characterization of a novel endogenous peptide ligand for the human APJ receptor. Biochem Biophys Res Commun 1998;251:471–6. [7] Kawamata Y, Habata, Fukusumi, Hosoya, Fujii, Hinuma, Nishizawa, Kitada, Onda, Nishimura, Fujino. Molecular properties of apelin: tissue distribution and receptor binding. Biochim Biophys Acta 2001;1538: 162–71. [8] Lee DK, Cheng, Nguyen, Fan, Kariyawasam, Liu, Osmond, George, O'Dowd. Characterization of apelin, the ligand for the APJ receptor. J Neurochem 2000;74:34–41. [9] Medhurst AD, Jennings, Robbins, Davis, Ellis, Winborn, Lawrie, Hervieu, Riley, Bolaky, Herrity, Murdock, Darker. Pharmacological and immunohistochemical characterization of the APJ receptor and its endogenous ligand apelin. J Neurochem 2003;84:1162–72. [10] Masri B, Knibiehler, Audigier. Apelin signalling: a promising pathway from cloning to pharmacology. Cell Signal 2005;17:415–26. [11] Sorhede WM, Magnusson, Ahren. The apj receptor is expressed in pancreatic islets and its ligand, apelin, inhibits insulin secretion in mice. Regul Pept 2005;131:12–7. [12] Boucher J, Masri, Daviaud, Gesta, Guigne, Mazzucotelli, Castan-Laurell, Tack, Knibiehler, Carpene, Audigier, Saulnier-Blache, Valet. Apelin, a newly identified adipokine up-regulated by insulin and obesity. Endocrinology 2005;146:1764–71. [13] Heinonen MV, Purhonen, Miettinen, Paakkonen, Pirinen, Alhava, Akerman, Herzig. Apelin, orexin-A and leptin plasma levels in morbid obesity and effect of gastric banding. Regul Pept 2005;130:7–13. [14] Takano A, Haruta, Iwata, Usui, Uno, Kawahara, Ueno, Sasaoka, Kobayashi. Growth hormone induces cellular insulin resistance by uncoupling phosphatidylinositol 3-kinase and its downstream signals in 3t3-l1 adipocytes. Diabetes 2001;50:1891–900. [15] Kralisch S, Klein, Lossner, Bluher, Paschke, Stumvoll, Fasshauer. Hormonal regulation of the novel adipocytokine visfatin in 3T3-L1 adipocytes. J Endocrinol 2005;185:R1–8. [16] Kralisch S, Klein, Lossner, Bluher, Paschke, Stumvoll, Fasshauer. Interleukin-6 is a negative regulator of visfatin gene expression in 3T3L1 adipocytes. Am J Physiol Endocrinol Metab 2005;289:E586–90. [17] Laborda J. 36B4 cDNA used as an estradiol-independent mRNA control is the cDNA for human acidic ribosomal phosphoprotein PO. Nucleic Acids Res 1991;19:3998. [18] Cheng X, Cheng, Pang. Venous dilator effect of apelin, an endogenous peptide ligand for the orphan APJ receptor, in conscious rats. Eur J Pharmacol 2003;470:171–5. [19] Szokodi I, Tavi, Foldes, Voutilainen-Myllyla, Ilves, Tokola, Pikkarainen, Piuhola, Rysa, Toth, Ruskoaho. Apelin, the novel endogenous ligand of the orphan receptor APJ, regulates cardiac contractility. Circ Res 2002;91: 434–40.
S. Kralisch et al. / Regulatory Peptides 139 (2007) 84–89 [20] Chen MM, Ashley, Deng, Tsalenko, Deng, Tabibiazar, Ben Dor, Fenster, Yang, King, Fowler, Robbins, Johnson, Bruhn, McDonagh, Dargie, Yakhini, Tsao, Quertermous. Novel role for the potent endogenous inotrope apelin in human cardiac dysfunction. Circulation 2003;108:1432–9. [21] Foldes G, Horkay, Szokodi, Vuolteenaho, Ilves, Lindstedt, Mayranpaa, Sarman, Seres, Skoumal, Lako-Futo, deChatel, Ruskoaho, Toth. Circulating and cardiac levels of apelin, the novel ligand of the orphan receptor APJ, in patients with heart failure. Biochem Biophys Res Commun 2003;308:480–5. [22] Sunter D, Hewson, Dickson. Intracerebroventricular injection of apelin-13 reduces food intake in the rat. Neurosci Lett 2003;353:1–4. [23] Frank SJ. Growth hormone signalling and its regulation: preventing too much of a good thing. Growth Horm IGF Res 2001;11:201–12. [24] Hansen I, Tsalikian, Beaufrere, Gerich, Haymond, Rizza. Insulin resistance in acromegaly: defects in both hepatic and extrahepatic insulin action. Am J Physiol 1986;250:E269–73. [25] Rizza RA, Mandarino, Gerich. Effects of growth hormone on insulin action in man. Mechanisms of insulin resistance, impaired suppression of glucose production, and impaired stimulation of glucose utilization. Diabetes 1982;31:663–9. [26] Campbell PJ, Bolli, Cryer, Gerich. Pathogenesis of the dawn phenomenon in patients with insulin-dependent diabetes mellitus. Accelerated glucose production and impaired glucose utilization due to nocturnal surges in growth hormone secretion. N Engl J Med 1985;312:1473–9. [27] Smith TR, Elmendorf, David, Turinsky. Growth hormone-induced insulin resistance: role of the insulin receptor, IRS-1, GLUT-1, and GLUT-4. Am J Physiol 1997;272:E1071–9.
89
[28] Thirone AC, Carvalho, Brenelli, Velloso, Saad. Effect of chronic growth hormone treatment on insulin signal transduction in rat tissues. Mol Cell Endocrinol 1997;130:33–42. [29] Ridderstrale M, Groop. Differential phosphorylation of Janus kinase 2, Stat5A and Stat5B in response to growth hormone in primary rat adipocytes. Mol Cell Endocrinol 2001;183:49–54. [30] Love DW, Whatmore, Clayton, Silva. Growth hormone stimulation of the mitogen-activated protein kinase pathway is cell type specific. Endocrinology 1998;139:1965–71. [31] Ridderstrale M, Degerman, Tornqvist. Growth hormone stimulates the tyrosine phosphorylation of the insulin receptor substrate-1 and its association with phosphatidylinositol 3-kinase in primary adipocytes. J Biol Chem 1995;270:3471–4. [32] Sakaue H, Ogawa, Takata, Kuroda, Kotani, Matsumoto, Sakaue, Nishio, Ueno, Kasuga. Phosphoinositide 3-kinase is required for insulin-induced but not for growth hormone- or hyperosmolarity-induced glucose uptake in 3T3-L1 adipocytes. Mol Endocrinol 1997;11:1552–62. [33] Wei L, Hou, Tatemoto. Regulation of apelin mRNA expression by insulin and glucocorticoids in mouse 3T3-L1 adipocytes. Regul Pept 2005;132: 27–32. [34] Daviaud D, Boucher, Gesta, Dray, Guigne, Quilliot, Ayav, Ziegler, Carpene, Saulnier-Blache, Valet, Castan-Laurell. TNFalpha up-regulates apelin expression in human and mouse adipose tissue. FASEB J 2006;20:1528–30.