- Email: [email protected]
The transcriptional co-activator PGC-1α up regulates apelin in human and mouse adipocytes
Regulatory Peptides 150 (2008) 33–37
Contents lists available at ScienceDirect
Regulatory Peptides j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / r e g p e p
The transcriptional co-activator PGC-1α up regulates apelin in human and mouse adipocytes Anne Mazzucotelli a,b,⁎, Carole Ribet a, Isabelle Castan-Laurell a,b, Danièle Daviaud a, Charlotte Guigné a, Dominique Langin a,b,c, Philippe Valet a,b a b c
Institut National de la Santé et de la Recherche Médicale (INSERM), U858, Toulouse, France Université de Toulouse, UPS, Institut de Médecine Moléculaire de Rangueil, IFR31, Toulouse, France CHU de Toulouse, Laboratoire de Biochime, Institut Biologique de Purpan, Toulouse F-31059, France
A R T I C L E
I N F O
Article history: Received 31 October 2007 Received in revised form 13 March 2008 Accepted 8 April 2008 Available online 13 April 2008 Keywords: Apelin PGC-1α Subcutaneous adipose tissue Adipokine Adenovirus Microarray
A B S T R A C T By using pangenomic microarray, we identified apelin as a unique adipokine up regulated by the transcriptional co-activator peroxisome proliferator-activated receptor γ (PPARγ) co-activator 1α (PGC-1α) in human white adipocytes. We investigated its regulation in vitro and in vivo. Overexpression of PGC-1α by adenovirus in human adipocytes induces apelin expression and secretion. Pharmacological induction of cAMP, an upstream regulator of endogenous PGC-1α expression, up regulates apelin gene expression and also apelin secretion in human and mice adipocytes. Moreover, during cold exposure in mice, a physiological situation known to induce both cAMP and PGC-1α, apelin expression in adipocytes and plasma levels were increased. This is the first demonstration that PGC-1α is involved in the regulation of an adipokine gene expression and release. © 2008 Elsevier B.V. All rights reserved.
1. Introduction The transcriptional proliferator-activated receptor γ (PPARγ) coactivator 1α (PGC-1α) was identified by its capacity to interact with the nuclear receptor PPARγ in brown adipose tissue (BAT) in order to control the expression of uncoupling protein 1 (UCP1) [1]. PGC-1α activates gene expression through specific interaction with transcription factors that bind the promoter of metabolic genes. PGC-1α is preferentially expressed in tissues with high oxidative capacity such as heart, muscle and brown adipose tissue. In the heart, PGC-1α is highly expressed after birth and fasting (known to require strong quantity of ATP) and allows the activation of mitochondrial biogenesis [2]. Exercise and endurance training activate PGC-1α expression in skeletal muscle which promotes mitochondrial biogenesis and a metabolic switch from glycolytic to oxidative muscle fibers for the adaptation to physical activity [3]. In BAT, PGC-1α is strongly induced by cold exposure which activates mitochondrial fatty-acid oxidation and heat production through expression of UCP1 [1]. As PGC-1α appears as an important component of energy balance and as low level of PGC-1α is detectable in human white
⁎ Corresponding author. Institut National de la Santé et de la Recherche Médicale (INSERM), U858, Toulouse, France. Fax: +33 561325622. E-mail address: [email protected] (A. Mazzucotelli). 0167-0115/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.regpep.2008.04.003
adipocytes, conversion of human white adipose tissue (WAT) into thermogenic adipocyte by overexpression of this co-activator is a potential strategy to fight obesity [4,5]. Previous work for our group showed that PGC-1α overexpression in human fat cell induces expression of uncoupling protein 1 (UCP1) and stimulates fat oxidation [6]. We performed microarray experiments to get an exhaustive view at genes regulated by PGC-1α in human white adipocytes. Among the genes up regulated by PGC-1α, we found mainly genes involved in mitochondrial energy metabolism and related cytosolic pathways [7]. Very few genes encoding secreted factors were increased by PGC-1α. Among these genes, a robust increase of the newly described adipokine, apelin, was observed. Apelin is a 36 amino-acid bioactive peptide identified as an endogenous ligand of the orphan G-protein-coupled receptor APJ [8,9]. The mRNA expression of this peptide in rodents and in humans has been identified in the central nervous system and periphery [10–13]. The apelin peptide has also been described in the bloodstream [14,15]. Previous work from our group demonstrated that apelin is expressed and secreted by both human and mice adipocytes [16]. A recent study has shown that a chronic intraperitoneal treatment with apelin regulates adiposity and lipid metabolism in mice by the induction of UCPs and a rise in thermogenesis [17]. These data suggest that apelin could be a novel adipocyte derived factor involved in the regulation of energy metabolism. The molecular mechanism of the regulation of apelin expression is poorly described. In adipose tissue, apelin expression increases during adipogenesis [16,18].
34
A. Mazzucotelli et al. / Regulatory Peptides 150 (2008) 33–37
Table 1 Primers used in real time quantitative PCR Gene
Species
Sense primer
Antisense primer
PGC1α Apelin Apelin
Murine/ human Human Murine
AAAGGATGCGCTCTCGTTCA
GGAATATGGTGATCGGGAACA
research. Human adipocytes in primary culture were differentiated as described by Hauner et al. [21] with modifications [22]. At day 13, 60– 80% of cells were differentiated into lipid droplet-containing adipocytes. 2.2. Adenoviral expression system
GCGGTTATGTCTCCTCCATAGATT GTGCGAGGTGAGAGCTGAATG TCTTGGCTCTTCCCTCTTTTCA GTGCTGGAATCCACTGGAGAA
We have shown that insulin and TNFα up regulates apelin expression in WAT but also increases plasma apelin levels suggesting adipose tissue as a major contributor to blood apelin levels [16,19]. Moreover, glucocorticoids and growth hormone respectively down and up regulates apelin in 3T3-L1 adipocytes [18,20]. In this study, we show that the transcriptional co-activator PGC-1α up regulates the expression of apelin in human white adipocytes. Adipocyte treatment with forskolin and isobutylmethylxanthine (IBMX), which increase intracellular cAMP levels, results in an induction of PGC-1α and an induction of both apelin mRNA expression and peptide secretion. Moreover, cold exposure of mice, a physiological situation known to induce both cAMP production and PGC-1α expression in white fat pad, was also associated with an increase of apelin expression and secretion. It is the first demonstration that the coactivator PGC-1α is involved in the regulation of an adipokine. 2. Materials and methods 2.1. Primary cultures of human preadipocytes Subcutaneous abdominal WAT was obtained from women undergoing plastic surgery in agreement with French laws on biomedical
Recombinant adenoviruses were generated as described [23]. The full-length human PGC-1α cDNA [24] was cloned into the pAdEasy parent plasmid. Recombination between the pAdEasy and pAdTrack vectors and production of the PGC-1α adenovirus was performed at the Laboratoire de Thérapie Génique de Nantes. The virus contains, in tandem, the green fluorescent protein (GFP) gene and the PGC-1α cDNA downstream of separate cytomegalovirus promoters. An adenovirus containing only the GFP gene was used as control. For experiments with adenovirus, differentiated adipocytes were harvested 48 h after adenofection unless otherwise indicated for mRNA assays. 2.3. Microarray experiments We performed the adenofection of four adipocyte cultures, each one obtained from women with a body mass index of 23 ± 2 kg/m2. 72 h after adenofection, the cells were lysed and total RNA was extracted using RNeasy kit (Qiagen). RNA quality was checked by capillary electrophoresis (Experion, BioRad). Fluorescent probes were obtained by amplifying and labelling 500 ng of RNA with the low RNA input linear amplification kit (Agilent). RNA from the cells expressing GFP was labelled with Cy3 and RNA from PGC-1α overexpressing cells with Cy5. 1 µg of Cy5 labelled probe was co-hybridized the same amount of the corresponding Cy3 labelled control probe. We used the whole
Fig. 1. PGC-1α overexpression induces apelin expression in human white adipocytes. PGC-1α (A) and apelin (B) mRNA levels in primary cultures of human white adipocytes 48 h after transduction with PGC-1α adenovirus. (n = 3,⁎P b 0.05, ⁎⁎P b 0.01). (C) Protein level of apelin in supernatant of human white adipocytes 72 h after transduction with PGC-1α adenovirus. (n = 3,⁎P b 0.05). Time dose–response of PGC-1α (D) and apelin (E) mRNA levels in primary cultures of human white adipocytes after transduction with PGC-1α adenovirus. (n = 3,⁎P b 0.05). Data are expressed as fold change relative to the control adipocytes infected with GFP adenovirus.
A. Mazzucotelli et al. / Regulatory Peptides 150 (2008) 33–37
35
human genome oligo microarray from Agilent with the gene expression hybridization kit according to the manufacturer's protocol (number G4112A). Microarrays were scanned on a 4000A Axon scanner and data were extracted with Feature Extraction (9.5.1.1, Agilent). The data were normalized with the Lowess procedure without background subtraction and only the features with a signal to background ratio equal or over 1.5 were analysed (between 18,090 and 18,686 features). The differentially expressed genes were determined with the use of the one class analysis of the Significant Analysis of Microarray software.
2.7. Animals
2.4. Cell culture of 3T3F442A adipocytes
2.8. Apelin assay
As previously described by Boucher et al. [16], mouse 3T3F442A preadipocytes were grown in Dulbecco's Modified Eagle's Medium (DMEM) containing 10% donor calf serum, 25 mM glucose, 100 U/ml penicillin,100 µg/ml streptomycin. At confluent step, differentiation was induced by incubating cells with DMEM supplemented with 10% fetal calf serum and 50 nM insulin for 8 to 10 days. At that time, more that 90% of the cells had accumulated fat droplets. All experiments have been done in triplicates.
Apelin protein level in supernatant was quantified using the Apelin-12 non selective immuno-assay kit (Phoenix Pharmaceuticals).
Studies with mice followed the Inserm and Louis Bugnard Institute Animal Care Facility guidelines. 14 weeks old male B6D2/F1 mice were obtained from Elevage Janvier (France), weight: 28.2 ± 2.7 g. For cold exposure experiments, the mice were fasted and maintained at 4 °C for 24 h. The tissues were dissected out, snap frozen in liquid nitrogen and stored at −80 °C until extraction. Total RNA was prepared from the fat pads for reverse transcriptase quantitative PCR analyses.
2.9. Statistical methods Data are expressed as mean ± S.E.M. The data were compared by non-parametric Wilcoxon tests for paired data. 3. Results
2.5. IBMX and forskolin treatments Differentiated adipocytes were treated with forskolin at 10 µM and with IBMX at 200 µM. After 48 h of treatments, cells were harvested for mRNA assays. 2.6. Reverse transcription and quantitative PCR analysis Reverse transcription-quantitative PCR analysis was performed as previously described [7]. Primers were designed using the Primer Express 1.5 software (Table 1). Some mRNAs were quantified using pre-made gene expression assays (Applied Biosystems). 18S ribosomal RNA was used as control to normalize gene expression using the ribosomal RNA control Taqman assay kit (Applied Biosystems).
3.1. PGC-1α regulates apelin expression and secretion in human white adipocytes Primary cultures of human subcutaneous adipocytes were transduced with the adenovirus encoding the human form of PGC-1α. Adenofection was performed on fully differentiated adipocytes in order to avoid the effect of PGC-1α expression during adipogenesis. As previously shown, only differentiated adipocytes were transduced [6]. Microarray experiments were carried out to identify new targets of this co-activator. Statistical analysis were performed and allowed the identification of 1818 clones up regulated (False discovery rate of 0,5%). Analysis of classically described secreted factors revealed that apelin was up regulated 1.8 fold by PGC-1α. Confirmation of microarray data was performed using
Fig. 2. Effects of treatment with IBMX and forskolin on apelin expression and secretion in adipocytes. Primary cultures of human adipocytes or 3T3F442A cells were incubated with 10 µM of forskolin and 200 µM IBMX for 48 h. (A) PGC-1α and apelin mRNA levels in primary cultures of human white adipocytes (n = 3,⁎P b 0.05,). (B) PGC-1α and apelin mRNA levels in 3T3F442A cells. (n = 3,⁎P b 0.05, ⁎⁎P b 0.01). (C) Apelin concentration in the supernatant of primary cultures of human white adipocytes. (n = 3,⁎P b 0.05). (D) Apelin concentration in supernatant of 3T3F442A cells (n = 3,⁎P b 0.05). Data are expressed as fold change relative to the control adipocytes treated with DMSO.
36
A. Mazzucotelli et al. / Regulatory Peptides 150 (2008) 33–37
Fig. 3. In vivo regulation of apelin. Mice were exposed for 24 h to cold, PGC-1α and apelin mRNA levels were quantified in epididymal WAT (A). Data are expressed as fold change relative to room temperature condition (n = 5,⁎P b 0.05).
reverse transcription-quantitative PCR. A 3-fold increase in apelin mRNA expression is observed in PGC-1α mRNA overexpressing adipocytes (Fig. 1A and B). The increase in mRNA level was associated with an increase of secreted apelin peptide level (Fig. 1C). Kinetic studies revealed that the induction of apelin mRNA expression appears as early as 24 h after adenoviral infection (Fig. 1D and E). 3.2. IBMX and forskolin treatments induce PGC-1α expression and apelin production in adipocytes We investigated whether the regulation of apelin expression is obtained after a pharmacological induction of endogenous PGC-1α. An increase in cAMP levels induces the expression of PGC-1α in human white adipocytes as shown in mouse brown fat [1]. Previous works have shown that a treatment with forskolin, an activator of adenylyl cyclase, induces PGC-1α expression in adipocytes [25]. So we treated primary cultures of differentiated human adipocytes with forskolin and IBMX, a phosphodiesterase inhibitor. The induction of PGC-1α expression was associated with an increase of apelin mRNA expression (Fig. 2A). A similar regulation was observed in 3T3-F442A adipocytes (Fig. 2B). Moreover, in these both cellular models, this treatment induces a significant secretion of apelin in the culture medium (Fig. 2C and D). 3.3. Cold exposure increases apelin expression in mouse WAT and apelin plasma levels In order to investigate the regulation of apelin by PGC-1α in vivo, we exposed mice to the cold, a physiological situation known to increase intracellular cAMP levels and to induce PGC-1α expression in fat pads of mice [7]. After 24 h at 4 °C, both PGC-1α expression and apelin mRNA levels are increased (Fig. 3). Furthermore, after cold exposure plasma apelin increases from 320 ± 70 pg/ml to 929 ± 81 pg/ ml. 4. Discussion PGC-1α function has been associated with the regulation of large clusters of genes controlling oxidative phosphorylation and mitochondrial activity [26]. To promote fatty acids utilization in adipocyte could be an attractive strategy for the treatment of obesity. Recently, we have shown by microarray experiments that expression of PGC-1α in human white adipocytes specialized in storage of energy induces the expression of genes involved in mitochondrial and fatty metabolism [7]. In the present study, the search for PGC-1α-regulated secretory factors led to
the identification of apelin. We confirmed the regulation of apelin expression and secretion by PGC-1α in human white adipocytes after adenoviral infection. Pharmacological treatments with forskolin and IBMX in human and murine adipocytes induced PGC-1α expression which was associated with a robust increase of both apelin expression and secretion. Finally, we observed that cold exposure, a physiological situation known to induce both cAMP production and PGC-1α expression, is also followed by a stronger production of apelin. PGC-1α is a transcriptional co-activator as such, cannot directly interact with DNA but rather regulates gene expression via interaction with nuclear receptors. PGC-1α has the ability to interact with many different transcription factors. PGC-1α can act with the orphan nuclear receptor estrogen-related receptor α (ERRα), with members of the peroxisome proliferator-activated receptor nuclear receptor family (PPARα, PPARγ, PPARβ/δ) or with the nuclear respiratory factors 1 and 2 (NRF1 and 2) [27]. The search of responsive elements for PPARs in the human promoter of apelin by Genomatix software analysis has shown the presence of several PPAR responsive element. We tested on human differentiated adipocytes PPARα (GW7647), PPARγ (BRL) and PPARδ/β agonists on apelin expression. However, PPAR agonist treatments have no effect on apelin gene expression (data not shown). Further studies will be necessary to identify the partner of PGC-1α in the regulation of apelin expression. Treatment with cAMP-inducing agents reveals a stronger increase of apelin expression than PGC-1α itself suggesting that PGC-1α may only contribute to part of the regulation of apelin by cAMP. Moreover, several cAMP response element have been identified by Genomatix analysis in both the human and murine promoters of apelin suggesting a role for members of the CREB family. This could explain the robust induction of apelin expression observed after a treatment with forskolin and IBMX. The difference between PGC-1α overexpression and forskolin and IBMX treatment on apelin expression level could also be explained by the fact that only 50% of differentiated adipocytes are transduced with adenovirus while forskolin and IBMX treatment act on all 100% of the cells. In mouse, cold exposure activates sympathetic nervous system which, in turn, induces the rise in PGC-1α expression in BAT. PGC-1α is a key player in the control of adaptive thermogenesis [1]. In our study, cold exposure led to an increased expression of PGC-1α in adipose tissues followed by an increase of both apelin expression and secretion. Recent data have shown that apelin treatment in mouse increased UCP1 expression in BAT associated with a rise of O2 consumption and a decrease of respiratory quotient [17]. Since apelin is a circulating adipokine, we can hypothesize that apelin could mediate the effects of PGC-1α in adipose tissue. In conclusion, this is the first study implying PGC-1α in the regulation of a secretory factor and particularly in the regulation of an adipokine. However, further studies will be necessary to determine more precisely the cellular mechanisms by which PGC-1α regulate apelin expression and the consequences of such an apelin increase on energy metabolism. Acknowledgements We gratefully acknowledge the animal facilities staff (service de zootechnie IFR31). We thank the Vector Core of the University Hospital of Nantes supported by the Association Française contre les Myopathies for the production of adenovirus vectors. The authors' work is supported by Inserm, the Programme National de Recherche sur le Diabète (to Dominique Langin), the Agence National de la Recherche program on Cardiovascular Disease, Diabetes and Obesity (FAIR project to Dominique Langin) and the project “Hepatic and adipose tissue and functions in the metabolic syndrome” (HEPADIP, see http://www.hepadip.org/), which is supported by the European Commission as an Integrated Project under the 6th Framework Programme (Contract LSHM-CT-2005-018734 to Dominique Langin).
A. Mazzucotelli et al. / Regulatory Peptides 150 (2008) 33–37
References [1] Puigserver P, Wu Z, Park CW, Graves R, Wright M, Spiegelman BM. A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 1998;92:829–39. [2] Lehman JJ, Barger PM, Kovacs A, Saffitz JE, Medeiros DM, Kelly DP. Peroxisome proliferator-activated receptor gamma coactivator-1 promotes cardiac mitochondrial biogenesis. J Clin Invest 2000;106:847–56. [3] Baar K, Wende AR, Jones TE, Marison M, Nolte LA, Chen M, Kelly DP, Holloszy JO. Adaptations of skeletal muscle to exercise: rapid increase in the transcriptional coactivator PGC-1. Faseb J 2002;16:1879–86. [4] Tiraby C, Langin D. Conversion from white to brown adipocytes: a strategy for the control of fat mass? Trends Endocrinol Metab 2003;14:439–41. [5] Klein J, Perwitz N, Kraus D, Fasshauer M. Adipose tissue as source and target for novel therapies. Trends Endocrinol Metab 2006;17:26–32. [6] Tiraby C, Tavernier G, Lefort C, Larrouy D, Bouillaud F, Ricquier D, Langin D. Acquirement of brown fat cell features by human white adipocytes. J Biol Chem 2003;278:33370–6. [7] Mazzucotelli A, Viguerie N, Tiraby C, Annicotte JS, Mairal A, Klimcakova E, Lepin E, Delmar P, Dejean S, Tavernier G, Lefort C, Hidalgo J, Pineau T, Fajas L, Clement K, Langin D. The transcriptional coactivator PGC-1{alpha} and the nuclear receptor PPAR{alpha} control the expression of glycerol kinase and metabolism genes independently of PPAR{gamma} activation in human white adipocytes. Diabetes 2007;56:24–67. [8] O'Dowd BF, Heiber M, Chan A, Heng HH, Tsui LC, Kennedy JL, Shi X, Petronis A, George SR, Nguyen T. A human gene that shows identity with the gene encoding the angiotensin receptor is located on chromosome 11. Gene 1993;136:355–60. [9] Tatemoto K, Hosoya M, Habata Y, Fujii R, Kakegawa T, Zou MX, Kawamata Y, Fukusumi S, Hinuma S, Kitada C, Kurokawa T, Onda H, Fujino M. Isolation and characterization of a novel endogenous peptide ligand for the human APJ receptor. Biochem Biophys Res Commun 1998;251:471–6. [10] Lee DK, Cheng R, Nguyen T, Fan T, Kariyawasam AP, Liu Y, Osmond DH, George SR, O'Dowd BF. Characterization of apelin, the ligand for the APJ receptor. J Neurochem 2000;74:34–41. [11] Kawamata Y, Habata Y, Fukusumi S, Hosoya M, Fujii R, Hinuma S, Nishizawa N, Kitada C, Onda H, Nishimura O, Fujino M. Molecular properties of apelin: tissue distribution and receptor binding. Biochim Biophys Acta 2001;1538:162–71. [12] Medhurst AD, Jennings CA, Robbins MJ, Davis RP, Ellis C, Winborn KY, Lawrie KW, Hervieu G, Riley G, Bolaky JE, Herrity NC, Murdock P, Darker JG. Pharmacological and immunohistochemical characterization of the APJ receptor and its endogenous ligand apelin. J Neurochem 2003;84:1162–72. [13] Kleinz MJ, Davenport AP. Emerging roles of apelin in biology and medicine. Pharmacol Ther 2005;107:198–211. [14] Foldes G, Horkay F, Szokodi I, Vuolteenaho O, Ilves M, Lindstedt KA, Mayranpaa M, Sarman B, Seres L, Skoumal R, Lako-Futo Z, deChatel R, Ruskoaho H, Toth M.
[15]
[16]
[17]
[18] [19]
[20]
[21]
[22]
[23] [24]
[25]
[26]
[27]
37
Circulating and cardiac levels of apelin, the novel ligand of the orphan receptor APJ, in patients with heart failure. Biochem Biophys Res Commun 2003;30:480–5. Kleinz MJ, Davenport AP. Immunocytochemical localization of the endogenous vasoactive peptide apelin to human vascular and endocardial endothelial cells. Regul Pept 2004;118:119–25. Boucher J, Masri B, Daviaud D, Gesta S, Guigne C, Mazzucotelli A, Castan-Laurell I, Tack I, Knibiehler B, Carpene C, Audigier Y, Saulnier-Blache JS, Valet P. Apelin, a newly identified adipokine up-regulated by insulin and obesity. Endocrinology 2005;146:1764–71. Higuchi K, Masaki T, Gotoh K, Chiba S, Katsuragi I, Tanaka K, Kakuma T, Yoshimatsu H. Apelin, an APJ receptor ligand, regulates body adiposity and favors the mRNA expression of uncoupling proteins in mice. Endocrinology 2007. Wei L, Hou X, Tatemoto K. Regulation of apelin mRNA expression by insulin and glucocorticoids in mouse 3T3-L1 adipocytes. Regul Pept 2005;132:27–32. Daviaud D, Boucher J, Gesta S, Dray C, Guigne C, Quilliot D, Ayav A, Ziegler O, Carpene C, Saulnier-Blache JS, Valet P, Castan-Laurell I. TNFalpha up-regulates apelin expression in human and mouse adipose tissue. Faseb J 2006;20:1528–30. Kralisch S, Lossner U, Bluher M, Paschke R, Stumvoll M, Fasshauer M. Growth hormone induces apelin mRNA expression and secretion in mouse 3T3-L1 adipocytes. Regul Pept 2007;139:84–9. Hauner H, Entenmann G, Wabitsch M, Gaillard D, Ailhaud G, Negrel R, Pfeiffer EF. Promoting effect of glucocorticoids on the differentiation of human adipocyte precursor cells cultured in a chemically defined medium. J Clin Invest 1989;84:1663–70. Smih F, Rouet P, Lucas S, Mairal A, Sengenes C, Lafontan M, Vaulont S, Casado M, Langin D. Transcriptional regulation of adipocyte hormone-sensitive lipase by glucose. Diabetes 2002;51:293–300. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B. A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci U S A 1998;95:2509–14. Larrouy D, Vidal H, Andreelli F, Laville M, Langin D. Cloning and mRNA tissue distribution of human PPARgamma coactivator-1. Int J Obes Relat Metab Disord 1999;23:1327–32. Bogacka I, Ukropcova B, McNeil M, Gimble JM, Smith SR. Structural and functional consequences of mitochondrial biogenesis in human adipocytes in vitro. J Clin Endocrinol Metab 2005;90:6650–6. Mootha VK, Lindgren CM, Eriksson KF, Subramanian A, Sihag S, Lehar J, Puigserver P, Carlsson E, Ridderstrale M, Laurila E, Houstis N, Daly MJ, Patterson N, Mesirov JP, Golub TR, Tamayo P, Spiegelman B, Lander ES, Hirschhorn JN, Altshuler D, Groop LC. PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet 2003;34:267–73. Lin J, Handschin C, Spiegelman BM. Metabolic control through the PGC-1 family of transcription coactivators. Cell Metab 2005;1:361–70.
Contents lists available at ScienceDirect
Regulatory Peptides j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / r e g p e p
The transcriptional co-activator PGC-1α up regulates apelin in human and mouse adipocytes Anne Mazzucotelli a,b,⁎, Carole Ribet a, Isabelle Castan-Laurell a,b, Danièle Daviaud a, Charlotte Guigné a, Dominique Langin a,b,c, Philippe Valet a,b a b c
Institut National de la Santé et de la Recherche Médicale (INSERM), U858, Toulouse, France Université de Toulouse, UPS, Institut de Médecine Moléculaire de Rangueil, IFR31, Toulouse, France CHU de Toulouse, Laboratoire de Biochime, Institut Biologique de Purpan, Toulouse F-31059, France
A R T I C L E
I N F O
Article history: Received 31 October 2007 Received in revised form 13 March 2008 Accepted 8 April 2008 Available online 13 April 2008 Keywords: Apelin PGC-1α Subcutaneous adipose tissue Adipokine Adenovirus Microarray
A B S T R A C T By using pangenomic microarray, we identified apelin as a unique adipokine up regulated by the transcriptional co-activator peroxisome proliferator-activated receptor γ (PPARγ) co-activator 1α (PGC-1α) in human white adipocytes. We investigated its regulation in vitro and in vivo. Overexpression of PGC-1α by adenovirus in human adipocytes induces apelin expression and secretion. Pharmacological induction of cAMP, an upstream regulator of endogenous PGC-1α expression, up regulates apelin gene expression and also apelin secretion in human and mice adipocytes. Moreover, during cold exposure in mice, a physiological situation known to induce both cAMP and PGC-1α, apelin expression in adipocytes and plasma levels were increased. This is the first demonstration that PGC-1α is involved in the regulation of an adipokine gene expression and release. © 2008 Elsevier B.V. All rights reserved.
1. Introduction The transcriptional proliferator-activated receptor γ (PPARγ) coactivator 1α (PGC-1α) was identified by its capacity to interact with the nuclear receptor PPARγ in brown adipose tissue (BAT) in order to control the expression of uncoupling protein 1 (UCP1) [1]. PGC-1α activates gene expression through specific interaction with transcription factors that bind the promoter of metabolic genes. PGC-1α is preferentially expressed in tissues with high oxidative capacity such as heart, muscle and brown adipose tissue. In the heart, PGC-1α is highly expressed after birth and fasting (known to require strong quantity of ATP) and allows the activation of mitochondrial biogenesis [2]. Exercise and endurance training activate PGC-1α expression in skeletal muscle which promotes mitochondrial biogenesis and a metabolic switch from glycolytic to oxidative muscle fibers for the adaptation to physical activity [3]. In BAT, PGC-1α is strongly induced by cold exposure which activates mitochondrial fatty-acid oxidation and heat production through expression of UCP1 [1]. As PGC-1α appears as an important component of energy balance and as low level of PGC-1α is detectable in human white
⁎ Corresponding author. Institut National de la Santé et de la Recherche Médicale (INSERM), U858, Toulouse, France. Fax: +33 561325622. E-mail address: [email protected] (A. Mazzucotelli). 0167-0115/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.regpep.2008.04.003
adipocytes, conversion of human white adipose tissue (WAT) into thermogenic adipocyte by overexpression of this co-activator is a potential strategy to fight obesity [4,5]. Previous work for our group showed that PGC-1α overexpression in human fat cell induces expression of uncoupling protein 1 (UCP1) and stimulates fat oxidation [6]. We performed microarray experiments to get an exhaustive view at genes regulated by PGC-1α in human white adipocytes. Among the genes up regulated by PGC-1α, we found mainly genes involved in mitochondrial energy metabolism and related cytosolic pathways [7]. Very few genes encoding secreted factors were increased by PGC-1α. Among these genes, a robust increase of the newly described adipokine, apelin, was observed. Apelin is a 36 amino-acid bioactive peptide identified as an endogenous ligand of the orphan G-protein-coupled receptor APJ [8,9]. The mRNA expression of this peptide in rodents and in humans has been identified in the central nervous system and periphery [10–13]. The apelin peptide has also been described in the bloodstream [14,15]. Previous work from our group demonstrated that apelin is expressed and secreted by both human and mice adipocytes [16]. A recent study has shown that a chronic intraperitoneal treatment with apelin regulates adiposity and lipid metabolism in mice by the induction of UCPs and a rise in thermogenesis [17]. These data suggest that apelin could be a novel adipocyte derived factor involved in the regulation of energy metabolism. The molecular mechanism of the regulation of apelin expression is poorly described. In adipose tissue, apelin expression increases during adipogenesis [16,18].
34
A. Mazzucotelli et al. / Regulatory Peptides 150 (2008) 33–37
Table 1 Primers used in real time quantitative PCR Gene
Species
Sense primer
Antisense primer
PGC1α Apelin Apelin
Murine/ human Human Murine
AAAGGATGCGCTCTCGTTCA
GGAATATGGTGATCGGGAACA
research. Human adipocytes in primary culture were differentiated as described by Hauner et al. [21] with modifications [22]. At day 13, 60– 80% of cells were differentiated into lipid droplet-containing adipocytes. 2.2. Adenoviral expression system
GCGGTTATGTCTCCTCCATAGATT GTGCGAGGTGAGAGCTGAATG TCTTGGCTCTTCCCTCTTTTCA GTGCTGGAATCCACTGGAGAA
We have shown that insulin and TNFα up regulates apelin expression in WAT but also increases plasma apelin levels suggesting adipose tissue as a major contributor to blood apelin levels [16,19]. Moreover, glucocorticoids and growth hormone respectively down and up regulates apelin in 3T3-L1 adipocytes [18,20]. In this study, we show that the transcriptional co-activator PGC-1α up regulates the expression of apelin in human white adipocytes. Adipocyte treatment with forskolin and isobutylmethylxanthine (IBMX), which increase intracellular cAMP levels, results in an induction of PGC-1α and an induction of both apelin mRNA expression and peptide secretion. Moreover, cold exposure of mice, a physiological situation known to induce both cAMP production and PGC-1α expression in white fat pad, was also associated with an increase of apelin expression and secretion. It is the first demonstration that the coactivator PGC-1α is involved in the regulation of an adipokine. 2. Materials and methods 2.1. Primary cultures of human preadipocytes Subcutaneous abdominal WAT was obtained from women undergoing plastic surgery in agreement with French laws on biomedical
Recombinant adenoviruses were generated as described [23]. The full-length human PGC-1α cDNA [24] was cloned into the pAdEasy parent plasmid. Recombination between the pAdEasy and pAdTrack vectors and production of the PGC-1α adenovirus was performed at the Laboratoire de Thérapie Génique de Nantes. The virus contains, in tandem, the green fluorescent protein (GFP) gene and the PGC-1α cDNA downstream of separate cytomegalovirus promoters. An adenovirus containing only the GFP gene was used as control. For experiments with adenovirus, differentiated adipocytes were harvested 48 h after adenofection unless otherwise indicated for mRNA assays. 2.3. Microarray experiments We performed the adenofection of four adipocyte cultures, each one obtained from women with a body mass index of 23 ± 2 kg/m2. 72 h after adenofection, the cells were lysed and total RNA was extracted using RNeasy kit (Qiagen). RNA quality was checked by capillary electrophoresis (Experion, BioRad). Fluorescent probes were obtained by amplifying and labelling 500 ng of RNA with the low RNA input linear amplification kit (Agilent). RNA from the cells expressing GFP was labelled with Cy3 and RNA from PGC-1α overexpressing cells with Cy5. 1 µg of Cy5 labelled probe was co-hybridized the same amount of the corresponding Cy3 labelled control probe. We used the whole
Fig. 1. PGC-1α overexpression induces apelin expression in human white adipocytes. PGC-1α (A) and apelin (B) mRNA levels in primary cultures of human white adipocytes 48 h after transduction with PGC-1α adenovirus. (n = 3,⁎P b 0.05, ⁎⁎P b 0.01). (C) Protein level of apelin in supernatant of human white adipocytes 72 h after transduction with PGC-1α adenovirus. (n = 3,⁎P b 0.05). Time dose–response of PGC-1α (D) and apelin (E) mRNA levels in primary cultures of human white adipocytes after transduction with PGC-1α adenovirus. (n = 3,⁎P b 0.05). Data are expressed as fold change relative to the control adipocytes infected with GFP adenovirus.
A. Mazzucotelli et al. / Regulatory Peptides 150 (2008) 33–37
35
human genome oligo microarray from Agilent with the gene expression hybridization kit according to the manufacturer's protocol (number G4112A). Microarrays were scanned on a 4000A Axon scanner and data were extracted with Feature Extraction (9.5.1.1, Agilent). The data were normalized with the Lowess procedure without background subtraction and only the features with a signal to background ratio equal or over 1.5 were analysed (between 18,090 and 18,686 features). The differentially expressed genes were determined with the use of the one class analysis of the Significant Analysis of Microarray software.
2.7. Animals
2.4. Cell culture of 3T3F442A adipocytes
2.8. Apelin assay
As previously described by Boucher et al. [16], mouse 3T3F442A preadipocytes were grown in Dulbecco's Modified Eagle's Medium (DMEM) containing 10% donor calf serum, 25 mM glucose, 100 U/ml penicillin,100 µg/ml streptomycin. At confluent step, differentiation was induced by incubating cells with DMEM supplemented with 10% fetal calf serum and 50 nM insulin for 8 to 10 days. At that time, more that 90% of the cells had accumulated fat droplets. All experiments have been done in triplicates.
Apelin protein level in supernatant was quantified using the Apelin-12 non selective immuno-assay kit (Phoenix Pharmaceuticals).
Studies with mice followed the Inserm and Louis Bugnard Institute Animal Care Facility guidelines. 14 weeks old male B6D2/F1 mice were obtained from Elevage Janvier (France), weight: 28.2 ± 2.7 g. For cold exposure experiments, the mice were fasted and maintained at 4 °C for 24 h. The tissues were dissected out, snap frozen in liquid nitrogen and stored at −80 °C until extraction. Total RNA was prepared from the fat pads for reverse transcriptase quantitative PCR analyses.
2.9. Statistical methods Data are expressed as mean ± S.E.M. The data were compared by non-parametric Wilcoxon tests for paired data. 3. Results
2.5. IBMX and forskolin treatments Differentiated adipocytes were treated with forskolin at 10 µM and with IBMX at 200 µM. After 48 h of treatments, cells were harvested for mRNA assays. 2.6. Reverse transcription and quantitative PCR analysis Reverse transcription-quantitative PCR analysis was performed as previously described [7]. Primers were designed using the Primer Express 1.5 software (Table 1). Some mRNAs were quantified using pre-made gene expression assays (Applied Biosystems). 18S ribosomal RNA was used as control to normalize gene expression using the ribosomal RNA control Taqman assay kit (Applied Biosystems).
3.1. PGC-1α regulates apelin expression and secretion in human white adipocytes Primary cultures of human subcutaneous adipocytes were transduced with the adenovirus encoding the human form of PGC-1α. Adenofection was performed on fully differentiated adipocytes in order to avoid the effect of PGC-1α expression during adipogenesis. As previously shown, only differentiated adipocytes were transduced [6]. Microarray experiments were carried out to identify new targets of this co-activator. Statistical analysis were performed and allowed the identification of 1818 clones up regulated (False discovery rate of 0,5%). Analysis of classically described secreted factors revealed that apelin was up regulated 1.8 fold by PGC-1α. Confirmation of microarray data was performed using
Fig. 2. Effects of treatment with IBMX and forskolin on apelin expression and secretion in adipocytes. Primary cultures of human adipocytes or 3T3F442A cells were incubated with 10 µM of forskolin and 200 µM IBMX for 48 h. (A) PGC-1α and apelin mRNA levels in primary cultures of human white adipocytes (n = 3,⁎P b 0.05,). (B) PGC-1α and apelin mRNA levels in 3T3F442A cells. (n = 3,⁎P b 0.05, ⁎⁎P b 0.01). (C) Apelin concentration in the supernatant of primary cultures of human white adipocytes. (n = 3,⁎P b 0.05). (D) Apelin concentration in supernatant of 3T3F442A cells (n = 3,⁎P b 0.05). Data are expressed as fold change relative to the control adipocytes treated with DMSO.
36
A. Mazzucotelli et al. / Regulatory Peptides 150 (2008) 33–37
Fig. 3. In vivo regulation of apelin. Mice were exposed for 24 h to cold, PGC-1α and apelin mRNA levels were quantified in epididymal WAT (A). Data are expressed as fold change relative to room temperature condition (n = 5,⁎P b 0.05).
reverse transcription-quantitative PCR. A 3-fold increase in apelin mRNA expression is observed in PGC-1α mRNA overexpressing adipocytes (Fig. 1A and B). The increase in mRNA level was associated with an increase of secreted apelin peptide level (Fig. 1C). Kinetic studies revealed that the induction of apelin mRNA expression appears as early as 24 h after adenoviral infection (Fig. 1D and E). 3.2. IBMX and forskolin treatments induce PGC-1α expression and apelin production in adipocytes We investigated whether the regulation of apelin expression is obtained after a pharmacological induction of endogenous PGC-1α. An increase in cAMP levels induces the expression of PGC-1α in human white adipocytes as shown in mouse brown fat [1]. Previous works have shown that a treatment with forskolin, an activator of adenylyl cyclase, induces PGC-1α expression in adipocytes [25]. So we treated primary cultures of differentiated human adipocytes with forskolin and IBMX, a phosphodiesterase inhibitor. The induction of PGC-1α expression was associated with an increase of apelin mRNA expression (Fig. 2A). A similar regulation was observed in 3T3-F442A adipocytes (Fig. 2B). Moreover, in these both cellular models, this treatment induces a significant secretion of apelin in the culture medium (Fig. 2C and D). 3.3. Cold exposure increases apelin expression in mouse WAT and apelin plasma levels In order to investigate the regulation of apelin by PGC-1α in vivo, we exposed mice to the cold, a physiological situation known to increase intracellular cAMP levels and to induce PGC-1α expression in fat pads of mice [7]. After 24 h at 4 °C, both PGC-1α expression and apelin mRNA levels are increased (Fig. 3). Furthermore, after cold exposure plasma apelin increases from 320 ± 70 pg/ml to 929 ± 81 pg/ ml. 4. Discussion PGC-1α function has been associated with the regulation of large clusters of genes controlling oxidative phosphorylation and mitochondrial activity [26]. To promote fatty acids utilization in adipocyte could be an attractive strategy for the treatment of obesity. Recently, we have shown by microarray experiments that expression of PGC-1α in human white adipocytes specialized in storage of energy induces the expression of genes involved in mitochondrial and fatty metabolism [7]. In the present study, the search for PGC-1α-regulated secretory factors led to
the identification of apelin. We confirmed the regulation of apelin expression and secretion by PGC-1α in human white adipocytes after adenoviral infection. Pharmacological treatments with forskolin and IBMX in human and murine adipocytes induced PGC-1α expression which was associated with a robust increase of both apelin expression and secretion. Finally, we observed that cold exposure, a physiological situation known to induce both cAMP production and PGC-1α expression, is also followed by a stronger production of apelin. PGC-1α is a transcriptional co-activator as such, cannot directly interact with DNA but rather regulates gene expression via interaction with nuclear receptors. PGC-1α has the ability to interact with many different transcription factors. PGC-1α can act with the orphan nuclear receptor estrogen-related receptor α (ERRα), with members of the peroxisome proliferator-activated receptor nuclear receptor family (PPARα, PPARγ, PPARβ/δ) or with the nuclear respiratory factors 1 and 2 (NRF1 and 2) [27]. The search of responsive elements for PPARs in the human promoter of apelin by Genomatix software analysis has shown the presence of several PPAR responsive element. We tested on human differentiated adipocytes PPARα (GW7647), PPARγ (BRL) and PPARδ/β agonists on apelin expression. However, PPAR agonist treatments have no effect on apelin gene expression (data not shown). Further studies will be necessary to identify the partner of PGC-1α in the regulation of apelin expression. Treatment with cAMP-inducing agents reveals a stronger increase of apelin expression than PGC-1α itself suggesting that PGC-1α may only contribute to part of the regulation of apelin by cAMP. Moreover, several cAMP response element have been identified by Genomatix analysis in both the human and murine promoters of apelin suggesting a role for members of the CREB family. This could explain the robust induction of apelin expression observed after a treatment with forskolin and IBMX. The difference between PGC-1α overexpression and forskolin and IBMX treatment on apelin expression level could also be explained by the fact that only 50% of differentiated adipocytes are transduced with adenovirus while forskolin and IBMX treatment act on all 100% of the cells. In mouse, cold exposure activates sympathetic nervous system which, in turn, induces the rise in PGC-1α expression in BAT. PGC-1α is a key player in the control of adaptive thermogenesis [1]. In our study, cold exposure led to an increased expression of PGC-1α in adipose tissues followed by an increase of both apelin expression and secretion. Recent data have shown that apelin treatment in mouse increased UCP1 expression in BAT associated with a rise of O2 consumption and a decrease of respiratory quotient [17]. Since apelin is a circulating adipokine, we can hypothesize that apelin could mediate the effects of PGC-1α in adipose tissue. In conclusion, this is the first study implying PGC-1α in the regulation of a secretory factor and particularly in the regulation of an adipokine. However, further studies will be necessary to determine more precisely the cellular mechanisms by which PGC-1α regulate apelin expression and the consequences of such an apelin increase on energy metabolism. Acknowledgements We gratefully acknowledge the animal facilities staff (service de zootechnie IFR31). We thank the Vector Core of the University Hospital of Nantes supported by the Association Française contre les Myopathies for the production of adenovirus vectors. The authors' work is supported by Inserm, the Programme National de Recherche sur le Diabète (to Dominique Langin), the Agence National de la Recherche program on Cardiovascular Disease, Diabetes and Obesity (FAIR project to Dominique Langin) and the project “Hepatic and adipose tissue and functions in the metabolic syndrome” (HEPADIP, see http://www.hepadip.org/), which is supported by the European Commission as an Integrated Project under the 6th Framework Programme (Contract LSHM-CT-2005-018734 to Dominique Langin).
A. Mazzucotelli et al. / Regulatory Peptides 150 (2008) 33–37
References [1] Puigserver P, Wu Z, Park CW, Graves R, Wright M, Spiegelman BM. A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 1998;92:829–39. [2] Lehman JJ, Barger PM, Kovacs A, Saffitz JE, Medeiros DM, Kelly DP. Peroxisome proliferator-activated receptor gamma coactivator-1 promotes cardiac mitochondrial biogenesis. J Clin Invest 2000;106:847–56. [3] Baar K, Wende AR, Jones TE, Marison M, Nolte LA, Chen M, Kelly DP, Holloszy JO. Adaptations of skeletal muscle to exercise: rapid increase in the transcriptional coactivator PGC-1. Faseb J 2002;16:1879–86. [4] Tiraby C, Langin D. Conversion from white to brown adipocytes: a strategy for the control of fat mass? Trends Endocrinol Metab 2003;14:439–41. [5] Klein J, Perwitz N, Kraus D, Fasshauer M. Adipose tissue as source and target for novel therapies. Trends Endocrinol Metab 2006;17:26–32. [6] Tiraby C, Tavernier G, Lefort C, Larrouy D, Bouillaud F, Ricquier D, Langin D. Acquirement of brown fat cell features by human white adipocytes. J Biol Chem 2003;278:33370–6. [7] Mazzucotelli A, Viguerie N, Tiraby C, Annicotte JS, Mairal A, Klimcakova E, Lepin E, Delmar P, Dejean S, Tavernier G, Lefort C, Hidalgo J, Pineau T, Fajas L, Clement K, Langin D. The transcriptional coactivator PGC-1{alpha} and the nuclear receptor PPAR{alpha} control the expression of glycerol kinase and metabolism genes independently of PPAR{gamma} activation in human white adipocytes. Diabetes 2007;56:24–67. [8] O'Dowd BF, Heiber M, Chan A, Heng HH, Tsui LC, Kennedy JL, Shi X, Petronis A, George SR, Nguyen T. A human gene that shows identity with the gene encoding the angiotensin receptor is located on chromosome 11. Gene 1993;136:355–60. [9] Tatemoto K, Hosoya M, Habata Y, Fujii R, Kakegawa T, Zou MX, Kawamata Y, Fukusumi S, Hinuma S, Kitada C, Kurokawa T, Onda H, Fujino M. Isolation and characterization of a novel endogenous peptide ligand for the human APJ receptor. Biochem Biophys Res Commun 1998;251:471–6. [10] Lee DK, Cheng R, Nguyen T, Fan T, Kariyawasam AP, Liu Y, Osmond DH, George SR, O'Dowd BF. Characterization of apelin, the ligand for the APJ receptor. J Neurochem 2000;74:34–41. [11] Kawamata Y, Habata Y, Fukusumi S, Hosoya M, Fujii R, Hinuma S, Nishizawa N, Kitada C, Onda H, Nishimura O, Fujino M. Molecular properties of apelin: tissue distribution and receptor binding. Biochim Biophys Acta 2001;1538:162–71. [12] Medhurst AD, Jennings CA, Robbins MJ, Davis RP, Ellis C, Winborn KY, Lawrie KW, Hervieu G, Riley G, Bolaky JE, Herrity NC, Murdock P, Darker JG. Pharmacological and immunohistochemical characterization of the APJ receptor and its endogenous ligand apelin. J Neurochem 2003;84:1162–72. [13] Kleinz MJ, Davenport AP. Emerging roles of apelin in biology and medicine. Pharmacol Ther 2005;107:198–211. [14] Foldes G, Horkay F, Szokodi I, Vuolteenaho O, Ilves M, Lindstedt KA, Mayranpaa M, Sarman B, Seres L, Skoumal R, Lako-Futo Z, deChatel R, Ruskoaho H, Toth M.
[15]
[16]
[17]
[18] [19]
[20]
[21]
[22]
[23] [24]
[25]
[26]
[27]
37
Circulating and cardiac levels of apelin, the novel ligand of the orphan receptor APJ, in patients with heart failure. Biochem Biophys Res Commun 2003;30:480–5. Kleinz MJ, Davenport AP. Immunocytochemical localization of the endogenous vasoactive peptide apelin to human vascular and endocardial endothelial cells. Regul Pept 2004;118:119–25. Boucher J, Masri B, Daviaud D, Gesta S, Guigne C, Mazzucotelli A, Castan-Laurell I, Tack I, Knibiehler B, Carpene C, Audigier Y, Saulnier-Blache JS, Valet P. Apelin, a newly identified adipokine up-regulated by insulin and obesity. Endocrinology 2005;146:1764–71. Higuchi K, Masaki T, Gotoh K, Chiba S, Katsuragi I, Tanaka K, Kakuma T, Yoshimatsu H. Apelin, an APJ receptor ligand, regulates body adiposity and favors the mRNA expression of uncoupling proteins in mice. Endocrinology 2007. Wei L, Hou X, Tatemoto K. Regulation of apelin mRNA expression by insulin and glucocorticoids in mouse 3T3-L1 adipocytes. Regul Pept 2005;132:27–32. Daviaud D, Boucher J, Gesta S, Dray C, Guigne C, Quilliot D, Ayav A, Ziegler O, Carpene C, Saulnier-Blache JS, Valet P, Castan-Laurell I. TNFalpha up-regulates apelin expression in human and mouse adipose tissue. Faseb J 2006;20:1528–30. Kralisch S, Lossner U, Bluher M, Paschke R, Stumvoll M, Fasshauer M. Growth hormone induces apelin mRNA expression and secretion in mouse 3T3-L1 adipocytes. Regul Pept 2007;139:84–9. Hauner H, Entenmann G, Wabitsch M, Gaillard D, Ailhaud G, Negrel R, Pfeiffer EF. Promoting effect of glucocorticoids on the differentiation of human adipocyte precursor cells cultured in a chemically defined medium. J Clin Invest 1989;84:1663–70. Smih F, Rouet P, Lucas S, Mairal A, Sengenes C, Lafontan M, Vaulont S, Casado M, Langin D. Transcriptional regulation of adipocyte hormone-sensitive lipase by glucose. Diabetes 2002;51:293–300. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B. A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci U S A 1998;95:2509–14. Larrouy D, Vidal H, Andreelli F, Laville M, Langin D. Cloning and mRNA tissue distribution of human PPARgamma coactivator-1. Int J Obes Relat Metab Disord 1999;23:1327–32. Bogacka I, Ukropcova B, McNeil M, Gimble JM, Smith SR. Structural and functional consequences of mitochondrial biogenesis in human adipocytes in vitro. J Clin Endocrinol Metab 2005;90:6650–6. Mootha VK, Lindgren CM, Eriksson KF, Subramanian A, Sihag S, Lehar J, Puigserver P, Carlsson E, Ridderstrale M, Laurila E, Houstis N, Daly MJ, Patterson N, Mesirov JP, Golub TR, Tamayo P, Spiegelman B, Lander ES, Hirschhorn JN, Altshuler D, Groop LC. PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet 2003;34:267–73. Lin J, Handschin C, Spiegelman BM. Metabolic control through the PGC-1 family of transcription coactivators. Cell Metab 2005;1:361–70.