- Email: [email protected]
Guinea pig 11β-hydroxysteroid dehydrogenase type 1: primary structure and catalytic properties☆
Steroids 65 (2000) 148 –156
Guinea pig 11-hydroxysteroid dehydrogenase type 1: primary structure and catalytic properties夞 X. Pu, K. Yang* The Lawson Research Institute, St. Joseph’s Health Centre, Departments of Obstetrics and Gynecology and Physiology, University of Western Ontario, 268 Grosvenor Street, London, Ontario, Canada N6A 4V2 Received 10 August 1999; received in revised form 23 September 1999; accepted 5 October 1999
Abstract The 11-hydroxysteroid dehydrogenase type 1 (11-HSD1) enzyme is responsible for the interconversion of glucocorticoids and their inactive metabolites, and thus modulates the intracellular level of bioactive glucocorticoids. The present study was designed to clone and characterize 11-HSD1 in the guinea pig, a laboratory animal known for resistance to glucocorticoids. The cDNA encoding guinea pig 11-HSD1 was cloned by a modified 3⬘-RACE (rapid amplification of cDNA ends) protocol using the hepatic RNA as template. The cloned cDNA encodes a protein of 300 amino acids that shares 71 to 74% sequence identity with other known mammalian 11-HSD1 proteins. Sequence comparison analysis revealed that the deduced guinea pig 11-HSD1 was longer, by eight amino acids at the C terminus, than those of other mammals. Moreover, one of the two absolutely conserved consensus sites for N-glycosylation was absent. To examine the functional significance of these structural changes, we also characterized 11-HSD1 activity in the hepatic microsomes. Although the guinea pig hepatic enzyme was NADP(H)-dependent and reversible, it displayed equal affinity for cortisol and cortisone (apparent Km for both substrates was 3 M). This is in marked contrast to 11-HSD1 in other mammals whose affinity for cortisone is approximately 10 times higher than that for cortisol (apparent Km of 0.3 vs. 3.0 M). The apparent lower affinity of the guinea pig enzyme for cortisone would suggest that the intracellular bioformation of cortisol from circulating cortisone may be less efficient in this species. Northern blot analysis and RT-PCR revealed that the mRNA for 11-HSD1 was widely expressed in the adult guinea pig but at low amounts. In conclusion, the present study has identified distinct features in the deduced primary structure and catalytic function of 11-HSD1 in the guinea pig. Thus, the guinea pig provides a useful model in which the structural determinants of catalytic function of 11-HSD1 may be studied. © 2000 Elsevier Science Inc. All rights reserved. Keywords: 11-HSD1; cDNA and protein sequence; mRNA; Enzyme properties; Guinea pigs; Glucocorticoid resistance
1. Introduction The intracellular enzyme 11-hydroxysteroid dehydrogenase (11-HSD) catalyzes the interconversion of bioactive glucocorticoids (cortisol and corticosterone) and their inert metabolites (cortisone and 11-dehydrocorticosterone). In mammals, two distinct isozymes of 11-HSD, known as 11-HSD1 and 2, have been identified, cloned and characterized [1]. 11-HSD1 is a low affinity NADP(H)-dependent dehydrogenase (cortisol to cortisone)/reductase (corti夞 This work was supported by the Canadian MRC (Grant MT-12100 to K.Y.). K. Yang is an Ontario Ministry of Health Career Scientist. * Corresponding author. Tel.: ⫹1-519-646-6100; fax: ⫹1-519-6466110. E-mail address: [email protected] (K. Yang)
sone to cortisol) enzyme, with an apparent Km for glucocorticoids in the M range [2,3]. This enzyme is widely expressed in glucocorticoid target tissues, most notably the liver [4,5]. In intact cells, 11-HSD1 functions predominantly as a reductase generating cortisol from cortisone that circulates largely in the free, unbound form [6]. Although it has been proposed that 11-HSD1 regulates the intracellular level of bioactive glucocorticoids, the precise physiological role of this enzyme in individual target sites remains obscure. In contrast, 11-HSD2 is a high affinity NAD-dependent unidirectional dehydrogenase enzyme, with an apparent Km for glucocorticoids in the nM range [7–10]. The expression of this isozyme is restricted to the placenta, where it is proposed to serve as a barrier to protect the fetus from high levels of maternal glucocorticoids [11,12], and to aldoste-
0039-128X/00/$ – see front matter © 2000 Elsevier Science Inc. All rights reserved. PII: S 0 0 3 9 - 1 2 8 X ( 9 9 ) 0 0 0 9 8 - 7
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
rone-target organs such as the kidney [8], where it protects the nonselective mineralocorticoid receptors from high circulating levels of glucocorticoids [13,14]. Deficiencies in this enzyme, either congenital (caused by mutations in the gene encoding 11-HSD2) or acquired (through liquorice ingestion), leads to the syndrome of apparent mineralocorticoid excess (AME) in which cortisol acts as a mineralocorticoid causing hypertension and hypokalemia [15–17]. The guinea pig, a laboratory animal known for resistance to glucocorticoids, displays a number of anomalies in its glucocorticoid signal transduction pathway [18,19]. First, plasma levels of total cortisol (free and protein bound) are at least 3 to 4⫻ higher than those in the human [20]. This is due to the hyper-adrenal secretion of cortisol caused by a superactive ACTH [21]. The enhanced potency of the guinea pig ACTH has been attributed to a point mutation in the gene encoding the ACTH precursor peptide, POMC [22]. Second, plasma levels of free cortisol, which is considered bioactive, are even higher owing to a low affinity corticosteroid binding globulin (CBG) [20]. Third, the guinea pig glucocorticoid receptor (GR) has an affinity for its ligand 10 to 20 times lower than that of its mammalian counterparts [23,24]. This probably explains why this animal is able to tolerate such high levels of cortisol in its circulation. There is increasing evidence that tissue sensitivity to glucocorticoids is determined not only by their levels in circulation and their intracellular receptors (GRs) but also by the intracellular 11-HSD enzymes [25]. Given that 11-HSD1 and GRs are co-localized in glucocorticoid target tissues [26], the present study was undertaken to determine if 11-HSD1 in the guinea pig possesses distinct features with respect to primary structure and catalytic function, to adapt themselves to the elevated glucocorticoid environment.
2. Experimental 2.1. Reagents and supplies [1,2,6,7-3H(N)]-Cortisol (80 Ci/mmol) was purchased from Du Pont Canada Inc. (Markham, Ontario, Canada). [1,2,6,7-3H(N)]-Cortisone was prepared from [1,2,6,73 H(N)]cortisol in our laboratory as described previously [10]. Nonradioactive steroids were obtained from Steraloids Inc. (Wilton, NH, USA). Co-factors (NAD, NADP, NADH, and NADPH) were purchased from Sigma Chemicals (St. Louis, MO, USA). Polyester-backed TLC plates were obtained from Fisher Scientific Ltd. (Unionville, Ontario, Canada). All solvents used were OmniSolv grade from BDH Inc. (Toronto, Ontario, Canada). General molecular biology reagents were from Gibco BRL or Pharmacia Canada Inc. (Baie D’Urte, Quebec, Canada). The cDNAs used in this study, including a mouse 18S rRNA cDNA (Dr. D.T. Denhardt, Rutgers University, Newmark, NJ, USA), were la-
149
beled with [32P]dCTP (Du Pont Canada; 3000 Ci/mmol) by random priming. Oligonucleotides were synthesized using a Pharmacia Gene Assembler and purified using NAP-50 columns (Pharmacia) according to the manufacturer’s instructions. 2.2. Tissue collection For cloning and enzyme activity studies, samples of liver tissues were collected from four adult guinea pigs (two males and two females). For the mRNA tissue distribution study, multiple peripheral tissues, including the liver, lung, kidney, adrenal, heart, spleen, stomach, small intestine, colon, skin, skeletal muscle, and ovary, as well as brain cortex, cerebellum and the rest of brain, were collected from one adult female guinea pig. All the tissues were snap-frozen in liquid nitrogen and stored at ⫺80°C until analysis. 2.3. RNA extraction Total RNA was extracted from all the tissues by using lithium chloride/urea and quantified spectrophotometrically at 260 nm. Before use, samples (10 g) were checked by agarose gel electrophoresis in the presence of formaldehyde, and the integrity of the RNA was assessed by the presence of two sharp bands representing 28S and 18S rRNA after staining with ethidium bromide. For RT-PCR, total RNA samples were purified using RNeasy kit (QIAGEN Inc., Mississauga, Ontario, Canada). 2.4. Cloning and sequencing of guinea pig 11-HSD1 cDNA The guinea pig 11-HSD1 cDNA was cloned by a 3⬘RACE (rapid amplification of cDNA ends) protocol [27], as modified below. Briefly, first-strand cDNAs were synthesized using 1 g of total RNA from an adult guinea pig liver as template, and an in-house designed oligo-dT-adapter primer (GTCGAC GGTACC GATATC T17) in a total volume of 20 l. An aliquot (2 l) was then subjected to a standard PCR (94°C, 55 s; 50°C, 55 s; 72°C, 2 min; 30 cycles) by using the adapter primer and a gene-specific primer (5⬘-GGGGGGTACC CGGGTAGAAA GCTCTGTAGG) that corresponds to nucleotides 1 through 20 in the published sheep 11-HSD1 cDNA. This primer was selected on the basis of high sequence homology among the other mammalian 11-HSD1 cDNAs. The positive PCR products were selected by Southern blot analysis by using [32P]sheep 11-HSD1 cDNA [5], and cloned into pBluescript KS. Double-stranded plasmid DNA was obtained and sequenced by using the dideoxy-chain termination method. The sequence of the cloned guinea pig 11-HSD1 cDNA was verified by sequencing an independent 11-HSD1 cDNA generated from hepatic total RNA of a different adult guinea pig. Sequences encompassing the stop codon in the guinea pig 11-HSD1 cDNA were also confirmed by se-
150
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
quencing of a genomic DNA fragment corresponding to nucleotides 813–1039 in the cloned cDNA. This fragment was obtained by a standard PCR by using genomic DNA prepared from an adult guinea pig kidney as template, and sequence specific primers based on the cloned guinea pig 11-HSD1 cDNA.
phate buffer, pH 7.0, containing 0.25 M sucrose (Buffer A). The homogenates were centrifuged consecutively at 750 and 20 000 ⫻ g for 30 min. The latter supernatant was centrifuged at 105 000 ⫻ g for 60 min. The resultant pellets were resuspended in Buffer A, and taken as microsomes that were used in assays as described below.
2.5. Northern blot analysis
2.7.2. Protein estimation Protein concentration was determined by the Bradford method by using a Bio–Rad (Mississauga, Ontario, Canada) protein assay kit with bovine serum albumin (BSA) as standard.
The tissue distribution of 11-HSD1 mRNA in the adult guinea pig was determined by Northern blot analysis, as described previously [5,28]. Briefly, denatured RNA samples (30 g) were subjected to agarose gel (1%) electrophoresis in the presence of formaldehyde, and transferred overnight by capillary blotting to a Zeta– Probe membrane (Bio–Rad Canada Ltd., Mississauga, Ontario, Canada). The RNA was fixed by UV crosslinking (Gene Cross–Linker, Bio–Rad) to the membrane that was then baked under vacuum at 80°C for 60 min. The blot was hybridized at 42°C for 16 h in the presence of formamide (50%) and [32P]guinea pig 11-HSD1 cDNA. To obtain comparative information, the same blot was stripped and reprobed with [32P]guinea pig 11HSD2 cDNA [29]. We used a cDNA for mouse 18S rRNA as an internal control for gel loading and efficiency of RNA transfer, as described previously [5]. 2.6. RT-PCR/Southern blot analysis The tissue distribution of 11-HSD1 mRNA in the adult guinea pig was further studied by standard RT-PCR/Southern blot analysis. Briefly, total RNA samples (1.0 g) were reverse transcribed using a standard oligo-dT primer in a total volume of 20 l. An aliquot (2 l) was then subjected to a standard PCR (94°C, 55 s; 50°C, 55 s; 72°C, 1 min; 30 cycles) by using guinea pig-specific primers (forward primer, 5⬘-ACAGCTCTGCGTCAAG; reverse primer, 5⬘GGTCTAGATCTGGGAAGATACCTTC) that correspond to nucleotides 813 through 829 and 1022 through 1040 in the cloned guinea pig 11-HSD1 cDNA, respectively. GAPDH was used as a control. The PCR conditions for GAPDH were identical to those for 11-HSD1. The human GAPDH-specific primers used in this study were as follows: forward primer, 5⬘-ACCACAGTCCATGCCATCAC; reverse primer, 5⬘-TCCACCACCCTGTTGCTGTA. A fraction of the RT-PCR products was then subjected to a standard Southern blotting procedure, by using [32P]guinea pig 11-HSD1 cDNA and [32P]human GAPDH cDNA as probes. 2.7. Assay of 11-HSD activity 2.7.1. Preparation of microsomes The microsomes were prepared by a standard procedure, as described [10]. Briefly, liver tissues (1–2 g) were homogenized freshly in 20 vol. of ice-cold 10-mM sodium phos-
2.7.3. Assay of 11-HSD dehydrogenase activity The 11-HSD dehydrogenase activity was determined by measuring the rate of conversion of cortisol to cortisone, as described previously [10]. Briefly, the assay tubes contained microsomes (25–30 g protein), approximately 100 000 cpm of the labeled cortisol, final concentrations of nonradioactive cortisol and cofactor (NAD or NADP) at 1.0 M and 250 M, respectively. After incubation in a water bath at 37°C for 10 min, the reaction was arrested, and the steroids extracted. The extracts were dried, and the residues resuspended. A fraction of the resuspension was spotted on a TLC plate that was developed in chloroform/methanol (9:1, v/v). The bands containing the labeled cortisol and cortisone were identified by UV light of the cold carriers, cut out into scintillation vials and counted in Scintisafe™ Econol 1 (Fisher Scientific, Toronto, Canada). The rate of cortisol to cortisone conversion was calculated from the specific activity of the labeled cortisol and the radioactivity of cortisone, and results expressed as the amount of cortisone (picomoles) formed per min per mg protein. 2.7.4. Assay of 11-HSD reductase activity The 11-HSD reductase activity was determined similarly, except that cortisone was used as substrate and NADH or NADPH as cofactor. 2.7.5. Kinetic analysis Kinetic analyses were performed by using the microsomes, as described previously [10]. Conversion assays were conducted by using a fixed amount of cofactor (250 M), microsomes (25–30 g protein), and reaction time (15 min), but with varying amounts of substrate (0.5–10 M). The conditions were chosen so that the initial velocity was linear with the reaction time and the amount of microsomes. Each experiment was carried out in duplicate, and a total of four independent experiments were conducted for the dehydrogenase and reductase, respectively. The data were plotted as a straight line of v against v/s according to the Michaelis–Menton Equation [30], and the Km and Vmax values were calculated from the intercepts of the plots as described [30].
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
151
Fig. 1. Nucleotide sequence of guinea pig 11-HSD1 cDNA (GeneBank accession number AF188005), and the deduced amino acid sequence of 11-HSD1 polypeptide. A consensus site for N-glycosylation is boxed.
3. Results 3.1. Guinea pig 11-HSD1 cDNA sequence and the deduced primary structure The cloned guinea pig 11-HSD1 cDNA is approximately 1.3 kb in length, including a poly A tail of about 200 bp. The cloned guinea pig 11-HSD1 cDNA contains a 903 bp open reading frame that encodes a protein of 300 amino acids (Fig. 1). The deduced guinea pig 11-HSD1 polypeptide has a predicted molecular weight of 35 kDa, contains one consensus site for N-glycosylation, and displays 71– 74% sequence identity to other known mammalian 11HSD1 proteins (Fig. 2). Similar to those of other mammals, the deduced guinea pig 11-HSD1 protein contains the well-conserved putative
cofactor binding and catalytic motifs (Fig. 2). However, compared with sequences of other mammalian 11-HSD1 proteins, the deduced guinea pig sequence has a C-terminal extension of eight amino acids. Moreover, one of the two absolutely conserved consensus sites for N-glycosylation in other mammalian 11-HSD1 proteins is absent (Fig. 2). 3.2. Tissue distribution of 11-HSD1 mRNA When total RNA from a range of peripheral tissues and brain regions of an adult female guinea pig was analyzed by Northern blot analysis with the cloned 1.3-kb guinea pig 11-HSD1 cDNA as probe, a single 1.8-kb mRNA was detected in the liver and kidney with higher amounts in the former. A very faint signal was also detected in the adrenal gland. Under conditions of the present study, the mRNA for
152
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
Fig. 2. Comparison of the deduced human (GeneBank accession number M68487), monkey (S63400), mouse (X83202), and guinea pig 11-HSD1 amino acid sequences. Hyphens indicate identical amino acids with respect to the human sequence, and # indicates gaps that are required to align the sequences. The two absolutely conserved consensus sites for N-glycosylation in other mammals are indicated by the arrows. The putative cofactor binding site (A) and catalytic site (B) are underlined.
11-HSD1 was undetectable in the adult guinea pig heart, lung, spleen, small intestine, colon, skin, skeletal muscle, ovary, and brain regions (Fig. 3).
By comparison, when the same blot was reprobed with guinea pig 11-HSD2 cDNA probe, a single 2.0 kb transcript was detected, in the descending order of abundance,
Fig. 3. Tissue distribution of 11-HSD1 and 2 mRNAs as determined by Northern blot analysis. Total RNA samples (30 g) were analyzed. Autoradiographs of the same blot probed sequentially with [32P]guinea pig 11-HSD1 cDNA, [32P]guinea pig 11-HSD2 cDNA, and with [32P]mouse 18S rRNA cDNA to serve as a control, are shown.
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
153
Fig. 4. Tissue distribution of 11-HSD1 mRNA as determined by RT-PCR/Southern blot analysis. Total RNA samples (1.0 g) were subjected to a standard RT-PCR, and the resultant products were analyzed by Southern blot analysis, as described in Section 2. The autoradiograph of the blot probed with [32P]guinea pig 11-HSD1 cDNA, and [32P]human GAPDH cDNA to serve as a control, is shown.
in the kidney, colon, ovary, and spleen. This transcript was undetectable in the rest of the tissues including the brain regions (Fig. 3). The conclusion on the stomach can not be made, as there was considerably less total RNA loaded onto the gel (Fig. 3). To further determine if the lack of 11-HSD1 mRNA as assessed by Northern analysis was due to a much lower abundance or its absence, we utilized RT-PCR/Southern blot analysis and showed that the mRNA was indeed present in all the peripheral tissues, and the brain regions albeit at extremely lower levels (Fig. 4). It should be pointed out that the RT-PCR results were intended to show the presence or absence of the mRNA, rather than to obtain quantitative information. 3.3. Characteristics of guinea pig hepatic 11-HSD1 As shown in Fig. 3, high levels of 11-HSD1 mRNA were detected in the guinea pig liver. However, under the same experimental conditions, the mRNA for 11-HSD2 was undetectable, indicating that 11-HSD1 is the predominant, if not exclusive, 11-HSD isozyme in the guinea pig liver. Therefore, catalytic properties of 11-HSD enzyme activity in the hepatic microsomes were studied, and taken to represent those of 11-HSD1 in this species. 3.3.1. Cofactor preference In hepatic microsomes, the 11-HSD1 dehydrogenase activity showed a slight preference for NADP (57 ⫾ 5 and 69 ⫾ 2 pmol/min/mg protein in the presence of NAD and NADP, respectively), although appreciable amounts of the activity were detected even in the absence of cofactor (32 ⫾ 2 pmol/min/mg protein). By contrast, the 11-HSD1 reductase activity displayed a remarkable degree of cofactor dependency, the activity being 2 ⫾ 1, 6 ⫾ 2, and 121 ⫾ 7 pmol/min/mg protein in the absence and presence of NADH and NADPH, respectively (Fig. 5). 3.3.2. Kinetic characteristics Under conditions of the present study, 11-HSD1 in the guinea pig hepatic microsomes displayed equal affinity for
cortisol and cortisone (apparent Km of 2.85 ⫾ 0.33 and 2.77 ⫾ 0.29 M for cortisol and cortisone, respectively) (Fig. 6).
4. Discussion In the present study, we have determined the primary structure of the guinea pig 11-HSD1 by cloning its cDNA. The cloned guinea pig 11-HSD1 cDNA, when aligned with other known mammalian sequences, showed an expected high degree of conservation, including the translational start codon [3–5,31–33]. However, a single nucleotide alteration was observed in the well-conserved stop codon (TAG to GAG) within the open reading frame, which resulted in an extension of the guinea pig 11-HSD1 open reading frame by 24 nucleotides. Thus, the cloned guinea pig 11-HSD1 cDNA predicted a protein of 300 amino acids, which is longer, by eight amino acids, than those of other mammals at its C-terminus [3–5,31–33]. It is suspected that this extra ‘tail’ may alter its secondary/tertiary
Fig. 5. Cofactor dependence of 11-HSD1 activity in the guinea pig hepatic microsomes. The hepatic microsomes were incubated with 1.0 M cortisol and cortisone, in the absence and presence of NAD or NADP and NADH or NADPH for determining the dehydrogenase and reductase activity, respectively, as described in Section 2. Each bar represents group mean ⫹ SEM (n ⫽ 4).
154
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
Fig. 6. Plots according to the Michaelis–Menten equation for determining kinetic parameters of 11-HSD1 activity in the guinea pig hepatic microsomes. The hepatic microsomes were incubated with varying amounts of cortisol (0.5–10 M) in the presence of NADP (A) and with cortisone (0.5–10 M) in the presence of NADPH (B) for determining the kinetic parameters of the dehydrogenase and reductase, respectively, as described in Section 2. Each experiment was conducted in duplicate, and a total of 4 independent experiments were conducted for the dehydrogenase and reductase, respectively. Data are presented as mean ⫹ SEM (n ⫽ 4).
structure, leading to changes in the catalytic function of this enzyme. In addition, the deduced guinea pig 11-HSD1 protein lacks one of the two well-conserved consensus sites for N-glycosylation [34]. In an elegant study by Agarwal and colleagues [35] in which the effects of glycosylation were examined in detail by introducing mutations into the two N-linked glycosylation sites (residues 158 –160 and 203– 205). It was demonstrated that the second glycosylation site was essential for both dehydrogenase and reductase activities. Moreover, the modification of the first site caused a 50 to 75% reduction in reductase activity without any effect on dehydrogenase activity. It is noteworthy that the first gly-
cosylation site is absent from the deduced guinea pig 11HSD1 protein. Thus, the guinea pig provides a naturally altered 11-HSD1 in which to study the role of N-glycosylation as well as the C-terminus in the function of 11HSD1. To gain insight into the functional significance of these structural changes in the deduced guinea pig enzyme, we have characterized the intrinsic properties of 11-HSD1 enzyme activity in the guinea pig hepatic microsomes. Although the reductase activity was clearly NADPH-dependent, the dehydrogenase activity can be driven by NAD and NADP. This is consistent with previous studies that used both sheep [10] and mouse [36] hepatic microsomes. Moreover, like the present study, those studies using tissue microsomes [10,36] demonstrated clearly the presence of reductase activity. Therefore, similar to 11-HSD1 in other species [2,3, 10], the guinea pig hepatic enzyme is a low affinity NADP(H)-dependent dehydrogenase/reductase. However, unlike other mammals whose affinity for cortisone is approximately 10⫻ higher than that for cortisol [3], the guinea pig 11-HSD1 displays equal affinity for the two substrates. The higher affinity of 11-HSD1 for cortisone in other mammals may explain why it functions predominantly as a reductase in intact cells. Given that cortisone circulates largely in the free, unbound form, the bioformation of cortisol by the action of 11-HSD1 reductase may play an important role in determining the sensitivity of individual tissues to glucocorticoids [25]. The relatively lower affinity of the guinea pig hepatic 11-HSD1 for cortisone would suggest that the intracellular bioformation of cortisol from circulating cortisone may be less efficient in this species. This may help to ensure that in the face of very high circulating cortisol levels, the intracellular level of cortisol in individual glucocorticoid-target tissues in the guinea pig is not further aggravated by the local formation from cortisone. It is possible that the reduced affinity of the guinea pig hepatic 11-HSD1 for cortisone is the result of alterations in its deduced primary structure, especially in light of the observed decreases in reductase activity when the first glycosylation site was modified [35]. Further studies that use site-directed mutagenesis are in progress to establish such a causal relationship. It is interesting to note that in a previous study by Moore and co-workers [3] it was shown that the hepatic 11-HSD1 in the squirrel monkey, another animal model of glucocorticoid resistance, was similar to that in the human with respect to primary structure and catalytic properties. This is in marked contrast to the findings in our present study. These differences in 11-HSD1 between the two glucocorticoid resistant species may represent species differences in their adaptation to high glucocorticoid levels. The model of 11-HSD1 as an end-organ modulator of glucocorticoid function depends fundamentally on its proper spatial/temporal expression and abundance. In the
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
adult guinea pig, 11-HSD1 mRNA, as determined by Northern blot analysis, was detected only in the liver and kidney with a much lower abundance in the adrenal gland. With RT-PCR, the mRNA for 11-HSD1 was detectable in all the peripheral tissues studied including heart, lung, spleen, stomach, small intestine, colon, skin, skeletal muscle, and ovary. This indicates that the expression of 11HSD1 is at a very low level in the guinea pig peripheral tissues except for the liver and kidney. More remarkably, the guinea pig brain expresses extremely low levels, if any, of 11-HSD1 mRNA. This is in marked contrast to the relatively abundant expression of 11-HSD1 mRNA in the brain and peripheral tissues of other mammals [26,37–39]. For instance, in adult mice, 11-HSD1 mRNA was clearly detectable by Northern analysis in the brain and in the majority, if not all, of peripheral tissues examined [40]. Given that the tissue level of 11-HSD1 mRNA is wellcorrelated with that of the enzyme activity [38], the relatively lower expression of 11-HSD1 in the guinea pig would mean less intracellular cortisol bioformation from cortisone. Likewise, the near absence of 11-HSD1 expression in the guinea pig brain may help facilitate glucocorticoid resistance by not producing cortisol locally from circulating cortisone. Thus, the present study has identified two potential mechanisms in the guinea pig, namely a partially deficient 11-HSD1 reductase and a much lower level of its expression in both the brain and peripheral tissues, which together may function to ensure that in the face of very high circulating cortisol levels, the intracellular level of cortisol in individual glucocorticoid-target tissues is not further aggravated by the local formation from cortisone. However, the precise physiological significance of 11-HSD1 in the guinea pig remains to be determined. New insight into the role of 11-HSD1 in the control of glucocorticoid actions has been provided recently through elegant studies in which the consequence of 11-HSD1 knockout was investigated [25]. Although not essential for fetal development or adult life, 11-HSD1 has profound effects on the adrenal gland and glucocorticoid-mediated biologic functions. For example, mutant mice lacking 11HSD1 showed adrenal hyperplasia and increased adrenal secretion of corticosterone. In addition, these mice had attenuated glucocorticoid-inducible responses and resisted hyperglycemia on obesity or stress [25]. The importance of this enzyme has also been realized through clinical studies of the apparent E (cortisone) reductase deficiency (AERD). This is the converse disorder of AME, which was first described in the mid-80s [41] and the characteristics of which consists of hypercortisolism without Cushing’s syndrome and over production of cortisone. Given that the reductase activity is an intrinsic property of 11-HSD1 that is primarily produced in the liver, this disorder is probably caused by hepatic 11-HSD1 dysfunction [42]. However, the molecular basis of the suspected 11HSD1 dysfunction remains to be determined. In the present
155
study, we have identified distinct features in the primary structure, the catalytic function (based on the hepatic microsomes) and the tissue distribution pattern of 11-HSD1 in the guinea pig, a laboratory animal resembling the human AERD in its ability to resist high circulating levels of cortisol. Thus, the guinea pig provide a useful model in which the structural determinants of catalytic function of 11-HSD1 may be studied. Acknowledgment We thank Dr R. Sampath–Kumar for his helpful input during the course of this study. References [1] White PC, Mune T, Agarwal AK. 11-Hydroxysteroid dehydrogenase and the syndrome of apparent mineralocorticoid excess. Endocr Rev 1997;18:135–56. [2] Agarwal AK, Tusie–Luna MT, Monder C, White PC. Expression of 11-hydroxysteroid dehydrogenase using recombinant vaccinia virus. Mol Endocrinol 1990;4:1827–32. [3] Moore CCD, Mellon SH, Murai J, Siiteri PK, Miller WL. Structure and function of the hepatic form of 11-hydroxysteroid dehydrogenase in the squirrel monkey, an animal model of glucocorticoid resistance. Endocrinology 1993;133:368 –75. [4] Tannin GM, Agarwal AK, Monder C, New MI, White PC. The human gene for 11-hydroxysteroid dehydrogenase. Structure, tissue distribution, and chromosomal localization. J Biol Chem 1991;266: 16653– 8. [5] Yang K, Smith CL, Dales D, Hammond GL, Challis JR. Cloning of an ovine 11-hydroxysteroid dehydrogenase complementary deoxyribonucleic acid: tissue and temporal distribution of its messenger ribonucleic acid during fetal and neonatal development. Endocrinology 1992;131:2120 – 6. [6] Jamieson PM, Chapman KE, Edwards CRW, Seckl JR. 11-hydroxysteroid dehydrogenase is an exclusive 11-reductase in primary cultures of rat hepatocytes: effect of physiochemical and hormonal manipulations. Endocrinology 1995;136:4754 – 61. [7] Rusvai E, Naray Fejes Toth A. A new isoform of 11 -hydroxysteroid dehydrogenase in aldosterone target cells. J Biol Chem 1993;268: 10717–20. [8] Albiston AL, Obeyesekere V, Smith R, Krozowski ZS. Cloning and tissue distribution of the human 11-hydroxysteroid dehydrogensae type 2 enzyme. Mol Cell Endocrinol 1994;105:R11–R17. [9] Stewart PM, Murry BA, Mason JI. Human kidney 11-hydroxysteroid dehydrogenase is a high affinity nicotinamide adenine dinucleotide-dependent enzyme and differs from the cloned type I isoform. J Clin Endocrinol Metab 1994;79:480 – 4. [10] Yang K, Yu M. Evidence for distinct isoforms of 11-hydroxysteroid dehydrogenase in the ovine liver and kidney. J Steroid Biochem Mol Biol 1994;49:245–50. [11] Murphy BE. Ontogeny of cortisol-cortisone interconversion in human tissues: a role for cortisone in human fetal development. J Steroid Biochem 1981;14:811–7. [12] Seckl JR, Benediktsson R, Lindsay RS, Brown RW. Placental 11hydroxysteroid dehydrogenase and the programming of hypertension. J Steroid Biochem Mol Biol 1995;55:447–55. [13] Edwards CR, Stewart PM, Burt D, Brett L, McIntyre MA, Sutanto WS, de Kloet ER, Monder C. Localization of 11-hydroxysteroid dehydrogenase–tissue specific protector of the mineralocorticoid receptor. Lancet 1988;2:986 –9.
156
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
[14] Funder JW, Pearce PT, Smith R, Smith AI. Mineralocorticoid action: target tissue specificity is enzyme, not receptor, mediated. Science 1988;242:583–5. [15] Ulick S, Levine LS, Gunczler P, Giovanni Z, Ramirez LC, Rauh W, Rosler A, Bradlow HL, New MI. A syndrome of apparent mineralocorticoid excess associated with defects in the peripheral metabolism of cortisol. J Clin Endocrinol Metab 1979;49:757– 64. [16] Stewart PM, Wallace AM, Valentino R, Burt D, Shackleton CH, Edwards CR. Mineralocorticoid activity of liquorice: 11-hydroxysteroid dehydrogenase deficiency comes of age. Lancet 1987;2:821– 4. [17] Stewart PM, Corrie JE, Shackleton CH, Edwards CR. Syndrome of apparent mineralocorticoid excess. A defect in the cortisol-cortisone shuttle. J Clin Invest 1988;82:340 –9. [18] Funder JW. The tale of the guinea pig. Front Neuroendocrinol 1994; 15:384 –9. [19] Keightley M-C, Fuller PJ. Anomalies in the endocrine axes of the guinea pig: relevance to human physiology and disease. Endocr Rev 1996;17:30 – 44. [20] Fujieda K, Goff AK, Pugeat M, Strott CA. Regulation of the pituitary-adrenal axis and corticosteroid-binding globulin-cortisol interaction in the guinea pig. Endocrinology 1982;111:1944 –50. [21] Smith AI, Wallace CA, Moritz RL, Simpson RJ, Schmauk–White LB, Woodcock EA, Funder JW. Isolation, amino acid sequence and superagonist steroidogenic activity of guinea pig ACTH. J Endocrinol 1987;115:5– 8. [22] Keightley M-C, Fuller PJ. Molecular cloning and sequencing of a guinea pig pro-opiomelanocortin cDNA. Mol Cell Endocrinol 1991; 82:89 –98. [23] Kraft N, Hodgson AJ, Funder JW. Glucocorticoid receptor and effector mechanisms: a comparison between the corticosensitive mouse and the corticoresistant guinea pig. Endocrinology 1979;104:344 –9. [24] Keightley M-C, Fuller PJ. Unique sequences in the guinea pig glucocorticoid receptor induce constitutive transactivation and decrease steroid sensitivity. Mol Endocrinol 1994;8:431–9. [25] Kotelevtsev Y, Holmes MC, Burchell A, Houston PM, Schmoll D, Jamieson P, Best R, Brown R, Edwards CRW, Seckl JR, Mullins JJ. 11-Hydroxysteroid dehydrogenase type 1 knockout mice show attenuated glucocorticoid-inducible responses and resist hyperglycemia on obesity or stress. Proc Natl Acad Sci USA 1997;94:14924 –9. [26] Whorwood CB, Franklyn JA, Sheppard MC, Stewart PM. Tissue localization of 11-hydroxysteroid dehydrogenase and its relationship to the glucocorticoid receptor. J Steroid Biochem Mol Biol 1992;41:21– 8. [27] Frohman MA. RACE: rapid amplification of cDNA ends. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR Protocols—A Guide to Methods and Applications. San Diego: Academic Press, 1990. pp. 28 –38. [28] Langlois DA, Matthews SG, Yu M, Yang K. Differential expression of 11-hydroxysteroid dehydrogenase 1 and 2 in the developing ovine fetal liver and kidney. J Endocrinol 1995;147:405–11.
[29] Sampath–Kumar R, Matthews SG, Yang K. 11-hydroxysteroid dehydrogenase type 2 is the predominant isozyme in the guinea pig placenta: decreases in mRNA and activity at term. Biol Reprod 1998;59:1378 – 84. [30] Henderson PJF. Statistical analysis of enzyme kinetic data. In: Eisenthal R, Danson MJ, editors. Enzyme assays: a practical approach. New York: Oxford University Press, 1992. pp. 277–316. [31] Agarwal AK, Monder C, Eckstein B, White PC. Cloning and expression of rat cDNA encoding corticosteroid 11-dehydrogenase. J Biol Chem 1989;264:18939 – 43. [32] Oppermann UCT, Netter KJ, Maser E. Cloning and primary structure of murine 11-hydroxysteroid dehydrogenase/microsomal carbonyl reductase. Eur J Biochem 1995;227:202– 8. [33] Rajan V, Chapman KE, Lyons V, Jamieson P, Mullins JJ, Edwards CRW, Seckl JR. Cloning, sequencing and tissue-distribution of mouse 11-hydroxysteroid dehydrogenase-1 cDNA. J Steroid Biochem Mol Biol 1995;52:141–7. [34] Ozols J. Lumenal orientation and post-translational modifications of the liver microsomal 11-hydroxysteroid dehydrogenase. J Biol Chem 1995;270:2305–12. [35] Agarwal AK, Mune T, Monder C, White PC. Mutations in putative glycosylation sites of rat 11-hydroxysteroid dehydrogenase affect enzymatic activity. Biochim Biophys Acta Protein Struct Mol Enzymol 1995;1248:70 – 4. [36] Maser E, Bannenberg G. The purification of 11-hydroxysteroid dehydrogenase from mouse liver microsomes. J Steroid Biochem Mol Biol 1994;48:257– 63. [37] Tannin GM, Agarwal AK, Monder C, New MI, White PC. The human gene for 11-hydroxysteroid dehydrogenase. J Biol Chem 1991;266:16653– 8. [38] Moisan M-P, Seckl JR, Edwards CRW. 11-Hydroxysteroid dehydrogenase bioactivity and mRNA expression in rat forebrain: localization in hypothalamus, hippocampus, and cortex. Endocrinology 1990;127:1450 –5. [39] Roland BL, Krozowski ZS, Funder JW. Glucocorticoid receptor, mineralocorticoid receptors, 11-hydroxysteroid dehydrogenase-1 and -2 expression in rat brain and kidney: in situ studies. Mol Cell Endocrinol 1995;111:R1–R7. [40] Cole TJ. Cloning of the mouse 11-hydroxysteroid dehydrogenase type 2 gene: tissue specific expression and localization in distal convoluted tubules and collecting ducts of the kidney. Endocrinology 1995;136:4693– 6. [41] Phillipou G, Higgins BA. A new defect in the peripheral conversion of cortisone to cortisol. J Steroid Biochem Mol Biol 1985; 22:435– 6. [42] Phillipov G, Palermo M, Shackleton CHL. Apparent cortisone reductase deficiency: a unique form of hypercortisolism. J Clin Endocrinol Metab 1996;81:3855– 60.
Guinea pig 11-hydroxysteroid dehydrogenase type 1: primary structure and catalytic properties夞 X. Pu, K. Yang* The Lawson Research Institute, St. Joseph’s Health Centre, Departments of Obstetrics and Gynecology and Physiology, University of Western Ontario, 268 Grosvenor Street, London, Ontario, Canada N6A 4V2 Received 10 August 1999; received in revised form 23 September 1999; accepted 5 October 1999
Abstract The 11-hydroxysteroid dehydrogenase type 1 (11-HSD1) enzyme is responsible for the interconversion of glucocorticoids and their inactive metabolites, and thus modulates the intracellular level of bioactive glucocorticoids. The present study was designed to clone and characterize 11-HSD1 in the guinea pig, a laboratory animal known for resistance to glucocorticoids. The cDNA encoding guinea pig 11-HSD1 was cloned by a modified 3⬘-RACE (rapid amplification of cDNA ends) protocol using the hepatic RNA as template. The cloned cDNA encodes a protein of 300 amino acids that shares 71 to 74% sequence identity with other known mammalian 11-HSD1 proteins. Sequence comparison analysis revealed that the deduced guinea pig 11-HSD1 was longer, by eight amino acids at the C terminus, than those of other mammals. Moreover, one of the two absolutely conserved consensus sites for N-glycosylation was absent. To examine the functional significance of these structural changes, we also characterized 11-HSD1 activity in the hepatic microsomes. Although the guinea pig hepatic enzyme was NADP(H)-dependent and reversible, it displayed equal affinity for cortisol and cortisone (apparent Km for both substrates was 3 M). This is in marked contrast to 11-HSD1 in other mammals whose affinity for cortisone is approximately 10 times higher than that for cortisol (apparent Km of 0.3 vs. 3.0 M). The apparent lower affinity of the guinea pig enzyme for cortisone would suggest that the intracellular bioformation of cortisol from circulating cortisone may be less efficient in this species. Northern blot analysis and RT-PCR revealed that the mRNA for 11-HSD1 was widely expressed in the adult guinea pig but at low amounts. In conclusion, the present study has identified distinct features in the deduced primary structure and catalytic function of 11-HSD1 in the guinea pig. Thus, the guinea pig provides a useful model in which the structural determinants of catalytic function of 11-HSD1 may be studied. © 2000 Elsevier Science Inc. All rights reserved. Keywords: 11-HSD1; cDNA and protein sequence; mRNA; Enzyme properties; Guinea pigs; Glucocorticoid resistance
1. Introduction The intracellular enzyme 11-hydroxysteroid dehydrogenase (11-HSD) catalyzes the interconversion of bioactive glucocorticoids (cortisol and corticosterone) and their inert metabolites (cortisone and 11-dehydrocorticosterone). In mammals, two distinct isozymes of 11-HSD, known as 11-HSD1 and 2, have been identified, cloned and characterized [1]. 11-HSD1 is a low affinity NADP(H)-dependent dehydrogenase (cortisol to cortisone)/reductase (corti夞 This work was supported by the Canadian MRC (Grant MT-12100 to K.Y.). K. Yang is an Ontario Ministry of Health Career Scientist. * Corresponding author. Tel.: ⫹1-519-646-6100; fax: ⫹1-519-6466110. E-mail address: [email protected] (K. Yang)
sone to cortisol) enzyme, with an apparent Km for glucocorticoids in the M range [2,3]. This enzyme is widely expressed in glucocorticoid target tissues, most notably the liver [4,5]. In intact cells, 11-HSD1 functions predominantly as a reductase generating cortisol from cortisone that circulates largely in the free, unbound form [6]. Although it has been proposed that 11-HSD1 regulates the intracellular level of bioactive glucocorticoids, the precise physiological role of this enzyme in individual target sites remains obscure. In contrast, 11-HSD2 is a high affinity NAD-dependent unidirectional dehydrogenase enzyme, with an apparent Km for glucocorticoids in the nM range [7–10]. The expression of this isozyme is restricted to the placenta, where it is proposed to serve as a barrier to protect the fetus from high levels of maternal glucocorticoids [11,12], and to aldoste-
0039-128X/00/$ – see front matter © 2000 Elsevier Science Inc. All rights reserved. PII: S 0 0 3 9 - 1 2 8 X ( 9 9 ) 0 0 0 9 8 - 7
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
rone-target organs such as the kidney [8], where it protects the nonselective mineralocorticoid receptors from high circulating levels of glucocorticoids [13,14]. Deficiencies in this enzyme, either congenital (caused by mutations in the gene encoding 11-HSD2) or acquired (through liquorice ingestion), leads to the syndrome of apparent mineralocorticoid excess (AME) in which cortisol acts as a mineralocorticoid causing hypertension and hypokalemia [15–17]. The guinea pig, a laboratory animal known for resistance to glucocorticoids, displays a number of anomalies in its glucocorticoid signal transduction pathway [18,19]. First, plasma levels of total cortisol (free and protein bound) are at least 3 to 4⫻ higher than those in the human [20]. This is due to the hyper-adrenal secretion of cortisol caused by a superactive ACTH [21]. The enhanced potency of the guinea pig ACTH has been attributed to a point mutation in the gene encoding the ACTH precursor peptide, POMC [22]. Second, plasma levels of free cortisol, which is considered bioactive, are even higher owing to a low affinity corticosteroid binding globulin (CBG) [20]. Third, the guinea pig glucocorticoid receptor (GR) has an affinity for its ligand 10 to 20 times lower than that of its mammalian counterparts [23,24]. This probably explains why this animal is able to tolerate such high levels of cortisol in its circulation. There is increasing evidence that tissue sensitivity to glucocorticoids is determined not only by their levels in circulation and their intracellular receptors (GRs) but also by the intracellular 11-HSD enzymes [25]. Given that 11-HSD1 and GRs are co-localized in glucocorticoid target tissues [26], the present study was undertaken to determine if 11-HSD1 in the guinea pig possesses distinct features with respect to primary structure and catalytic function, to adapt themselves to the elevated glucocorticoid environment.
2. Experimental 2.1. Reagents and supplies [1,2,6,7-3H(N)]-Cortisol (80 Ci/mmol) was purchased from Du Pont Canada Inc. (Markham, Ontario, Canada). [1,2,6,7-3H(N)]-Cortisone was prepared from [1,2,6,73 H(N)]cortisol in our laboratory as described previously [10]. Nonradioactive steroids were obtained from Steraloids Inc. (Wilton, NH, USA). Co-factors (NAD, NADP, NADH, and NADPH) were purchased from Sigma Chemicals (St. Louis, MO, USA). Polyester-backed TLC plates were obtained from Fisher Scientific Ltd. (Unionville, Ontario, Canada). All solvents used were OmniSolv grade from BDH Inc. (Toronto, Ontario, Canada). General molecular biology reagents were from Gibco BRL or Pharmacia Canada Inc. (Baie D’Urte, Quebec, Canada). The cDNAs used in this study, including a mouse 18S rRNA cDNA (Dr. D.T. Denhardt, Rutgers University, Newmark, NJ, USA), were la-
149
beled with [32P]dCTP (Du Pont Canada; 3000 Ci/mmol) by random priming. Oligonucleotides were synthesized using a Pharmacia Gene Assembler and purified using NAP-50 columns (Pharmacia) according to the manufacturer’s instructions. 2.2. Tissue collection For cloning and enzyme activity studies, samples of liver tissues were collected from four adult guinea pigs (two males and two females). For the mRNA tissue distribution study, multiple peripheral tissues, including the liver, lung, kidney, adrenal, heart, spleen, stomach, small intestine, colon, skin, skeletal muscle, and ovary, as well as brain cortex, cerebellum and the rest of brain, were collected from one adult female guinea pig. All the tissues were snap-frozen in liquid nitrogen and stored at ⫺80°C until analysis. 2.3. RNA extraction Total RNA was extracted from all the tissues by using lithium chloride/urea and quantified spectrophotometrically at 260 nm. Before use, samples (10 g) were checked by agarose gel electrophoresis in the presence of formaldehyde, and the integrity of the RNA was assessed by the presence of two sharp bands representing 28S and 18S rRNA after staining with ethidium bromide. For RT-PCR, total RNA samples were purified using RNeasy kit (QIAGEN Inc., Mississauga, Ontario, Canada). 2.4. Cloning and sequencing of guinea pig 11-HSD1 cDNA The guinea pig 11-HSD1 cDNA was cloned by a 3⬘RACE (rapid amplification of cDNA ends) protocol [27], as modified below. Briefly, first-strand cDNAs were synthesized using 1 g of total RNA from an adult guinea pig liver as template, and an in-house designed oligo-dT-adapter primer (GTCGAC GGTACC GATATC T17) in a total volume of 20 l. An aliquot (2 l) was then subjected to a standard PCR (94°C, 55 s; 50°C, 55 s; 72°C, 2 min; 30 cycles) by using the adapter primer and a gene-specific primer (5⬘-GGGGGGTACC CGGGTAGAAA GCTCTGTAGG) that corresponds to nucleotides 1 through 20 in the published sheep 11-HSD1 cDNA. This primer was selected on the basis of high sequence homology among the other mammalian 11-HSD1 cDNAs. The positive PCR products were selected by Southern blot analysis by using [32P]sheep 11-HSD1 cDNA [5], and cloned into pBluescript KS. Double-stranded plasmid DNA was obtained and sequenced by using the dideoxy-chain termination method. The sequence of the cloned guinea pig 11-HSD1 cDNA was verified by sequencing an independent 11-HSD1 cDNA generated from hepatic total RNA of a different adult guinea pig. Sequences encompassing the stop codon in the guinea pig 11-HSD1 cDNA were also confirmed by se-
150
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
quencing of a genomic DNA fragment corresponding to nucleotides 813–1039 in the cloned cDNA. This fragment was obtained by a standard PCR by using genomic DNA prepared from an adult guinea pig kidney as template, and sequence specific primers based on the cloned guinea pig 11-HSD1 cDNA.
phate buffer, pH 7.0, containing 0.25 M sucrose (Buffer A). The homogenates were centrifuged consecutively at 750 and 20 000 ⫻ g for 30 min. The latter supernatant was centrifuged at 105 000 ⫻ g for 60 min. The resultant pellets were resuspended in Buffer A, and taken as microsomes that were used in assays as described below.
2.5. Northern blot analysis
2.7.2. Protein estimation Protein concentration was determined by the Bradford method by using a Bio–Rad (Mississauga, Ontario, Canada) protein assay kit with bovine serum albumin (BSA) as standard.
The tissue distribution of 11-HSD1 mRNA in the adult guinea pig was determined by Northern blot analysis, as described previously [5,28]. Briefly, denatured RNA samples (30 g) were subjected to agarose gel (1%) electrophoresis in the presence of formaldehyde, and transferred overnight by capillary blotting to a Zeta– Probe membrane (Bio–Rad Canada Ltd., Mississauga, Ontario, Canada). The RNA was fixed by UV crosslinking (Gene Cross–Linker, Bio–Rad) to the membrane that was then baked under vacuum at 80°C for 60 min. The blot was hybridized at 42°C for 16 h in the presence of formamide (50%) and [32P]guinea pig 11-HSD1 cDNA. To obtain comparative information, the same blot was stripped and reprobed with [32P]guinea pig 11HSD2 cDNA [29]. We used a cDNA for mouse 18S rRNA as an internal control for gel loading and efficiency of RNA transfer, as described previously [5]. 2.6. RT-PCR/Southern blot analysis The tissue distribution of 11-HSD1 mRNA in the adult guinea pig was further studied by standard RT-PCR/Southern blot analysis. Briefly, total RNA samples (1.0 g) were reverse transcribed using a standard oligo-dT primer in a total volume of 20 l. An aliquot (2 l) was then subjected to a standard PCR (94°C, 55 s; 50°C, 55 s; 72°C, 1 min; 30 cycles) by using guinea pig-specific primers (forward primer, 5⬘-ACAGCTCTGCGTCAAG; reverse primer, 5⬘GGTCTAGATCTGGGAAGATACCTTC) that correspond to nucleotides 813 through 829 and 1022 through 1040 in the cloned guinea pig 11-HSD1 cDNA, respectively. GAPDH was used as a control. The PCR conditions for GAPDH were identical to those for 11-HSD1. The human GAPDH-specific primers used in this study were as follows: forward primer, 5⬘-ACCACAGTCCATGCCATCAC; reverse primer, 5⬘-TCCACCACCCTGTTGCTGTA. A fraction of the RT-PCR products was then subjected to a standard Southern blotting procedure, by using [32P]guinea pig 11-HSD1 cDNA and [32P]human GAPDH cDNA as probes. 2.7. Assay of 11-HSD activity 2.7.1. Preparation of microsomes The microsomes were prepared by a standard procedure, as described [10]. Briefly, liver tissues (1–2 g) were homogenized freshly in 20 vol. of ice-cold 10-mM sodium phos-
2.7.3. Assay of 11-HSD dehydrogenase activity The 11-HSD dehydrogenase activity was determined by measuring the rate of conversion of cortisol to cortisone, as described previously [10]. Briefly, the assay tubes contained microsomes (25–30 g protein), approximately 100 000 cpm of the labeled cortisol, final concentrations of nonradioactive cortisol and cofactor (NAD or NADP) at 1.0 M and 250 M, respectively. After incubation in a water bath at 37°C for 10 min, the reaction was arrested, and the steroids extracted. The extracts were dried, and the residues resuspended. A fraction of the resuspension was spotted on a TLC plate that was developed in chloroform/methanol (9:1, v/v). The bands containing the labeled cortisol and cortisone were identified by UV light of the cold carriers, cut out into scintillation vials and counted in Scintisafe™ Econol 1 (Fisher Scientific, Toronto, Canada). The rate of cortisol to cortisone conversion was calculated from the specific activity of the labeled cortisol and the radioactivity of cortisone, and results expressed as the amount of cortisone (picomoles) formed per min per mg protein. 2.7.4. Assay of 11-HSD reductase activity The 11-HSD reductase activity was determined similarly, except that cortisone was used as substrate and NADH or NADPH as cofactor. 2.7.5. Kinetic analysis Kinetic analyses were performed by using the microsomes, as described previously [10]. Conversion assays were conducted by using a fixed amount of cofactor (250 M), microsomes (25–30 g protein), and reaction time (15 min), but with varying amounts of substrate (0.5–10 M). The conditions were chosen so that the initial velocity was linear with the reaction time and the amount of microsomes. Each experiment was carried out in duplicate, and a total of four independent experiments were conducted for the dehydrogenase and reductase, respectively. The data were plotted as a straight line of v against v/s according to the Michaelis–Menton Equation [30], and the Km and Vmax values were calculated from the intercepts of the plots as described [30].
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
151
Fig. 1. Nucleotide sequence of guinea pig 11-HSD1 cDNA (GeneBank accession number AF188005), and the deduced amino acid sequence of 11-HSD1 polypeptide. A consensus site for N-glycosylation is boxed.
3. Results 3.1. Guinea pig 11-HSD1 cDNA sequence and the deduced primary structure The cloned guinea pig 11-HSD1 cDNA is approximately 1.3 kb in length, including a poly A tail of about 200 bp. The cloned guinea pig 11-HSD1 cDNA contains a 903 bp open reading frame that encodes a protein of 300 amino acids (Fig. 1). The deduced guinea pig 11-HSD1 polypeptide has a predicted molecular weight of 35 kDa, contains one consensus site for N-glycosylation, and displays 71– 74% sequence identity to other known mammalian 11HSD1 proteins (Fig. 2). Similar to those of other mammals, the deduced guinea pig 11-HSD1 protein contains the well-conserved putative
cofactor binding and catalytic motifs (Fig. 2). However, compared with sequences of other mammalian 11-HSD1 proteins, the deduced guinea pig sequence has a C-terminal extension of eight amino acids. Moreover, one of the two absolutely conserved consensus sites for N-glycosylation in other mammalian 11-HSD1 proteins is absent (Fig. 2). 3.2. Tissue distribution of 11-HSD1 mRNA When total RNA from a range of peripheral tissues and brain regions of an adult female guinea pig was analyzed by Northern blot analysis with the cloned 1.3-kb guinea pig 11-HSD1 cDNA as probe, a single 1.8-kb mRNA was detected in the liver and kidney with higher amounts in the former. A very faint signal was also detected in the adrenal gland. Under conditions of the present study, the mRNA for
152
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
Fig. 2. Comparison of the deduced human (GeneBank accession number M68487), monkey (S63400), mouse (X83202), and guinea pig 11-HSD1 amino acid sequences. Hyphens indicate identical amino acids with respect to the human sequence, and # indicates gaps that are required to align the sequences. The two absolutely conserved consensus sites for N-glycosylation in other mammals are indicated by the arrows. The putative cofactor binding site (A) and catalytic site (B) are underlined.
11-HSD1 was undetectable in the adult guinea pig heart, lung, spleen, small intestine, colon, skin, skeletal muscle, ovary, and brain regions (Fig. 3).
By comparison, when the same blot was reprobed with guinea pig 11-HSD2 cDNA probe, a single 2.0 kb transcript was detected, in the descending order of abundance,
Fig. 3. Tissue distribution of 11-HSD1 and 2 mRNAs as determined by Northern blot analysis. Total RNA samples (30 g) were analyzed. Autoradiographs of the same blot probed sequentially with [32P]guinea pig 11-HSD1 cDNA, [32P]guinea pig 11-HSD2 cDNA, and with [32P]mouse 18S rRNA cDNA to serve as a control, are shown.
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
153
Fig. 4. Tissue distribution of 11-HSD1 mRNA as determined by RT-PCR/Southern blot analysis. Total RNA samples (1.0 g) were subjected to a standard RT-PCR, and the resultant products were analyzed by Southern blot analysis, as described in Section 2. The autoradiograph of the blot probed with [32P]guinea pig 11-HSD1 cDNA, and [32P]human GAPDH cDNA to serve as a control, is shown.
in the kidney, colon, ovary, and spleen. This transcript was undetectable in the rest of the tissues including the brain regions (Fig. 3). The conclusion on the stomach can not be made, as there was considerably less total RNA loaded onto the gel (Fig. 3). To further determine if the lack of 11-HSD1 mRNA as assessed by Northern analysis was due to a much lower abundance or its absence, we utilized RT-PCR/Southern blot analysis and showed that the mRNA was indeed present in all the peripheral tissues, and the brain regions albeit at extremely lower levels (Fig. 4). It should be pointed out that the RT-PCR results were intended to show the presence or absence of the mRNA, rather than to obtain quantitative information. 3.3. Characteristics of guinea pig hepatic 11-HSD1 As shown in Fig. 3, high levels of 11-HSD1 mRNA were detected in the guinea pig liver. However, under the same experimental conditions, the mRNA for 11-HSD2 was undetectable, indicating that 11-HSD1 is the predominant, if not exclusive, 11-HSD isozyme in the guinea pig liver. Therefore, catalytic properties of 11-HSD enzyme activity in the hepatic microsomes were studied, and taken to represent those of 11-HSD1 in this species. 3.3.1. Cofactor preference In hepatic microsomes, the 11-HSD1 dehydrogenase activity showed a slight preference for NADP (57 ⫾ 5 and 69 ⫾ 2 pmol/min/mg protein in the presence of NAD and NADP, respectively), although appreciable amounts of the activity were detected even in the absence of cofactor (32 ⫾ 2 pmol/min/mg protein). By contrast, the 11-HSD1 reductase activity displayed a remarkable degree of cofactor dependency, the activity being 2 ⫾ 1, 6 ⫾ 2, and 121 ⫾ 7 pmol/min/mg protein in the absence and presence of NADH and NADPH, respectively (Fig. 5). 3.3.2. Kinetic characteristics Under conditions of the present study, 11-HSD1 in the guinea pig hepatic microsomes displayed equal affinity for
cortisol and cortisone (apparent Km of 2.85 ⫾ 0.33 and 2.77 ⫾ 0.29 M for cortisol and cortisone, respectively) (Fig. 6).
4. Discussion In the present study, we have determined the primary structure of the guinea pig 11-HSD1 by cloning its cDNA. The cloned guinea pig 11-HSD1 cDNA, when aligned with other known mammalian sequences, showed an expected high degree of conservation, including the translational start codon [3–5,31–33]. However, a single nucleotide alteration was observed in the well-conserved stop codon (TAG to GAG) within the open reading frame, which resulted in an extension of the guinea pig 11-HSD1 open reading frame by 24 nucleotides. Thus, the cloned guinea pig 11-HSD1 cDNA predicted a protein of 300 amino acids, which is longer, by eight amino acids, than those of other mammals at its C-terminus [3–5,31–33]. It is suspected that this extra ‘tail’ may alter its secondary/tertiary
Fig. 5. Cofactor dependence of 11-HSD1 activity in the guinea pig hepatic microsomes. The hepatic microsomes were incubated with 1.0 M cortisol and cortisone, in the absence and presence of NAD or NADP and NADH or NADPH for determining the dehydrogenase and reductase activity, respectively, as described in Section 2. Each bar represents group mean ⫹ SEM (n ⫽ 4).
154
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
Fig. 6. Plots according to the Michaelis–Menten equation for determining kinetic parameters of 11-HSD1 activity in the guinea pig hepatic microsomes. The hepatic microsomes were incubated with varying amounts of cortisol (0.5–10 M) in the presence of NADP (A) and with cortisone (0.5–10 M) in the presence of NADPH (B) for determining the kinetic parameters of the dehydrogenase and reductase, respectively, as described in Section 2. Each experiment was conducted in duplicate, and a total of 4 independent experiments were conducted for the dehydrogenase and reductase, respectively. Data are presented as mean ⫹ SEM (n ⫽ 4).
structure, leading to changes in the catalytic function of this enzyme. In addition, the deduced guinea pig 11-HSD1 protein lacks one of the two well-conserved consensus sites for N-glycosylation [34]. In an elegant study by Agarwal and colleagues [35] in which the effects of glycosylation were examined in detail by introducing mutations into the two N-linked glycosylation sites (residues 158 –160 and 203– 205). It was demonstrated that the second glycosylation site was essential for both dehydrogenase and reductase activities. Moreover, the modification of the first site caused a 50 to 75% reduction in reductase activity without any effect on dehydrogenase activity. It is noteworthy that the first gly-
cosylation site is absent from the deduced guinea pig 11HSD1 protein. Thus, the guinea pig provides a naturally altered 11-HSD1 in which to study the role of N-glycosylation as well as the C-terminus in the function of 11HSD1. To gain insight into the functional significance of these structural changes in the deduced guinea pig enzyme, we have characterized the intrinsic properties of 11-HSD1 enzyme activity in the guinea pig hepatic microsomes. Although the reductase activity was clearly NADPH-dependent, the dehydrogenase activity can be driven by NAD and NADP. This is consistent with previous studies that used both sheep [10] and mouse [36] hepatic microsomes. Moreover, like the present study, those studies using tissue microsomes [10,36] demonstrated clearly the presence of reductase activity. Therefore, similar to 11-HSD1 in other species [2,3, 10], the guinea pig hepatic enzyme is a low affinity NADP(H)-dependent dehydrogenase/reductase. However, unlike other mammals whose affinity for cortisone is approximately 10⫻ higher than that for cortisol [3], the guinea pig 11-HSD1 displays equal affinity for the two substrates. The higher affinity of 11-HSD1 for cortisone in other mammals may explain why it functions predominantly as a reductase in intact cells. Given that cortisone circulates largely in the free, unbound form, the bioformation of cortisol by the action of 11-HSD1 reductase may play an important role in determining the sensitivity of individual tissues to glucocorticoids [25]. The relatively lower affinity of the guinea pig hepatic 11-HSD1 for cortisone would suggest that the intracellular bioformation of cortisol from circulating cortisone may be less efficient in this species. This may help to ensure that in the face of very high circulating cortisol levels, the intracellular level of cortisol in individual glucocorticoid-target tissues in the guinea pig is not further aggravated by the local formation from cortisone. It is possible that the reduced affinity of the guinea pig hepatic 11-HSD1 for cortisone is the result of alterations in its deduced primary structure, especially in light of the observed decreases in reductase activity when the first glycosylation site was modified [35]. Further studies that use site-directed mutagenesis are in progress to establish such a causal relationship. It is interesting to note that in a previous study by Moore and co-workers [3] it was shown that the hepatic 11-HSD1 in the squirrel monkey, another animal model of glucocorticoid resistance, was similar to that in the human with respect to primary structure and catalytic properties. This is in marked contrast to the findings in our present study. These differences in 11-HSD1 between the two glucocorticoid resistant species may represent species differences in their adaptation to high glucocorticoid levels. The model of 11-HSD1 as an end-organ modulator of glucocorticoid function depends fundamentally on its proper spatial/temporal expression and abundance. In the
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
adult guinea pig, 11-HSD1 mRNA, as determined by Northern blot analysis, was detected only in the liver and kidney with a much lower abundance in the adrenal gland. With RT-PCR, the mRNA for 11-HSD1 was detectable in all the peripheral tissues studied including heart, lung, spleen, stomach, small intestine, colon, skin, skeletal muscle, and ovary. This indicates that the expression of 11HSD1 is at a very low level in the guinea pig peripheral tissues except for the liver and kidney. More remarkably, the guinea pig brain expresses extremely low levels, if any, of 11-HSD1 mRNA. This is in marked contrast to the relatively abundant expression of 11-HSD1 mRNA in the brain and peripheral tissues of other mammals [26,37–39]. For instance, in adult mice, 11-HSD1 mRNA was clearly detectable by Northern analysis in the brain and in the majority, if not all, of peripheral tissues examined [40]. Given that the tissue level of 11-HSD1 mRNA is wellcorrelated with that of the enzyme activity [38], the relatively lower expression of 11-HSD1 in the guinea pig would mean less intracellular cortisol bioformation from cortisone. Likewise, the near absence of 11-HSD1 expression in the guinea pig brain may help facilitate glucocorticoid resistance by not producing cortisol locally from circulating cortisone. Thus, the present study has identified two potential mechanisms in the guinea pig, namely a partially deficient 11-HSD1 reductase and a much lower level of its expression in both the brain and peripheral tissues, which together may function to ensure that in the face of very high circulating cortisol levels, the intracellular level of cortisol in individual glucocorticoid-target tissues is not further aggravated by the local formation from cortisone. However, the precise physiological significance of 11-HSD1 in the guinea pig remains to be determined. New insight into the role of 11-HSD1 in the control of glucocorticoid actions has been provided recently through elegant studies in which the consequence of 11-HSD1 knockout was investigated [25]. Although not essential for fetal development or adult life, 11-HSD1 has profound effects on the adrenal gland and glucocorticoid-mediated biologic functions. For example, mutant mice lacking 11HSD1 showed adrenal hyperplasia and increased adrenal secretion of corticosterone. In addition, these mice had attenuated glucocorticoid-inducible responses and resisted hyperglycemia on obesity or stress [25]. The importance of this enzyme has also been realized through clinical studies of the apparent E (cortisone) reductase deficiency (AERD). This is the converse disorder of AME, which was first described in the mid-80s [41] and the characteristics of which consists of hypercortisolism without Cushing’s syndrome and over production of cortisone. Given that the reductase activity is an intrinsic property of 11-HSD1 that is primarily produced in the liver, this disorder is probably caused by hepatic 11-HSD1 dysfunction [42]. However, the molecular basis of the suspected 11HSD1 dysfunction remains to be determined. In the present
155
study, we have identified distinct features in the primary structure, the catalytic function (based on the hepatic microsomes) and the tissue distribution pattern of 11-HSD1 in the guinea pig, a laboratory animal resembling the human AERD in its ability to resist high circulating levels of cortisol. Thus, the guinea pig provide a useful model in which the structural determinants of catalytic function of 11-HSD1 may be studied. Acknowledgment We thank Dr R. Sampath–Kumar for his helpful input during the course of this study. References [1] White PC, Mune T, Agarwal AK. 11-Hydroxysteroid dehydrogenase and the syndrome of apparent mineralocorticoid excess. Endocr Rev 1997;18:135–56. [2] Agarwal AK, Tusie–Luna MT, Monder C, White PC. Expression of 11-hydroxysteroid dehydrogenase using recombinant vaccinia virus. Mol Endocrinol 1990;4:1827–32. [3] Moore CCD, Mellon SH, Murai J, Siiteri PK, Miller WL. Structure and function of the hepatic form of 11-hydroxysteroid dehydrogenase in the squirrel monkey, an animal model of glucocorticoid resistance. Endocrinology 1993;133:368 –75. [4] Tannin GM, Agarwal AK, Monder C, New MI, White PC. The human gene for 11-hydroxysteroid dehydrogenase. Structure, tissue distribution, and chromosomal localization. J Biol Chem 1991;266: 16653– 8. [5] Yang K, Smith CL, Dales D, Hammond GL, Challis JR. Cloning of an ovine 11-hydroxysteroid dehydrogenase complementary deoxyribonucleic acid: tissue and temporal distribution of its messenger ribonucleic acid during fetal and neonatal development. Endocrinology 1992;131:2120 – 6. [6] Jamieson PM, Chapman KE, Edwards CRW, Seckl JR. 11-hydroxysteroid dehydrogenase is an exclusive 11-reductase in primary cultures of rat hepatocytes: effect of physiochemical and hormonal manipulations. Endocrinology 1995;136:4754 – 61. [7] Rusvai E, Naray Fejes Toth A. A new isoform of 11 -hydroxysteroid dehydrogenase in aldosterone target cells. J Biol Chem 1993;268: 10717–20. [8] Albiston AL, Obeyesekere V, Smith R, Krozowski ZS. Cloning and tissue distribution of the human 11-hydroxysteroid dehydrogensae type 2 enzyme. Mol Cell Endocrinol 1994;105:R11–R17. [9] Stewart PM, Murry BA, Mason JI. Human kidney 11-hydroxysteroid dehydrogenase is a high affinity nicotinamide adenine dinucleotide-dependent enzyme and differs from the cloned type I isoform. J Clin Endocrinol Metab 1994;79:480 – 4. [10] Yang K, Yu M. Evidence for distinct isoforms of 11-hydroxysteroid dehydrogenase in the ovine liver and kidney. J Steroid Biochem Mol Biol 1994;49:245–50. [11] Murphy BE. Ontogeny of cortisol-cortisone interconversion in human tissues: a role for cortisone in human fetal development. J Steroid Biochem 1981;14:811–7. [12] Seckl JR, Benediktsson R, Lindsay RS, Brown RW. Placental 11hydroxysteroid dehydrogenase and the programming of hypertension. J Steroid Biochem Mol Biol 1995;55:447–55. [13] Edwards CR, Stewart PM, Burt D, Brett L, McIntyre MA, Sutanto WS, de Kloet ER, Monder C. Localization of 11-hydroxysteroid dehydrogenase–tissue specific protector of the mineralocorticoid receptor. Lancet 1988;2:986 –9.
156
X. Pu, K. Yang / Steroids 65 (2000) 148 –156
[14] Funder JW, Pearce PT, Smith R, Smith AI. Mineralocorticoid action: target tissue specificity is enzyme, not receptor, mediated. Science 1988;242:583–5. [15] Ulick S, Levine LS, Gunczler P, Giovanni Z, Ramirez LC, Rauh W, Rosler A, Bradlow HL, New MI. A syndrome of apparent mineralocorticoid excess associated with defects in the peripheral metabolism of cortisol. J Clin Endocrinol Metab 1979;49:757– 64. [16] Stewart PM, Wallace AM, Valentino R, Burt D, Shackleton CH, Edwards CR. Mineralocorticoid activity of liquorice: 11-hydroxysteroid dehydrogenase deficiency comes of age. Lancet 1987;2:821– 4. [17] Stewart PM, Corrie JE, Shackleton CH, Edwards CR. Syndrome of apparent mineralocorticoid excess. A defect in the cortisol-cortisone shuttle. J Clin Invest 1988;82:340 –9. [18] Funder JW. The tale of the guinea pig. Front Neuroendocrinol 1994; 15:384 –9. [19] Keightley M-C, Fuller PJ. Anomalies in the endocrine axes of the guinea pig: relevance to human physiology and disease. Endocr Rev 1996;17:30 – 44. [20] Fujieda K, Goff AK, Pugeat M, Strott CA. Regulation of the pituitary-adrenal axis and corticosteroid-binding globulin-cortisol interaction in the guinea pig. Endocrinology 1982;111:1944 –50. [21] Smith AI, Wallace CA, Moritz RL, Simpson RJ, Schmauk–White LB, Woodcock EA, Funder JW. Isolation, amino acid sequence and superagonist steroidogenic activity of guinea pig ACTH. J Endocrinol 1987;115:5– 8. [22] Keightley M-C, Fuller PJ. Molecular cloning and sequencing of a guinea pig pro-opiomelanocortin cDNA. Mol Cell Endocrinol 1991; 82:89 –98. [23] Kraft N, Hodgson AJ, Funder JW. Glucocorticoid receptor and effector mechanisms: a comparison between the corticosensitive mouse and the corticoresistant guinea pig. Endocrinology 1979;104:344 –9. [24] Keightley M-C, Fuller PJ. Unique sequences in the guinea pig glucocorticoid receptor induce constitutive transactivation and decrease steroid sensitivity. Mol Endocrinol 1994;8:431–9. [25] Kotelevtsev Y, Holmes MC, Burchell A, Houston PM, Schmoll D, Jamieson P, Best R, Brown R, Edwards CRW, Seckl JR, Mullins JJ. 11-Hydroxysteroid dehydrogenase type 1 knockout mice show attenuated glucocorticoid-inducible responses and resist hyperglycemia on obesity or stress. Proc Natl Acad Sci USA 1997;94:14924 –9. [26] Whorwood CB, Franklyn JA, Sheppard MC, Stewart PM. Tissue localization of 11-hydroxysteroid dehydrogenase and its relationship to the glucocorticoid receptor. J Steroid Biochem Mol Biol 1992;41:21– 8. [27] Frohman MA. RACE: rapid amplification of cDNA ends. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR Protocols—A Guide to Methods and Applications. San Diego: Academic Press, 1990. pp. 28 –38. [28] Langlois DA, Matthews SG, Yu M, Yang K. Differential expression of 11-hydroxysteroid dehydrogenase 1 and 2 in the developing ovine fetal liver and kidney. J Endocrinol 1995;147:405–11.
[29] Sampath–Kumar R, Matthews SG, Yang K. 11-hydroxysteroid dehydrogenase type 2 is the predominant isozyme in the guinea pig placenta: decreases in mRNA and activity at term. Biol Reprod 1998;59:1378 – 84. [30] Henderson PJF. Statistical analysis of enzyme kinetic data. In: Eisenthal R, Danson MJ, editors. Enzyme assays: a practical approach. New York: Oxford University Press, 1992. pp. 277–316. [31] Agarwal AK, Monder C, Eckstein B, White PC. Cloning and expression of rat cDNA encoding corticosteroid 11-dehydrogenase. J Biol Chem 1989;264:18939 – 43. [32] Oppermann UCT, Netter KJ, Maser E. Cloning and primary structure of murine 11-hydroxysteroid dehydrogenase/microsomal carbonyl reductase. Eur J Biochem 1995;227:202– 8. [33] Rajan V, Chapman KE, Lyons V, Jamieson P, Mullins JJ, Edwards CRW, Seckl JR. Cloning, sequencing and tissue-distribution of mouse 11-hydroxysteroid dehydrogenase-1 cDNA. J Steroid Biochem Mol Biol 1995;52:141–7. [34] Ozols J. Lumenal orientation and post-translational modifications of the liver microsomal 11-hydroxysteroid dehydrogenase. J Biol Chem 1995;270:2305–12. [35] Agarwal AK, Mune T, Monder C, White PC. Mutations in putative glycosylation sites of rat 11-hydroxysteroid dehydrogenase affect enzymatic activity. Biochim Biophys Acta Protein Struct Mol Enzymol 1995;1248:70 – 4. [36] Maser E, Bannenberg G. The purification of 11-hydroxysteroid dehydrogenase from mouse liver microsomes. J Steroid Biochem Mol Biol 1994;48:257– 63. [37] Tannin GM, Agarwal AK, Monder C, New MI, White PC. The human gene for 11-hydroxysteroid dehydrogenase. J Biol Chem 1991;266:16653– 8. [38] Moisan M-P, Seckl JR, Edwards CRW. 11-Hydroxysteroid dehydrogenase bioactivity and mRNA expression in rat forebrain: localization in hypothalamus, hippocampus, and cortex. Endocrinology 1990;127:1450 –5. [39] Roland BL, Krozowski ZS, Funder JW. Glucocorticoid receptor, mineralocorticoid receptors, 11-hydroxysteroid dehydrogenase-1 and -2 expression in rat brain and kidney: in situ studies. Mol Cell Endocrinol 1995;111:R1–R7. [40] Cole TJ. Cloning of the mouse 11-hydroxysteroid dehydrogenase type 2 gene: tissue specific expression and localization in distal convoluted tubules and collecting ducts of the kidney. Endocrinology 1995;136:4693– 6. [41] Phillipou G, Higgins BA. A new defect in the peripheral conversion of cortisone to cortisol. J Steroid Biochem Mol Biol 1985; 22:435– 6. [42] Phillipov G, Palermo M, Shackleton CHL. Apparent cortisone reductase deficiency: a unique form of hypercortisolism. J Clin Endocrinol Metab 1996;81:3855– 60.