- Email: [email protected]
High intensity interval training favourably affects antioxidant and inflammation mRNA expression in early-stage chronic kidney disease
Author’s Accepted Manuscript High intensity interval training favourably affects antioxidant and inflammation mRNA expression in early-stage chronic kidney disease Patrick S. Tucker, David R. Briskey, Aaron T. Scanlan, Jeff S. Coombes, Vincent J. Dalbo www.elsevier.com
PII: DOI: Reference:
S0891-5849(15)00597-3 http://dx.doi.org/10.1016/j.freeradbiomed.2015.07.162 FRB12582
To appear in: Free Radical Biology and Medicine Received date: 20 May 2015 Revised date: 14 July 2015 Accepted date: 25 July 2015 Cite this article as: Patrick S. Tucker, David R. Briskey, Aaron T. Scanlan, Jeff S. Coombes and Vincent J. Dalbo, High intensity interval training favourably affects antioxidant and inflammation mRNA expression in early-stage chronic kidney disease, Free Radical Biology and Medicine, http://dx.doi.org/10.1016/j.freeradbiomed.2015.07.162 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
High intensity interval training in CKD High intensity interval training favourably affects antioxidant and inflammation mRNA expression in early-stage chronic kidney disease Patrick S. Tucker1,2, David R. Briskey3, Aaron T. Scanlan1,2, Jeff S. Coombes3, and Vincent J. Dalbo1,2 1
Clinical Biochemistry Laboratory, Bruce Highway, Building 81, Central Queensland University, Rockhampton, Australia 4702 2
Human Exercise and Training Laboratory, Bruce Highway, Building 81, Central Queensland University, Rockhampton, Australia 4702 3
Antioxidant Research Group, Room 535, Human Movement and Nutrition Sciences Building, University of Queensland, Brisbane, Australia 4072 Patrick S. Tucker – [email protected] David R. Briskey – [email protected] Aaron T. Scanlan – [email protected] Jeff S. Coombes – [email protected] Vincent J. Dalbo – [email protected] Corresponding Author: Vincent J. Dalbo, PhD Director of the Clinical Biochemistry Laboratory School of Medical and Applied Sciences Central Queensland University Bruce Highway, Building 81, Room 1.11 Rockhampton, Queensland, 4702 Phone: +61 7 4923 2289 Email: [email protected] Running Head: High intensity interval training in CKD Key Words: Renal disease, reactive oxygen species, nephrology, antioxidant status, exercise, high intensity interval training
1
High intensity interval training in CKD Abstract Increased levels of oxidative stress and inflammation have been linked to the progression of chronic kidney disease. To reduce oxidative stress and inflammation related to chronic kidney disease, chronic aerobic exercise is often recommended. Data suggests high intensity interval training may be more beneficial than traditional aerobic exercise. However, appraisals of differing modes of exercise, along with explanations of mechanisms responsible for observed effects, are lacking. This study assessed effects of eight weeks of high intensity interval training (85% VO2max), versus low intensity exercise (45-50% VO2max) and sedentary behaviour, in an animal model of early-stage chronic kidney disease. We examined kidney-specific mRNA expression of genes related to endogenous antioxidant enzyme activity (glutathione peroxidase 1; Gpx1, superoxide dismutase 1; Sod1, and catalase; Cat) and inflammation (kidney injury molecule 1; Kim1 and tumour necrosis factor receptor super family 1b; Tnfrsf1b), as well as plasma F2-isoprostanes, a marker of lipid peroxidation. Compared to sedentary behaviour, high intensity interval training resulted in increased mRNA expression of Sod1 (p=0.01) and Cat (p<0.001). Compared to low intensity exercise, high intensity interval training resulted in increased mRNA expression of Cat (p<0.001) and Tnfrsf1b (p=0.047). In this study, high intensity interval training was superior to sedentary behaviour and low intensity exercise as high intensity interval training beneficially influenced expression of genes related to endogenous antioxidant enzyme activity and inflammation.
Key Words: Renal disease, reactive oxygen species, nephrology, antioxidant status
2
High intensity interval training in CKD Introduction It is estimated that 10% Australians over the age of 18 years have clinical evidence of chronic kidney disease (CKD), a progressive and irreversible condition. Although it is possible to slow the progression of CKD, CKD-related risk factors and comorbidities become more difficult to manage as CKD progresses, resulting in a life expectancy that decreases in accordance with decreasing kidney function. As such, the development of therapies dedicated to decelerating the progression of CKD is warranted. Emerging evidence suggests that reducing oxidative stress (OS) and inflammation (INF) may be the most effective way to slow CKD progression [1, 2]. The overabundance of radicals, apparent during OS, react with molecular components of a nephron leading to oxidation of amino acids [3], lipid peroxidation of cell membranes [3], and cleavage and crosslinking of renal DNA [4]. These reactions promote nephron damage and encourage a cyclical series of events characterised by recurrent cellular- and molecular-level nephron damage. As radical-mediated nephron damage occurs, the resultant inflammatory response generates superoxide [5] via neutrophils’ membrane-associated nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system. Superoxide and other radicals continue to promote kidney injury or act as immuno-messaging molecules, resulting in a locally sustained immune response [1]. To assess kidney-specific damage and inflammation, kidney injury molecule-1 (KIM1) has emerged as a useful biomarker. Undetectable in normal kidneys [6], KIM1 expression is increased in damaged tubular cells [7, 8], is associated with tubular necrosis [8] and INF [7], is related to the development of tubulointerstitial fibrosis [7], and is negatively correlated with renal function [7]. Free radicals and fibrosis further aggravate damaged tissue, resulting in recruitment of inflammatory cytokines that promote injury in distal tissues.
3
High intensity interval training in CKD Inflammatory cytokines such as tumour necrosis factor-α (TNFα) activate signalling pathways that promote nuclear factor κB (NFκB) transcription factors by binding to TNFα receptors, such as tumour necrosis factor receptor superfamily, member 1b (TNFRSF1b) [9]. NFκB transcription factors prompt transcription of genes involved in systemic inflammatory responses, encouraging generation of radicals via phagocytic activity [9]. Regulating NFκBmediated INF is one beneficial effect of endogenous antioxidant enzymes (eAO). Specifically, superoxide dismutase (SOD), glutathione peroxidase (GPX), and catalase (CAT) quench radicals while simultaneously inhibiting nuclear translocation of NFκB [10], thereby reducing systemic INF and INF-related radical generation. Chronic aerobic exercise has emerged as a promising means of reducing OS and INF. Mechanisms responsible for beneficial effects of chronic aerobic exercise are traininginduced up-regulation of SOD [11] and CAT [12], reduced mitochondrial reactive oxygen species [13], and reduced expression of NADPH oxidase [14]. It has been proposed that chronic high-intensity interval training (HIIT) (≈85% VO2max) may elicit greater health benefits than traditional chronic aerobic exercise. Reasons for this supposition include improvements in SOD activity [11], aerobic capacity [15], blood lipids [16], and blood pressure [17] that are more remarkable when exercise is performed at higher intensities. Investigations examining effects of HIIT on biochemical and molecular markers of eAO, OS, and INF, especially in models of early-stage CKD, are unavailable. The purpose of the present study was to examine effects of HIIT (4 times per week for 8 weeks), light intensity exercise (LIT) (4 times per week for 8 weeks), and sedentary behaviour (SED) on the expression of genes associated with eAO activity (Sod1, Gpx1, and Cat) and INF (Kim1, Tnfrsf1b), as well as a reliable plasma marker of OS (F2-isoprostanes) in an animal model of early-stage CKD. It was hypothesised that HIIT would exert a more beneficial effect on the expression of genes associated with eAO and INF, compared to SED and LIT conditions. As
4
High intensity interval training in CKD such, we also hypothesised that plasma levels of F2-isoprostanes would be significantly reduced following HIIT, compared to SED and LIT conditions.
Materials and Methods Animals and General Overview Male spontaneously hypertensive rats (SHR) (n=39) (Animal Resource Centre, Canning Vale, WA, Australia) were housed in a temperature-controlled room (22–25°C) with a dark-light cycle of 12:12 hours and provided ad libitum access to standard laboratory chow and water. At the time of arrival, rats were 4-5 weeks old. Following a 2-week habituation period, allowing for acclimatisation to their new environment, all rats underwent a unilateral nephrectomy (6-7 weeks old). Following surgery, rats were allowed to recover for 2 weeks prior to the initiation of an 8-week exercise intervention. Blood pressures, body weights, and body lengths were recorded at pre-surgery, baseline (pre-exercise), 4 weeks (midintervention), and 8 weeks (post-intervention). Following the 8-week intervention, rats were euthanised 24 hours following their last bout of exercise and tissues were collected for subsequent analysis. All research procedures were granted prior approval by an institutional Animal Ethics Committee (Animal Ethics Committee of CQUniversity, project A13/11-305). Anesthetisation and Euthanasia Procedures Prior to nephrectomy, rats were anesthetised with Zoletil (25 mg/kg) and Xylazine (10 mg/kg). For pain relief, Meloxicam (2 mg/kg) was injected once daily for 2 days following nephrectomy. Prior to blood pressure readings, rats were anesthetised with Zoletil (25 mg/kg). Saline was injected subcutaneously following each anesthetisation to help avoid dehydration. Prior to being euthanised, rats were given a Lethabarb injection (1.5 mg/kg).
Exercise Protocol
5
High intensity interval training in CKD Rats were randomly assigned to one of three treatment groups: sedentary (SED, n=12), light intensity exercise (LIT, n=13), and high intensity interval exercise (HIIT, n=14). The number of animals assigned to each group was dependant on the form of exercise, as the possibility existed that aerobic exercise may have proven too strenuous, resulting in the need to withdraw an animal from the experiment. However, there were no adverse events in any group, suggesting that aerobic exercise was well-tolerated in this disease model. At 8-9 weeks of age, rats in the LIT and HIIT groups began treadmill running for 8 weeks. An identical 5-minute warm-up (15 m/min) was performed by both training groups before each exercise session. In this study, treadmill exercise protocols were based on work previously performed in this specific area [18]. Rats in the LIT group exercised at a treadmill speed of 15 m/min with an incline of 1° (45-50 VO2max) [18], up to 33 minutes per day, 4 days per week, for 8 weeks. Rats in the HIIT group exercised at a treadmill speed of up to 50 m/min with an incline of up to 10° (≈85 VO2max) [18], 30 minutes per day (2-minute stationary period followed by 1-minute sprint x 10 repetitions), 4 days per week, for 8 weeks. To permit adequate adaptation to treadmill running, thereby allowing each exercise session to be completed in its entirety, exercise training was progressive. By the beginning of the fourth week of training, all rats were performing exercise sessions at maximum intensity/duration – the exercise effort remained constant for the remaining 5 weeks of training. In an effort to standardise variables related to exercise training, while simultaneously allowing for the comparison of different intensities, sessions between LIT and HIIT groups were matched based on distance travelled per bout; despite the difference in exercise intensity between groups, LIT and HIIT rats travelled the same distance (±1 meter) during each exercise session, with distances progressing in unison from ≈200 meters per session in week 1 to ≈500 meters per session in week 8. (Table 1 – republished with permission [19])
6
High intensity interval training in CKD Table 1 around here
Tissue Homogenisation and mRNA Isolation Tissue used for analyses were chosen based on tissue-specific transcriptomic work performed in SHRs [20]. Renal tissue specifically consisted of renal cortex as mRNA is differentially expressed dependant on the type of renal tissue [21]. Approximately 100 mg (± 10 mg) of renal tissue was homogenised in 1 ml of TRI-reagent, using the TRI-reagent method (Sigma Aldrich, St. Louis, MO, USA). Samples were then centrifuged at 12,000 x g for 10 minutes at 4°C. The resulting supernatant was transferred to a new microtube and incubated for 5 minutes, at room temperature, to allow for disassociation of the nucleoprotein complex. Following incubation, 0.2 ml of chloroform was added before this solution was mixed and then incubated for 3 minutes. Samples were then centrifuged at 12,000 x g for 15 minutes at 4°C. The resulting supernatant was transferred to a new microtube. Following this separation, 500 μl of 2-propanol was added to each microtube. Microtubes were incubated at room temperature for 10 minutes and then centrifuged at 12,000 x g for 10 minutes at 4°C. The resulting supernatant was removed, leaving behind a mRNA pellet. The mRNA pellet was exposed to 2 ethanol washes (1 ml, 75%). Following each wash, microtubes were vortexed, centrifuged at 7,500 x g for 5 minutes at 4°C. The mRNA pellets were then allowed to air dry under a fume hood before being dissolved in 30 μl of RNase-free water. A 260/280 ratio was calculated to assess mRNA purity, with all ratios falling within commonly accepted parameters. The diluted mRNA samples were stored at −80°C until later analyses.
Total mRNA Determination and Reverse Transcription Total mRNA concentrations from each sample were determined using a spectrophotometer (NanoDrop 2000c, Thermo Scientific, Wilmington, DE, USA). Next, mRNA concentrations were adjusted to 400 ng/μl by diluting the crude total mRNA extracts
7
High intensity interval training in CKD with RNase-free water. The standardised solutions of total cellular mRNA were reverse transcribed to synthesise complimentary DNA (cDNA) using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Briefly, 2x RT master mix was prepared per kit instructions. Next, 10 μl of RT mix was added (and mixed via pipette trituration) to 10 μl of the standardised mRNA solution. These samples were placed on a thermal cycler (T100 Thermal Cycler, Bio-Rad, Gladesville, NSW, Australia) set to run at: 25°C for 10 minutes, 37°C for 120 minutes, and 85°C for 5 minutes. Following reverse transcription, the resulting cDNA template concentrations were diluted to 5 ng/μl by adding RNase free water. The standardised cDNA solutions were frozen at −80°C until quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed.
Quantitative Reverse Transcription Polymerase Chain Reaction Analysis Forward and reverse oligonucleotide primer pairs were developed using National Centre for Biotechnology Information’s (NCBI, Bethesda, MD, USA) Primer Designer Tool before being commercially synthesised (GeneWorks, Hindmarsh, SA, Australia) (Table 2). Gapdh was used as an internal reference gene for detecting relative change in the quantity of target mRNA due to its consideration as a constitutively expressed housekeeping gene following exercise training. Following the examination of primer efficiencies, qRT- PCR reactions were mixed. Reactions contained the following mixture: 2.5 μl of prepared cDNA template, 5 μl of SYBR Select Master Mix (Life Technologies, Mulgrave, Victoria, Australia), 0.5 μl of sense and anti-sense primers, and 1.5 μl RNase free water. Following the mixture of each reaction, qRT-PCR was performed with a thermal cycler (Rotor-Gene Q, Qiagen, Venlo, Netherlands). The amplification sequence involved an initial 10-minute cycle at 95°C, followed by 40 cycles, each composed of a denaturation step (95°C for 15 seconds) and a primer annealing/extension step (60°C for 45 seconds). Melting curves were performed
8
High intensity interval training in CKD to ensure that sufficient PCR product was being generated by each primer, in the absence of primer dimers. All assays were performed in duplicate (coefficient of variation = 0.01). mRNA expression data were calculated using the Livak method [22] and data are presented as the fold change of the gene of interest, relative to that of control animals.
Table 2 around here
Plasma F2-Isoprostanes Plasma F2-isoprostanes were measured using gas chromatography-tandem mass spectrometry per methods which are outlined in detail elsewhere [23]. To analyse F2isoprostane content, a Varian 320 MS/MS, with a Varian 450 gas chromatograph equipped with a CP8400 auto sampler was used. F2-isoprostane data was analysed using the Varian MS Workstation-System control software (Version 6.9.2, Varian, Australia).
Clinical Measurements Detailed methods describing the collection and analysis of clinical measurements, in the animals discussed in the current investigation, have been previously reported [19]. Briefly, clinical measures included systolic blood pressure, remnant kidney weight, remnant kidney weight to body weight ratio, and plasma levels of high density lipoprotein, low density lipoprotein, triglycerides, total cholesterol, albumin, and creatinine. These measurements receive consideration in the Discussion section of this manuscript as they help elucidate mechanisms that may relate to findings in the current study.
Statistics mRNA data are presented as mean ± standard error of the mean (SEM). Plasma F2isoprostane data are presented as mean ± standard deviation (SD). Data for mRNA expression
9
High intensity interval training in CKD (Sod1, Gpx1, Cat, Kim1, and Tnfrsf1b) and plasma F2-isoprostanes were analysed using separate between-group one-way ANOVAs with Tukey post-hoc comparisons. Analyses were performed using IBM SPSS Statistics (v20.0, IBM Corporation; Armonk, NY, USA). Statistical significance was set at p<0.05.
Results Clinical Measurements Clinical measurements relating to the animals in the current investigation have been previously reported [19]. A summation of these results can be found in Table 3.
Quantitative Reverse Transcription Polymerase Chain Reaction Analysis Results pertaining to renal expression of eAO-related mRNA can be seen in Figure 1. In HIIT, mRNA expression of Sod1 was significantly up-regulated, compared to SED (p=0.001) and mRNA expression of Cat was significantly up-regulated, compared to SED (p<0.001) and LIT (p<0.001). Results pertaining to renal expression of INF-related mRNA can be seen in Figure 2. In HIIT, mRNA expression of Tnfrsf1b was significantly upregulated, compared to LIT (p=0.047).
Figure 1 around here Figure 2 around here
Plasma F2-Isoprostanes Results pertaining to plasma F2-isoprostanes can be seen in Table 3. A one-way ANOVA revealed significant between-group differences in plasma F2-isoprostanes (F(2,35) = 3.882, p=0.03). Following Tukey post-hoc comparisons, between-group differences in
10
High intensity interval training in CKD plasma F2-isoprostanes failed to reach statistical significance (SED v. LIT, p=0.992; SED v. HIIT, p=0.066; LIT v. HIIT, p=0.051).
Table 3 around here
Discussion This is the first investigation to compare the efficacy of HIIT with LIT and sedentary behaviour, in regard to the modulation of kidney-specific mRNA expression of genes related to eAO and INF. Compared to SED, HIIT resulted in increased mRNA expression of Sod1 (p=0.01) and Cat (p<0.001). Compared to LIT, HIIT resulted in increased mRNA expression of Cat (p<0.001) and Tnfrsf1b (p=0.047). Improvements in plasma levels of F2-isoprostanes were apparent in HIIT, compared to SED and LIT, but results failed to reach statistical significance (v. SED, p=0.066; v. LIT; p=0.051). To date, few studies have compared the effects of different types of chronic aerobic exercise on eAO activity. However, there is sufficient evidence to suggest that chronic aerobic exercise influences the expression and activity of eAO-related markers and that these effects are further influenced by exercise intensity [11]. Significant HIIT-related increases in the mRNA expression of Sod1 (compared to SED, p=0.001) and Cat (compared to SED and LIT, p<0.001) in the current study are supported by previous work. In rats, moderate- (65% VO2max) and high-intensity (75% VO2max) chronic aerobic exercise resulted in significantly increased SOD activity, compared to low-intensity (55% VO2max) and sedentary conditions [11] in the right ventricle of the heart. In addition, treadmill running performed for 8 weeks (50 min/day, 5 days/wk, 17 m/min) [24] and 14 weeks (60 min/day, 3 days/wk, 30 m/min) [25] resulted in significant increases in kidney-specific SOD activity [24] and CAT activity in the tibialis anterior [25], compared to sedentary rats. Although research suggests increases in
11
High intensity interval training in CKD exercise intensity results in increased levels of OS and INF, it is the repeated exposure to increased oxidative and inflammatory insult that seems to be responsible for positive exercise-induced adaptations, namely increases in eAO activity [11, 25]. At present, much of the work focusing on the effects of exercise on eAO utilises blood markers and skeletal muscle tissue. As such, tissue-specific work (e.g. kidney) as it relates to specific diseases (e.g. CKD) is timely. Disease-relevant, tissue-specific work is also important when assessing INF. Reviewed elsewhere [26], research suggests that TNFα receptors should be considered important targets in CKD [26, 27], a notion that is supported by the current data. Transgenic animal studies have shown that reduced Tnfrsf1b mRNA expression is associated with endothelial apoptosis [27] and increased risk of heart failure [28], while increased Tnfrsf1b mRNA expression is associated with ischemia-mediated adaptive angiogenesis [29]. Further, increased TNFRSF1B protein expression is associated with tubular cell regeneration in kidney tissue [30]. Fortunately, exercise may beneficially mediate Tnfrsf1b mRNA expression. In the current study, HIIT resulted in a significant up-regulation of Tnfrsf1b mRNA expression in kidney tissue, compared to LIT (p=0.047). Similarly, Padilla et al. reported seven days of voluntary exercise resulted in non-significant increases in Tnfrsf1b mRNA expression in the renal arteries of voluntarily active rats (30 days of voluntary exercise), compared to involuntarily inactive rats (23 days of voluntary exercise, followed by 7 days of mandatory sedentary behaviour) [31]. This is noteworthy as decreased TNFRSF1B protein expression has been linked to increases in TNFα-induced apoptosis in cells that are crucial to immuno-regulation and inflammatory responses such as lymphocytes [32]. Considering our findings, in conjunction with findings that describe (a) the ability of chronic aerobic exercise to significantly reduce TNFα mRNA expression [33], (b) the inverse relationship between
12
High intensity interval training in CKD serum levels of TNFα and TNF receptors [34], and (c) the inverse relationship between TNFα-induced apoptosis and TNFRSF1B protein expression [32], we propose that HIIT favourably influences TNFα activity, as evidenced by an increase in the expression of Tnfrsf1b mRNA. Furthermore, based on our data, we propose the ability of exercise to influence TNFα activity is intensity-dependant as HIIT resulted in a significant up-regulation of Tnfrsf1b mRNA expression, compared to LIT (p=0.047). Using the present group of animals, we previously reported [19] that HIIT was more effective at improving plasma levels of LDL (p=0.001), triglycerides (p=0.029), and total cholesterol (p=0.02), compared to LIT. This led us to speculate that HIIT-related improvements to lipid markers may have partially explained the non-significant differences in post-intervention SBP in HIIT (227.12 mmHg), compared to SED (239.77 mmHg, +5.28% v. HIIT) and LIT (241.63 mmHg, +6.01% v. HIIT). In the present study, significant HIITrelated increases in the mRNA expression of Sod1 (compared to SED) and Cat (compared to SED and LIT) may further explain the non-significant differences in post-intervention SBP in HIIT, via eAO-mediated increases in molecular-level protection [10, 35]. Research indicates that radical-mediated damage is a primary contributor to the development of hypertension [36] as superoxide can stimulate NFκB transcription factors that eventually lead to endothelial dysfunction and reduced vasodilation, resulting in increased peripheral resistance and elevated blood pressure [37]. Reduced plasma albumin is an independent predictor of renal dysfunction [38] and exercise training (16 weeks at 60% of maximal aerobic velocity) has proven useful at reducing albuminuria (urinary albumin) in SHRs [39]. Nevertheless, a recent review notes a scarcity of data describing the effects of exercise training on plasma albumin in models of CKD [40]. Furthermore, data describing the effects of HIIT on plasma albumin in models of CKD is particularly rare. Using the present group of animals, we previously reported [19] that
13
High intensity interval training in CKD plasma albumin was significantly higher in HIIT, compared to SED (p=0.001) and LIT (p=0.047). In the current study, increases in plasma albumin may be explained by HIITrelated increases in mRNA expression of Sod1 and Cat. The preservation of renal structure and function, and resultant increase in plasma albumin, may be due to molecular-level protection of renal tissue provided by intensity-dependant increases in the mRNA expression of renal-specific Sod1 and Cat. Up-regulated mRNA expression of renal Sod1 and Cat in the current study may also explain the non-significant reduction in plasma F2-isoprostanes in HIIT. Reviewed elsewhere [41], research has substantiated the inverse relationship between kidney function and the formation of F2-isoprostanes [42]. In the current study, F2-isoprostanes were non-significantly lower in HIIT, compared to SED (p=0.066, +31.49% v. HIIT) and LIT (p=0.051, +32.61% v. HIIT). The mechanisms explaining the ability of exercise to reduce F2-isoprostanes are not completely clear. There is evidence to suggest that chronic exercise can reduce levels of arachidonic acid, the pre-peroxidised source of F2-isoprostanes [43]. However, it should be noted that the evaluation of arachidonic acid, following exercise training, can be challenging, as tissue-specific levels and distribution of arachidonic acid may fluctuate based on the genotype of the experimental model [44]. Because this study examined the same types of tissues in a genotypically homogenous group of animals, we did not evaluate arachidonic acid. Rather, we suggest here that molecular-level renal structure may be better preserved by HIIT, as evidenced by non-significant reductions in lipid peroxidation, due to enhanced radical scavenging stemming from significantly up-regulated mRNA expression of renal Sod1 and Cat. Considering HIIT can theoretically reduce arachidonic acid peroxidation via increases in mRNA expression of Sod1 and Cat (per our results), it stands to reason that downstream F2isoprostane formation would also be reduced following HIIT.
14
High intensity interval training in CKD Kidney weight also provides information pertaining to renal structure in CKD. Declines in renal function are associated with compensatory alterations to renal tissue such as tubulointerstitial fibrosis [45]. Structural alterations like fibrosis are associated with glomerular hypertrophy [45] and reduced renal function [7]. Using the current animals, we previously reported that kidney weight and kidney weight-body weight ratio were significantly lower in HIIT, compared to SED and LIT [19]. Combining our previous results with findings from the current study, we propose that lower kidney weight and kidney weight-body weight ratio in HIIT may have resulted from the structural preservation of renal tissue via enhancements in molecular-level protection by way of up-regulated mRNA expression of renal Sod1 [35, 46] and Cat [35, 46].
Conclusions Our data indicated that, in an animal model of early-stage CKD, HIIT was more beneficial, compared to SED and LIT. Specifically, HIIT was responsible for a significant upregulation in the mRNA expression of Sod1, Cat, and Tnfrsf1b. The up-regulation of Sod1 and Cat mRNA may partially explain the non-significant decrease in plasma F2-isoprostanes. Combined with previously published data from our laboratory [19], the current investigation provides compelling evidence that HIIT has the ability to reduce oxidation- and inflammation-mediated damage in the kidney, making HIIT a promising therapy for patients with early-stage CKD. Clinical trials should be conducted in humans to further expound the use of HIIT as a means by which to slow disease progression in early-stage CKD populations.
15
High intensity interval training in CKD Table 1. Detailed Description of 8-Week Exercise Protocol Group
HIIT ≈85% VO2max
LIT 45-50% VO2max
SED
Variable
Measure
Wk 1
Wk 2
Wk 3
Wk 4
Wk 5
Wk 6
Wk 7
Wk 8
NA Max. Speed
NA
NA
NA
NA
NA
NA
NA
NA
NA
meters/min
15
15
15
15
15
15
15
15
Incline
degrees
1
1
1
1
1
1
1
1
Duration
minutes
13.3
20
26.6
33.3
33.3
33.3
33.3
33.3
Intensity
Constant treadmill speed and constant treadmill incline
Frequency
bouts/wk
Distance per bout
4
4
4
4
4
4
4
4
meters
199.5
300
399
499.5
499.5
499.5
499.5
499.5
Distance per wk
meters
798
1200
1596
1998
1998
1998
1998
1998
Max. Speed
meters/min
20
30
40
50
50
50
50
50
Incline
degrees
5
10
10
10
10
10
10
10
Duration
minutes
30
30
30
30
30
30
30
30
Intensity
2 min stationary period followed by 1 min sprint period x 10 reps
Frequency
bouts/wk
Distance per bout Distance per wk
4
4
4
4
4
4
4
4
meters
200
300
400
500
500
500
500
500
meters
800
1200
1600
2000
2000
2000
2000
2000
Abbreviations: SED – Sedentary, LIT – Light Intensity exercise, HIIT – High Intensity Interval Training, Wk – Week Exercise groups performed identical 5 minute warm-up (15 meters/min) prior to each exercise bout
16
High intensity interval training in CKD Table 2. Primer Sequences Used in Quantitative Reverse Transcription Polymerase Chain Reactions Target Primer Sequence (5'-3') Cat Forward primer TTTTCACCGACGAGATGGCA Cat Reverse primer AAGGTGTGTGAGCCATAGCC Gpx1 Forward primer GCTCACCCGCTCTTTACCTT Gpx1 Reverse primer GATGTCGATGGTGCGAAAGC Kim1 Forward Primer GGGTCTCCTTCACAGCACAT Kim1 Reverse Primer CCACACATGGTGACAGAGACT Sod1 Forward primer TTTTGCTCTCCCAGGTTCCG Sod1 Reverse primer CCCATGCTCGCCTTCAGTTA Tnfrsf1b Forward primer CGCATTTGTAGCATCCTGGC Tnfrsf1b Reverse primer AGGTGACGTTGACATGGGTC Gapdh Forward primer GTTACCAGGGCTGCCTTCTC Gapdh Reverse primer GATGGTGATGGGTTTCCCGT Abbreviations: Cat – catalase, Gpx1 – glutathione peroxidase, Kim1 – kidney injury molecule-1, SOD1 – superoxide dismutase, Tnfrsf1b – tumour necrosis factor receptor superfamily, member 1b, Gapdh – glyceraldehyde 3-phosphate dehydrogenase
17
High intensity interval training in CKD Table 3. Oxidative Stress and Clinical Measures Measure
Previously Reported
Group
Mean
p-value compared to HIIT 0.109 0.591
Mean Duplicate CV
SED 0.82 ± 0.13 LIT 0.88 ± 0.15 0.06 Yes HIIT 0.93 ± 0.12 SED 1.27 ± 0.27 0.285 LDL LIT 1.55 ± 0.34 0.001 0.03 Yes (mg/ml) HIIT 1.08 ± 0.32* SED 5.65 ± 1.66 0.183 TAG LIT 6.35 ± 2.65 0.029 0.04 Yes (mg/ml) HIIT 4.11 ± 2.04* SED 3.22 ± 0.47 0.263 CHOL LIT 3.71 ± 0.61 0.002 NA‡ Yes (mg/ml) HIIT 2.83 ± 0.73* SED 1.07 ± 0.51 0.126 CRE LIT 2.06 ± 1.79 0.996 0.04 Yes (nmol/ul) HIIT 2.11 ± 1.26 SED 26.23 ± 3.84 0.001 ALB LIT 29.88 ± 6.42 0.047 0.04 Yes (mg/ml) HIIT 35.24 ± 6.08† SED 1.57 ± 0.09 0.028 Kidney Weight LIT 1.59 ± 0.12 0.005 NA Yes (g) HIIT 1.46 ± 0.08† SED 0.005 ± 0.0003 0.045 LIT 0.005 ± 0.0003 0.048 NA KW-BW Ratio Yes HIIT 0.0047 ± 0.0002† SED 239.77 ± 12.85 0.114 Post-Int SBP LIT 241.63 ± 21.42 0.074 0.02 Yes (mmHg) HIIT 227.12 ± 14.23 SED 3000.97 ± 1203.76 0.066 ISO-P LIT 3050.83 ± 796.43 0.051 0.17 (pg/ml) HIIT 2055.83 ± 1061.89 Values presented as mean ± standard deviation Some values are re-reported with permission Significance set at p<0.05 *HIIT significantly different from LIT †HIIT significantly different from LIT and SED Abbreviations: SED – Sedentary, LIT – Light Intensity exercise, HIIT – High Intensity Interval Training, HDL – high density lipoprotein, LDL – low density lipoprotein, TAG – triglycerides, CHOL – total cholesterol, CRE – creatinine, ALB – albumin, KW-BW – kidney weight-body weight, Post-Int SBP – post-intervention systolic blood pressure, ISO-P – F2-isoprostanes, CV – coefficient of variation ‡CHOL is a calculated value and does not have a duplicate CV HDL (mg/ml)
18
High intensity interval training in CKD Figure Legend: Figure 1 – Endogenous Antioxidant Enzyme Genes – mRNA Expression Fold Change Figure 2 – Inflammation Genes – mRNA Expression Fold Change
Figure 1 – Endogenous Antioxidant Enzyme Genes – mRNA Expression Fold Change
Abbreviations: SED – Sedentary, LIT – Light Intensity exercise, HIIT – High Intensity Interval Training, Gapdh – glyceraldehyde 3-phosphate dehydrogenase
Figure 2 – Inflammation Genes – mRNA Expression Fold Change
Abbreviations: SED – Sedentary, LIT – Light Intensity exercise, HIIT – High Intensity Interval Training, Gapdh – glyceraldehyde 3-phosphate dehydrogenase
19
High intensity interval training in CKD References 1. 2. 3. 4. 5. 6.
7. 8. 9. 10.
11. 12.
13. 14.
15.
16.
17.
18.
19.
Cachofeiro, V., et al., Oxidative stress and inflammation, a link between chronic kidney disease and cardiovascular disease. Kidney Int Suppl, 2008(111): p. S4-9. Cottone, S., et al., Oxidative stress, inflammation and cardiovascular disease in chronic renal failure. J Nephrol, 2008. 21(2): p. 175-9. Avery, S.V., Molecular targets of oxidative stress. Biochem J, 2011. 434(2): p. 20110. Cooke, M.S., et al., Oxidative DNA damage: mechanisms, mutation, and disease. FASEB J, 2003. 17(10): p. 1195-214. Closa, D. and E. Folch-Puy, Oxygen free radicals and the systemic inflammatory response. IUBMB Life, 2004. 56(4): p. 185-91. Chiusolo, A., et al., Kidney injury molecule-1 expression in rat proximal tubule after treatment with segment-specific nephrotoxicants: a tool for early screening of potential kidney toxicity. Toxicol Pathol, 2010. 38(3): p. 338-45. van Timmeren, M.M., et al., Tubular kidney injury molecule-1 (KIM-1) in human renal disease. J Pathol, 2007. 212(2): p. 209-17. Han, W.K., et al., Kidney Injury Molecule-1 (KIM-1): a novel biomarker for human renal proximal tubule injury. Kidney Int, 2002. 62(1): p. 237-44. Guijarro, C. and J. Egido, Transcription factor-kappa B (NF-kappa B) and renal disease. Kidney Int, 2001. 59(2): p. 415-24. Azevedo-Martins, A.K., et al., Improvement of the mitochondrial antioxidant defense status prevents cytokine-induced nuclear factor-kappaB activation in insulinproducing cells. Diabetes, 2003. 52(1): p. 93-101. Powers, S.K., et al., Rigorous exercise training increases superoxide dismutase activity in ventricular myocardium. Am J Physiol, 1993. 265(6 Pt 2): p. H2094-8. Berzosa, C., et al., Acute exercise increases plasma total antioxidant status and antioxidant enzyme activities in untrained men. J Biomed Biotechnol, 2011. 2011: p. 540458. Silva, L.A., et al., Physical exercise increases mitochondrial function and reduces oxidative damage in skeletal muscle. Eur J Appl Physiol, 2009. 105(6): p. 861-7. Newsholme, P., et al., Exercise and possible molecular mechanisms of protection from vascular disease and diabetes: the central role of ROS and nitric oxide. Clin Sci, 2010. 118(5): p. 341-9. Ouerghi, N., et al., Effects of a high-intensity intermittent training program on aerobic capacity and lipid profile in trained subjects. Open Access J Sports Med, 2014. 5: p. 243-8. Racil, G., et al., Effects of high vs. moderate exercise intensity during interval training on lipids and adiponectin levels in obese young females. Eur J Appl Physiol, 2013. 113(10): p. 2531-40. Paoli, A., et al., Effects of high-intensity circuit training, low-intensity circuit training and endurance training on blood pressure and lipoproteins in middle-aged overweight men. Lipids Health Dis, 2013. 12: p. 131. Brooks, G.A. and T.P. White, Determination of metabolic and heart rate responses of rats to treadmill exercise. J Appl Physiol Respir Environ Exerc Physiol, 1978. 45(6): p. 1009-15. Tucker, P.S., A.T. Scanlan, and V.J. Dalbo, High Intensity Interval Training Favourably Affects Angiotensinogen mRNA Expression and Markers of Cardiorenal Health in a Rat Model of Early-Stage Chronic Kidney Disease. BioMed Research International.
20
High intensity interval training in CKD 20. 21.
22.
23.
24. 25. 26. 27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
Yu, Y., et al., A rat RNA-Seq transcriptomic BodyMap across 11 organs and 4 developmental stages. Nat Commun, 2014. 5: p. 3230. Marques, F.Z., et al., Gene expression profiling reveals renin mRNA overexpression in human hypertensive kidneys and a role for microRNAs. Hypertension, 2011. 58(6): p. 1093-8. Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001. 25(4): p. 402-8. Briskey, D.R., et al., Optimized method for quantification of total F(2)-isoprostanes using gas chromatography-tandem mass spectrometry. J Pharm Biomed Anal, 2014. 90: p. 161-6. de Souza, P.S., et al., Therapeutic action of physical exercise on markers of oxidative stress induced by chronic kidney disease. Life Sci, 2012. 91(3-4): p. 132-6. Abruzzo, P.M., et al., Moderate exercise training induces ROS-related adaptations to skeletal muscles. Int J Sports Med, 2013. 34(8): p. 676-87. Speeckaert, M.M., et al., Tumor necrosis factor receptors: biology and therapeutic potential in kidney diseases. Am J Nephrol, 2012. 36(3): p. 261-70. Espin, R., et al., TNF receptors regulate vascular homeostasis in zebrafish through a caspase-8, caspase-2 and P53 apoptotic program that bypasses caspase-3. Dis Model Mech, 2013. 6(2): p. 383-96. Higuchi, Y., et al., Tumor necrosis factor receptors 1 and 2 differentially regulate survival, cardiac dysfunction, and remodeling in transgenic mice with tumor necrosis factor-alpha-induced cardiomyopathy. Circulation, 2004. 109(15): p. 1892-7. Luo, Y., et al., Endothelial-specific transgenesis of TNFR2 promotes adaptive arteriogenesis and angiogenesis. Arterioscler Thromb Vasc Biol, 2010. 30(7): p. 1307-14. Al-Lamki, R.S., et al., TNFR1- and TNFR2-mediated signaling pathways in human kidney are cell type-specific and differentially contribute to renal injury. FASEB J, 2005. 19(12): p. 1637-45. Padilla, J., et al., Differential changes in vascular mRNA levels between rat iliac and renal arteries produced by cessation of voluntary running. Exp Physiol, 2013. 98(1): p. 337-47. Aggarwal, S., S. Gollapudi, and S. Gupta, Increased TNF-alpha-induced apoptosis in lymphocytes from aged humans: changes in TNF-alpha receptor expression and activation of caspases. J Immunol, 1999. 162(4): p. 2154-61. Agarwal, D., et al., Chronic exercise modulates RAS components and improves balance between pro- and anti-inflammatory cytokines in the brain of SHR. Basic Res Cardiol, 2011. 106(6): p. 1069-85. Zahorska-Markiewicz, B., et al., Serum concentrations of TNF-alpha and soluble TNF-alpha receptors in obesity. Int J Obes Relat Metab Disord, 2000. 24(11): p. 1392-5. Luo, Z.F., et al., Prevention of diabetic nephropathy in rats through enhanced renal antioxidative capacity by inhibition of the proteasome. Life Sci, 2011. 88(11-12): p. 512-20. Manning, R.D., Jr., N. Tian, and S. Meng, Oxidative stress and antioxidant treatment in hypertension and the associated renal damage. Am J Nephrol, 2005. 25(4): p. 3117. Montezano, A.C. and R.M. Touyz, Molecular mechanisms of hypertension--reactive oxygen species and antioxidants: a basic science update for the clinician. Can J Cardiol, 2012. 28(3): p. 288-95.
21
High intensity interval training in CKD 38.
Pinto-Sietsma, S.J., et al., Urinary albumin excretion is associated with renal functional abnormalities in a nondiabetic population. J Am Soc Nephrol, 2000. 11(10): p. 1882-8. Agarwal, D., et al., Chronic exercise preserves renal structure and hemodynamics in spontaneously hypertensive rats. Antioxid Redox Signal, 2012. 16(2): p. 139-52. Smart, N.A., et al., Exercise & Sports Science Australia (ESSA) position statement on exercise and chronic kidney disease. J Sci Med Sport, 2013. 16(5): p. 406-11. Tucker, P.S., et al., Clinical and research markers of oxidative stress in chronic kidney disease. Biomarkers, 2013. 18(2): p. 103-15. Dounousi, E., et al., Oxidative stress is progressively enhanced with advancing stages of CKD. Am J Kidney Dis, 2006. 48(5): p. 752-60. Nikolaidis, M.G., et al., Effect of chronic wheel running on the fatty acid composition of phospholipids and triacylglycerols in rat serum, skeletal muscle and heart. Acta Physiol Scand, 2004. 181(2): p. 199-208. Ayre, K.J., et al., Exercise training reduces skeletal muscle membrane arachidonate in the obese (fa/fa) Zucker rat. J Appl Physiol (1985), 1998. 85(5): p. 1898-902. Keller, G., et al., Nephron number in patients with primary hypertension. N Engl J Med, 2003. 348(2): p. 101-8. Alvarez, M.C., et al., Is cardiac hypertrophy in spontaneously hypertensive rats the cause or the consequence of oxidative stress? Hypertens Res, 2008. 31(7): p. 1465-76.
39. 40. 41. 42. 43.
44. 45. 46.
highlights
Oxidative stress and inflammation are linked to chronic kidney disease. We assessed high intensity interval training in a model of chronic kidney disease. We examined genes related to endogenous antioxidant enzymes and inflammation. High intensity interval training, alone, beneficially influenced these genes.
Graphical abstract
22
PII: DOI: Reference:
S0891-5849(15)00597-3 http://dx.doi.org/10.1016/j.freeradbiomed.2015.07.162 FRB12582
To appear in: Free Radical Biology and Medicine Received date: 20 May 2015 Revised date: 14 July 2015 Accepted date: 25 July 2015 Cite this article as: Patrick S. Tucker, David R. Briskey, Aaron T. Scanlan, Jeff S. Coombes and Vincent J. Dalbo, High intensity interval training favourably affects antioxidant and inflammation mRNA expression in early-stage chronic kidney disease, Free Radical Biology and Medicine, http://dx.doi.org/10.1016/j.freeradbiomed.2015.07.162 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
High intensity interval training in CKD High intensity interval training favourably affects antioxidant and inflammation mRNA expression in early-stage chronic kidney disease Patrick S. Tucker1,2, David R. Briskey3, Aaron T. Scanlan1,2, Jeff S. Coombes3, and Vincent J. Dalbo1,2 1
Clinical Biochemistry Laboratory, Bruce Highway, Building 81, Central Queensland University, Rockhampton, Australia 4702 2
Human Exercise and Training Laboratory, Bruce Highway, Building 81, Central Queensland University, Rockhampton, Australia 4702 3
Antioxidant Research Group, Room 535, Human Movement and Nutrition Sciences Building, University of Queensland, Brisbane, Australia 4072 Patrick S. Tucker – [email protected] David R. Briskey – [email protected] Aaron T. Scanlan – [email protected] Jeff S. Coombes – [email protected] Vincent J. Dalbo – [email protected] Corresponding Author: Vincent J. Dalbo, PhD Director of the Clinical Biochemistry Laboratory School of Medical and Applied Sciences Central Queensland University Bruce Highway, Building 81, Room 1.11 Rockhampton, Queensland, 4702 Phone: +61 7 4923 2289 Email: [email protected] Running Head: High intensity interval training in CKD Key Words: Renal disease, reactive oxygen species, nephrology, antioxidant status, exercise, high intensity interval training
1
High intensity interval training in CKD Abstract Increased levels of oxidative stress and inflammation have been linked to the progression of chronic kidney disease. To reduce oxidative stress and inflammation related to chronic kidney disease, chronic aerobic exercise is often recommended. Data suggests high intensity interval training may be more beneficial than traditional aerobic exercise. However, appraisals of differing modes of exercise, along with explanations of mechanisms responsible for observed effects, are lacking. This study assessed effects of eight weeks of high intensity interval training (85% VO2max), versus low intensity exercise (45-50% VO2max) and sedentary behaviour, in an animal model of early-stage chronic kidney disease. We examined kidney-specific mRNA expression of genes related to endogenous antioxidant enzyme activity (glutathione peroxidase 1; Gpx1, superoxide dismutase 1; Sod1, and catalase; Cat) and inflammation (kidney injury molecule 1; Kim1 and tumour necrosis factor receptor super family 1b; Tnfrsf1b), as well as plasma F2-isoprostanes, a marker of lipid peroxidation. Compared to sedentary behaviour, high intensity interval training resulted in increased mRNA expression of Sod1 (p=0.01) and Cat (p<0.001). Compared to low intensity exercise, high intensity interval training resulted in increased mRNA expression of Cat (p<0.001) and Tnfrsf1b (p=0.047). In this study, high intensity interval training was superior to sedentary behaviour and low intensity exercise as high intensity interval training beneficially influenced expression of genes related to endogenous antioxidant enzyme activity and inflammation.
Key Words: Renal disease, reactive oxygen species, nephrology, antioxidant status
2
High intensity interval training in CKD Introduction It is estimated that 10% Australians over the age of 18 years have clinical evidence of chronic kidney disease (CKD), a progressive and irreversible condition. Although it is possible to slow the progression of CKD, CKD-related risk factors and comorbidities become more difficult to manage as CKD progresses, resulting in a life expectancy that decreases in accordance with decreasing kidney function. As such, the development of therapies dedicated to decelerating the progression of CKD is warranted. Emerging evidence suggests that reducing oxidative stress (OS) and inflammation (INF) may be the most effective way to slow CKD progression [1, 2]. The overabundance of radicals, apparent during OS, react with molecular components of a nephron leading to oxidation of amino acids [3], lipid peroxidation of cell membranes [3], and cleavage and crosslinking of renal DNA [4]. These reactions promote nephron damage and encourage a cyclical series of events characterised by recurrent cellular- and molecular-level nephron damage. As radical-mediated nephron damage occurs, the resultant inflammatory response generates superoxide [5] via neutrophils’ membrane-associated nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system. Superoxide and other radicals continue to promote kidney injury or act as immuno-messaging molecules, resulting in a locally sustained immune response [1]. To assess kidney-specific damage and inflammation, kidney injury molecule-1 (KIM1) has emerged as a useful biomarker. Undetectable in normal kidneys [6], KIM1 expression is increased in damaged tubular cells [7, 8], is associated with tubular necrosis [8] and INF [7], is related to the development of tubulointerstitial fibrosis [7], and is negatively correlated with renal function [7]. Free radicals and fibrosis further aggravate damaged tissue, resulting in recruitment of inflammatory cytokines that promote injury in distal tissues.
3
High intensity interval training in CKD Inflammatory cytokines such as tumour necrosis factor-α (TNFα) activate signalling pathways that promote nuclear factor κB (NFκB) transcription factors by binding to TNFα receptors, such as tumour necrosis factor receptor superfamily, member 1b (TNFRSF1b) [9]. NFκB transcription factors prompt transcription of genes involved in systemic inflammatory responses, encouraging generation of radicals via phagocytic activity [9]. Regulating NFκBmediated INF is one beneficial effect of endogenous antioxidant enzymes (eAO). Specifically, superoxide dismutase (SOD), glutathione peroxidase (GPX), and catalase (CAT) quench radicals while simultaneously inhibiting nuclear translocation of NFκB [10], thereby reducing systemic INF and INF-related radical generation. Chronic aerobic exercise has emerged as a promising means of reducing OS and INF. Mechanisms responsible for beneficial effects of chronic aerobic exercise are traininginduced up-regulation of SOD [11] and CAT [12], reduced mitochondrial reactive oxygen species [13], and reduced expression of NADPH oxidase [14]. It has been proposed that chronic high-intensity interval training (HIIT) (≈85% VO2max) may elicit greater health benefits than traditional chronic aerobic exercise. Reasons for this supposition include improvements in SOD activity [11], aerobic capacity [15], blood lipids [16], and blood pressure [17] that are more remarkable when exercise is performed at higher intensities. Investigations examining effects of HIIT on biochemical and molecular markers of eAO, OS, and INF, especially in models of early-stage CKD, are unavailable. The purpose of the present study was to examine effects of HIIT (4 times per week for 8 weeks), light intensity exercise (LIT) (4 times per week for 8 weeks), and sedentary behaviour (SED) on the expression of genes associated with eAO activity (Sod1, Gpx1, and Cat) and INF (Kim1, Tnfrsf1b), as well as a reliable plasma marker of OS (F2-isoprostanes) in an animal model of early-stage CKD. It was hypothesised that HIIT would exert a more beneficial effect on the expression of genes associated with eAO and INF, compared to SED and LIT conditions. As
4
High intensity interval training in CKD such, we also hypothesised that plasma levels of F2-isoprostanes would be significantly reduced following HIIT, compared to SED and LIT conditions.
Materials and Methods Animals and General Overview Male spontaneously hypertensive rats (SHR) (n=39) (Animal Resource Centre, Canning Vale, WA, Australia) were housed in a temperature-controlled room (22–25°C) with a dark-light cycle of 12:12 hours and provided ad libitum access to standard laboratory chow and water. At the time of arrival, rats were 4-5 weeks old. Following a 2-week habituation period, allowing for acclimatisation to their new environment, all rats underwent a unilateral nephrectomy (6-7 weeks old). Following surgery, rats were allowed to recover for 2 weeks prior to the initiation of an 8-week exercise intervention. Blood pressures, body weights, and body lengths were recorded at pre-surgery, baseline (pre-exercise), 4 weeks (midintervention), and 8 weeks (post-intervention). Following the 8-week intervention, rats were euthanised 24 hours following their last bout of exercise and tissues were collected for subsequent analysis. All research procedures were granted prior approval by an institutional Animal Ethics Committee (Animal Ethics Committee of CQUniversity, project A13/11-305). Anesthetisation and Euthanasia Procedures Prior to nephrectomy, rats were anesthetised with Zoletil (25 mg/kg) and Xylazine (10 mg/kg). For pain relief, Meloxicam (2 mg/kg) was injected once daily for 2 days following nephrectomy. Prior to blood pressure readings, rats were anesthetised with Zoletil (25 mg/kg). Saline was injected subcutaneously following each anesthetisation to help avoid dehydration. Prior to being euthanised, rats were given a Lethabarb injection (1.5 mg/kg).
Exercise Protocol
5
High intensity interval training in CKD Rats were randomly assigned to one of three treatment groups: sedentary (SED, n=12), light intensity exercise (LIT, n=13), and high intensity interval exercise (HIIT, n=14). The number of animals assigned to each group was dependant on the form of exercise, as the possibility existed that aerobic exercise may have proven too strenuous, resulting in the need to withdraw an animal from the experiment. However, there were no adverse events in any group, suggesting that aerobic exercise was well-tolerated in this disease model. At 8-9 weeks of age, rats in the LIT and HIIT groups began treadmill running for 8 weeks. An identical 5-minute warm-up (15 m/min) was performed by both training groups before each exercise session. In this study, treadmill exercise protocols were based on work previously performed in this specific area [18]. Rats in the LIT group exercised at a treadmill speed of 15 m/min with an incline of 1° (45-50 VO2max) [18], up to 33 minutes per day, 4 days per week, for 8 weeks. Rats in the HIIT group exercised at a treadmill speed of up to 50 m/min with an incline of up to 10° (≈85 VO2max) [18], 30 minutes per day (2-minute stationary period followed by 1-minute sprint x 10 repetitions), 4 days per week, for 8 weeks. To permit adequate adaptation to treadmill running, thereby allowing each exercise session to be completed in its entirety, exercise training was progressive. By the beginning of the fourth week of training, all rats were performing exercise sessions at maximum intensity/duration – the exercise effort remained constant for the remaining 5 weeks of training. In an effort to standardise variables related to exercise training, while simultaneously allowing for the comparison of different intensities, sessions between LIT and HIIT groups were matched based on distance travelled per bout; despite the difference in exercise intensity between groups, LIT and HIIT rats travelled the same distance (±1 meter) during each exercise session, with distances progressing in unison from ≈200 meters per session in week 1 to ≈500 meters per session in week 8. (Table 1 – republished with permission [19])
6
High intensity interval training in CKD Table 1 around here
Tissue Homogenisation and mRNA Isolation Tissue used for analyses were chosen based on tissue-specific transcriptomic work performed in SHRs [20]. Renal tissue specifically consisted of renal cortex as mRNA is differentially expressed dependant on the type of renal tissue [21]. Approximately 100 mg (± 10 mg) of renal tissue was homogenised in 1 ml of TRI-reagent, using the TRI-reagent method (Sigma Aldrich, St. Louis, MO, USA). Samples were then centrifuged at 12,000 x g for 10 minutes at 4°C. The resulting supernatant was transferred to a new microtube and incubated for 5 minutes, at room temperature, to allow for disassociation of the nucleoprotein complex. Following incubation, 0.2 ml of chloroform was added before this solution was mixed and then incubated for 3 minutes. Samples were then centrifuged at 12,000 x g for 15 minutes at 4°C. The resulting supernatant was transferred to a new microtube. Following this separation, 500 μl of 2-propanol was added to each microtube. Microtubes were incubated at room temperature for 10 minutes and then centrifuged at 12,000 x g for 10 minutes at 4°C. The resulting supernatant was removed, leaving behind a mRNA pellet. The mRNA pellet was exposed to 2 ethanol washes (1 ml, 75%). Following each wash, microtubes were vortexed, centrifuged at 7,500 x g for 5 minutes at 4°C. The mRNA pellets were then allowed to air dry under a fume hood before being dissolved in 30 μl of RNase-free water. A 260/280 ratio was calculated to assess mRNA purity, with all ratios falling within commonly accepted parameters. The diluted mRNA samples were stored at −80°C until later analyses.
Total mRNA Determination and Reverse Transcription Total mRNA concentrations from each sample were determined using a spectrophotometer (NanoDrop 2000c, Thermo Scientific, Wilmington, DE, USA). Next, mRNA concentrations were adjusted to 400 ng/μl by diluting the crude total mRNA extracts
7
High intensity interval training in CKD with RNase-free water. The standardised solutions of total cellular mRNA were reverse transcribed to synthesise complimentary DNA (cDNA) using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Briefly, 2x RT master mix was prepared per kit instructions. Next, 10 μl of RT mix was added (and mixed via pipette trituration) to 10 μl of the standardised mRNA solution. These samples were placed on a thermal cycler (T100 Thermal Cycler, Bio-Rad, Gladesville, NSW, Australia) set to run at: 25°C for 10 minutes, 37°C for 120 minutes, and 85°C for 5 minutes. Following reverse transcription, the resulting cDNA template concentrations were diluted to 5 ng/μl by adding RNase free water. The standardised cDNA solutions were frozen at −80°C until quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed.
Quantitative Reverse Transcription Polymerase Chain Reaction Analysis Forward and reverse oligonucleotide primer pairs were developed using National Centre for Biotechnology Information’s (NCBI, Bethesda, MD, USA) Primer Designer Tool before being commercially synthesised (GeneWorks, Hindmarsh, SA, Australia) (Table 2). Gapdh was used as an internal reference gene for detecting relative change in the quantity of target mRNA due to its consideration as a constitutively expressed housekeeping gene following exercise training. Following the examination of primer efficiencies, qRT- PCR reactions were mixed. Reactions contained the following mixture: 2.5 μl of prepared cDNA template, 5 μl of SYBR Select Master Mix (Life Technologies, Mulgrave, Victoria, Australia), 0.5 μl of sense and anti-sense primers, and 1.5 μl RNase free water. Following the mixture of each reaction, qRT-PCR was performed with a thermal cycler (Rotor-Gene Q, Qiagen, Venlo, Netherlands). The amplification sequence involved an initial 10-minute cycle at 95°C, followed by 40 cycles, each composed of a denaturation step (95°C for 15 seconds) and a primer annealing/extension step (60°C for 45 seconds). Melting curves were performed
8
High intensity interval training in CKD to ensure that sufficient PCR product was being generated by each primer, in the absence of primer dimers. All assays were performed in duplicate (coefficient of variation = 0.01). mRNA expression data were calculated using the Livak method [22] and data are presented as the fold change of the gene of interest, relative to that of control animals.
Table 2 around here
Plasma F2-Isoprostanes Plasma F2-isoprostanes were measured using gas chromatography-tandem mass spectrometry per methods which are outlined in detail elsewhere [23]. To analyse F2isoprostane content, a Varian 320 MS/MS, with a Varian 450 gas chromatograph equipped with a CP8400 auto sampler was used. F2-isoprostane data was analysed using the Varian MS Workstation-System control software (Version 6.9.2, Varian, Australia).
Clinical Measurements Detailed methods describing the collection and analysis of clinical measurements, in the animals discussed in the current investigation, have been previously reported [19]. Briefly, clinical measures included systolic blood pressure, remnant kidney weight, remnant kidney weight to body weight ratio, and plasma levels of high density lipoprotein, low density lipoprotein, triglycerides, total cholesterol, albumin, and creatinine. These measurements receive consideration in the Discussion section of this manuscript as they help elucidate mechanisms that may relate to findings in the current study.
Statistics mRNA data are presented as mean ± standard error of the mean (SEM). Plasma F2isoprostane data are presented as mean ± standard deviation (SD). Data for mRNA expression
9
High intensity interval training in CKD (Sod1, Gpx1, Cat, Kim1, and Tnfrsf1b) and plasma F2-isoprostanes were analysed using separate between-group one-way ANOVAs with Tukey post-hoc comparisons. Analyses were performed using IBM SPSS Statistics (v20.0, IBM Corporation; Armonk, NY, USA). Statistical significance was set at p<0.05.
Results Clinical Measurements Clinical measurements relating to the animals in the current investigation have been previously reported [19]. A summation of these results can be found in Table 3.
Quantitative Reverse Transcription Polymerase Chain Reaction Analysis Results pertaining to renal expression of eAO-related mRNA can be seen in Figure 1. In HIIT, mRNA expression of Sod1 was significantly up-regulated, compared to SED (p=0.001) and mRNA expression of Cat was significantly up-regulated, compared to SED (p<0.001) and LIT (p<0.001). Results pertaining to renal expression of INF-related mRNA can be seen in Figure 2. In HIIT, mRNA expression of Tnfrsf1b was significantly upregulated, compared to LIT (p=0.047).
Figure 1 around here Figure 2 around here
Plasma F2-Isoprostanes Results pertaining to plasma F2-isoprostanes can be seen in Table 3. A one-way ANOVA revealed significant between-group differences in plasma F2-isoprostanes (F(2,35) = 3.882, p=0.03). Following Tukey post-hoc comparisons, between-group differences in
10
High intensity interval training in CKD plasma F2-isoprostanes failed to reach statistical significance (SED v. LIT, p=0.992; SED v. HIIT, p=0.066; LIT v. HIIT, p=0.051).
Table 3 around here
Discussion This is the first investigation to compare the efficacy of HIIT with LIT and sedentary behaviour, in regard to the modulation of kidney-specific mRNA expression of genes related to eAO and INF. Compared to SED, HIIT resulted in increased mRNA expression of Sod1 (p=0.01) and Cat (p<0.001). Compared to LIT, HIIT resulted in increased mRNA expression of Cat (p<0.001) and Tnfrsf1b (p=0.047). Improvements in plasma levels of F2-isoprostanes were apparent in HIIT, compared to SED and LIT, but results failed to reach statistical significance (v. SED, p=0.066; v. LIT; p=0.051). To date, few studies have compared the effects of different types of chronic aerobic exercise on eAO activity. However, there is sufficient evidence to suggest that chronic aerobic exercise influences the expression and activity of eAO-related markers and that these effects are further influenced by exercise intensity [11]. Significant HIIT-related increases in the mRNA expression of Sod1 (compared to SED, p=0.001) and Cat (compared to SED and LIT, p<0.001) in the current study are supported by previous work. In rats, moderate- (65% VO2max) and high-intensity (75% VO2max) chronic aerobic exercise resulted in significantly increased SOD activity, compared to low-intensity (55% VO2max) and sedentary conditions [11] in the right ventricle of the heart. In addition, treadmill running performed for 8 weeks (50 min/day, 5 days/wk, 17 m/min) [24] and 14 weeks (60 min/day, 3 days/wk, 30 m/min) [25] resulted in significant increases in kidney-specific SOD activity [24] and CAT activity in the tibialis anterior [25], compared to sedentary rats. Although research suggests increases in
11
High intensity interval training in CKD exercise intensity results in increased levels of OS and INF, it is the repeated exposure to increased oxidative and inflammatory insult that seems to be responsible for positive exercise-induced adaptations, namely increases in eAO activity [11, 25]. At present, much of the work focusing on the effects of exercise on eAO utilises blood markers and skeletal muscle tissue. As such, tissue-specific work (e.g. kidney) as it relates to specific diseases (e.g. CKD) is timely. Disease-relevant, tissue-specific work is also important when assessing INF. Reviewed elsewhere [26], research suggests that TNFα receptors should be considered important targets in CKD [26, 27], a notion that is supported by the current data. Transgenic animal studies have shown that reduced Tnfrsf1b mRNA expression is associated with endothelial apoptosis [27] and increased risk of heart failure [28], while increased Tnfrsf1b mRNA expression is associated with ischemia-mediated adaptive angiogenesis [29]. Further, increased TNFRSF1B protein expression is associated with tubular cell regeneration in kidney tissue [30]. Fortunately, exercise may beneficially mediate Tnfrsf1b mRNA expression. In the current study, HIIT resulted in a significant up-regulation of Tnfrsf1b mRNA expression in kidney tissue, compared to LIT (p=0.047). Similarly, Padilla et al. reported seven days of voluntary exercise resulted in non-significant increases in Tnfrsf1b mRNA expression in the renal arteries of voluntarily active rats (30 days of voluntary exercise), compared to involuntarily inactive rats (23 days of voluntary exercise, followed by 7 days of mandatory sedentary behaviour) [31]. This is noteworthy as decreased TNFRSF1B protein expression has been linked to increases in TNFα-induced apoptosis in cells that are crucial to immuno-regulation and inflammatory responses such as lymphocytes [32]. Considering our findings, in conjunction with findings that describe (a) the ability of chronic aerobic exercise to significantly reduce TNFα mRNA expression [33], (b) the inverse relationship between
12
High intensity interval training in CKD serum levels of TNFα and TNF receptors [34], and (c) the inverse relationship between TNFα-induced apoptosis and TNFRSF1B protein expression [32], we propose that HIIT favourably influences TNFα activity, as evidenced by an increase in the expression of Tnfrsf1b mRNA. Furthermore, based on our data, we propose the ability of exercise to influence TNFα activity is intensity-dependant as HIIT resulted in a significant up-regulation of Tnfrsf1b mRNA expression, compared to LIT (p=0.047). Using the present group of animals, we previously reported [19] that HIIT was more effective at improving plasma levels of LDL (p=0.001), triglycerides (p=0.029), and total cholesterol (p=0.02), compared to LIT. This led us to speculate that HIIT-related improvements to lipid markers may have partially explained the non-significant differences in post-intervention SBP in HIIT (227.12 mmHg), compared to SED (239.77 mmHg, +5.28% v. HIIT) and LIT (241.63 mmHg, +6.01% v. HIIT). In the present study, significant HIITrelated increases in the mRNA expression of Sod1 (compared to SED) and Cat (compared to SED and LIT) may further explain the non-significant differences in post-intervention SBP in HIIT, via eAO-mediated increases in molecular-level protection [10, 35]. Research indicates that radical-mediated damage is a primary contributor to the development of hypertension [36] as superoxide can stimulate NFκB transcription factors that eventually lead to endothelial dysfunction and reduced vasodilation, resulting in increased peripheral resistance and elevated blood pressure [37]. Reduced plasma albumin is an independent predictor of renal dysfunction [38] and exercise training (16 weeks at 60% of maximal aerobic velocity) has proven useful at reducing albuminuria (urinary albumin) in SHRs [39]. Nevertheless, a recent review notes a scarcity of data describing the effects of exercise training on plasma albumin in models of CKD [40]. Furthermore, data describing the effects of HIIT on plasma albumin in models of CKD is particularly rare. Using the present group of animals, we previously reported [19] that
13
High intensity interval training in CKD plasma albumin was significantly higher in HIIT, compared to SED (p=0.001) and LIT (p=0.047). In the current study, increases in plasma albumin may be explained by HIITrelated increases in mRNA expression of Sod1 and Cat. The preservation of renal structure and function, and resultant increase in plasma albumin, may be due to molecular-level protection of renal tissue provided by intensity-dependant increases in the mRNA expression of renal-specific Sod1 and Cat. Up-regulated mRNA expression of renal Sod1 and Cat in the current study may also explain the non-significant reduction in plasma F2-isoprostanes in HIIT. Reviewed elsewhere [41], research has substantiated the inverse relationship between kidney function and the formation of F2-isoprostanes [42]. In the current study, F2-isoprostanes were non-significantly lower in HIIT, compared to SED (p=0.066, +31.49% v. HIIT) and LIT (p=0.051, +32.61% v. HIIT). The mechanisms explaining the ability of exercise to reduce F2-isoprostanes are not completely clear. There is evidence to suggest that chronic exercise can reduce levels of arachidonic acid, the pre-peroxidised source of F2-isoprostanes [43]. However, it should be noted that the evaluation of arachidonic acid, following exercise training, can be challenging, as tissue-specific levels and distribution of arachidonic acid may fluctuate based on the genotype of the experimental model [44]. Because this study examined the same types of tissues in a genotypically homogenous group of animals, we did not evaluate arachidonic acid. Rather, we suggest here that molecular-level renal structure may be better preserved by HIIT, as evidenced by non-significant reductions in lipid peroxidation, due to enhanced radical scavenging stemming from significantly up-regulated mRNA expression of renal Sod1 and Cat. Considering HIIT can theoretically reduce arachidonic acid peroxidation via increases in mRNA expression of Sod1 and Cat (per our results), it stands to reason that downstream F2isoprostane formation would also be reduced following HIIT.
14
High intensity interval training in CKD Kidney weight also provides information pertaining to renal structure in CKD. Declines in renal function are associated with compensatory alterations to renal tissue such as tubulointerstitial fibrosis [45]. Structural alterations like fibrosis are associated with glomerular hypertrophy [45] and reduced renal function [7]. Using the current animals, we previously reported that kidney weight and kidney weight-body weight ratio were significantly lower in HIIT, compared to SED and LIT [19]. Combining our previous results with findings from the current study, we propose that lower kidney weight and kidney weight-body weight ratio in HIIT may have resulted from the structural preservation of renal tissue via enhancements in molecular-level protection by way of up-regulated mRNA expression of renal Sod1 [35, 46] and Cat [35, 46].
Conclusions Our data indicated that, in an animal model of early-stage CKD, HIIT was more beneficial, compared to SED and LIT. Specifically, HIIT was responsible for a significant upregulation in the mRNA expression of Sod1, Cat, and Tnfrsf1b. The up-regulation of Sod1 and Cat mRNA may partially explain the non-significant decrease in plasma F2-isoprostanes. Combined with previously published data from our laboratory [19], the current investigation provides compelling evidence that HIIT has the ability to reduce oxidation- and inflammation-mediated damage in the kidney, making HIIT a promising therapy for patients with early-stage CKD. Clinical trials should be conducted in humans to further expound the use of HIIT as a means by which to slow disease progression in early-stage CKD populations.
15
High intensity interval training in CKD Table 1. Detailed Description of 8-Week Exercise Protocol Group
HIIT ≈85% VO2max
LIT 45-50% VO2max
SED
Variable
Measure
Wk 1
Wk 2
Wk 3
Wk 4
Wk 5
Wk 6
Wk 7
Wk 8
NA Max. Speed
NA
NA
NA
NA
NA
NA
NA
NA
NA
meters/min
15
15
15
15
15
15
15
15
Incline
degrees
1
1
1
1
1
1
1
1
Duration
minutes
13.3
20
26.6
33.3
33.3
33.3
33.3
33.3
Intensity
Constant treadmill speed and constant treadmill incline
Frequency
bouts/wk
Distance per bout
4
4
4
4
4
4
4
4
meters
199.5
300
399
499.5
499.5
499.5
499.5
499.5
Distance per wk
meters
798
1200
1596
1998
1998
1998
1998
1998
Max. Speed
meters/min
20
30
40
50
50
50
50
50
Incline
degrees
5
10
10
10
10
10
10
10
Duration
minutes
30
30
30
30
30
30
30
30
Intensity
2 min stationary period followed by 1 min sprint period x 10 reps
Frequency
bouts/wk
Distance per bout Distance per wk
4
4
4
4
4
4
4
4
meters
200
300
400
500
500
500
500
500
meters
800
1200
1600
2000
2000
2000
2000
2000
Abbreviations: SED – Sedentary, LIT – Light Intensity exercise, HIIT – High Intensity Interval Training, Wk – Week Exercise groups performed identical 5 minute warm-up (15 meters/min) prior to each exercise bout
16
High intensity interval training in CKD Table 2. Primer Sequences Used in Quantitative Reverse Transcription Polymerase Chain Reactions Target Primer Sequence (5'-3') Cat Forward primer TTTTCACCGACGAGATGGCA Cat Reverse primer AAGGTGTGTGAGCCATAGCC Gpx1 Forward primer GCTCACCCGCTCTTTACCTT Gpx1 Reverse primer GATGTCGATGGTGCGAAAGC Kim1 Forward Primer GGGTCTCCTTCACAGCACAT Kim1 Reverse Primer CCACACATGGTGACAGAGACT Sod1 Forward primer TTTTGCTCTCCCAGGTTCCG Sod1 Reverse primer CCCATGCTCGCCTTCAGTTA Tnfrsf1b Forward primer CGCATTTGTAGCATCCTGGC Tnfrsf1b Reverse primer AGGTGACGTTGACATGGGTC Gapdh Forward primer GTTACCAGGGCTGCCTTCTC Gapdh Reverse primer GATGGTGATGGGTTTCCCGT Abbreviations: Cat – catalase, Gpx1 – glutathione peroxidase, Kim1 – kidney injury molecule-1, SOD1 – superoxide dismutase, Tnfrsf1b – tumour necrosis factor receptor superfamily, member 1b, Gapdh – glyceraldehyde 3-phosphate dehydrogenase
17
High intensity interval training in CKD Table 3. Oxidative Stress and Clinical Measures Measure
Previously Reported
Group
Mean
p-value compared to HIIT 0.109 0.591
Mean Duplicate CV
SED 0.82 ± 0.13 LIT 0.88 ± 0.15 0.06 Yes HIIT 0.93 ± 0.12 SED 1.27 ± 0.27 0.285 LDL LIT 1.55 ± 0.34 0.001 0.03 Yes (mg/ml) HIIT 1.08 ± 0.32* SED 5.65 ± 1.66 0.183 TAG LIT 6.35 ± 2.65 0.029 0.04 Yes (mg/ml) HIIT 4.11 ± 2.04* SED 3.22 ± 0.47 0.263 CHOL LIT 3.71 ± 0.61 0.002 NA‡ Yes (mg/ml) HIIT 2.83 ± 0.73* SED 1.07 ± 0.51 0.126 CRE LIT 2.06 ± 1.79 0.996 0.04 Yes (nmol/ul) HIIT 2.11 ± 1.26 SED 26.23 ± 3.84 0.001 ALB LIT 29.88 ± 6.42 0.047 0.04 Yes (mg/ml) HIIT 35.24 ± 6.08† SED 1.57 ± 0.09 0.028 Kidney Weight LIT 1.59 ± 0.12 0.005 NA Yes (g) HIIT 1.46 ± 0.08† SED 0.005 ± 0.0003 0.045 LIT 0.005 ± 0.0003 0.048 NA KW-BW Ratio Yes HIIT 0.0047 ± 0.0002† SED 239.77 ± 12.85 0.114 Post-Int SBP LIT 241.63 ± 21.42 0.074 0.02 Yes (mmHg) HIIT 227.12 ± 14.23 SED 3000.97 ± 1203.76 0.066 ISO-P LIT 3050.83 ± 796.43 0.051 0.17 (pg/ml) HIIT 2055.83 ± 1061.89 Values presented as mean ± standard deviation Some values are re-reported with permission Significance set at p<0.05 *HIIT significantly different from LIT †HIIT significantly different from LIT and SED Abbreviations: SED – Sedentary, LIT – Light Intensity exercise, HIIT – High Intensity Interval Training, HDL – high density lipoprotein, LDL – low density lipoprotein, TAG – triglycerides, CHOL – total cholesterol, CRE – creatinine, ALB – albumin, KW-BW – kidney weight-body weight, Post-Int SBP – post-intervention systolic blood pressure, ISO-P – F2-isoprostanes, CV – coefficient of variation ‡CHOL is a calculated value and does not have a duplicate CV HDL (mg/ml)
18
High intensity interval training in CKD Figure Legend: Figure 1 – Endogenous Antioxidant Enzyme Genes – mRNA Expression Fold Change Figure 2 – Inflammation Genes – mRNA Expression Fold Change
Figure 1 – Endogenous Antioxidant Enzyme Genes – mRNA Expression Fold Change
Abbreviations: SED – Sedentary, LIT – Light Intensity exercise, HIIT – High Intensity Interval Training, Gapdh – glyceraldehyde 3-phosphate dehydrogenase
Figure 2 – Inflammation Genes – mRNA Expression Fold Change
Abbreviations: SED – Sedentary, LIT – Light Intensity exercise, HIIT – High Intensity Interval Training, Gapdh – glyceraldehyde 3-phosphate dehydrogenase
19
High intensity interval training in CKD References 1. 2. 3. 4. 5. 6.
7. 8. 9. 10.
11. 12.
13. 14.
15.
16.
17.
18.
19.
Cachofeiro, V., et al., Oxidative stress and inflammation, a link between chronic kidney disease and cardiovascular disease. Kidney Int Suppl, 2008(111): p. S4-9. Cottone, S., et al., Oxidative stress, inflammation and cardiovascular disease in chronic renal failure. J Nephrol, 2008. 21(2): p. 175-9. Avery, S.V., Molecular targets of oxidative stress. Biochem J, 2011. 434(2): p. 20110. Cooke, M.S., et al., Oxidative DNA damage: mechanisms, mutation, and disease. FASEB J, 2003. 17(10): p. 1195-214. Closa, D. and E. Folch-Puy, Oxygen free radicals and the systemic inflammatory response. IUBMB Life, 2004. 56(4): p. 185-91. Chiusolo, A., et al., Kidney injury molecule-1 expression in rat proximal tubule after treatment with segment-specific nephrotoxicants: a tool for early screening of potential kidney toxicity. Toxicol Pathol, 2010. 38(3): p. 338-45. van Timmeren, M.M., et al., Tubular kidney injury molecule-1 (KIM-1) in human renal disease. J Pathol, 2007. 212(2): p. 209-17. Han, W.K., et al., Kidney Injury Molecule-1 (KIM-1): a novel biomarker for human renal proximal tubule injury. Kidney Int, 2002. 62(1): p. 237-44. Guijarro, C. and J. Egido, Transcription factor-kappa B (NF-kappa B) and renal disease. Kidney Int, 2001. 59(2): p. 415-24. Azevedo-Martins, A.K., et al., Improvement of the mitochondrial antioxidant defense status prevents cytokine-induced nuclear factor-kappaB activation in insulinproducing cells. Diabetes, 2003. 52(1): p. 93-101. Powers, S.K., et al., Rigorous exercise training increases superoxide dismutase activity in ventricular myocardium. Am J Physiol, 1993. 265(6 Pt 2): p. H2094-8. Berzosa, C., et al., Acute exercise increases plasma total antioxidant status and antioxidant enzyme activities in untrained men. J Biomed Biotechnol, 2011. 2011: p. 540458. Silva, L.A., et al., Physical exercise increases mitochondrial function and reduces oxidative damage in skeletal muscle. Eur J Appl Physiol, 2009. 105(6): p. 861-7. Newsholme, P., et al., Exercise and possible molecular mechanisms of protection from vascular disease and diabetes: the central role of ROS and nitric oxide. Clin Sci, 2010. 118(5): p. 341-9. Ouerghi, N., et al., Effects of a high-intensity intermittent training program on aerobic capacity and lipid profile in trained subjects. Open Access J Sports Med, 2014. 5: p. 243-8. Racil, G., et al., Effects of high vs. moderate exercise intensity during interval training on lipids and adiponectin levels in obese young females. Eur J Appl Physiol, 2013. 113(10): p. 2531-40. Paoli, A., et al., Effects of high-intensity circuit training, low-intensity circuit training and endurance training on blood pressure and lipoproteins in middle-aged overweight men. Lipids Health Dis, 2013. 12: p. 131. Brooks, G.A. and T.P. White, Determination of metabolic and heart rate responses of rats to treadmill exercise. J Appl Physiol Respir Environ Exerc Physiol, 1978. 45(6): p. 1009-15. Tucker, P.S., A.T. Scanlan, and V.J. Dalbo, High Intensity Interval Training Favourably Affects Angiotensinogen mRNA Expression and Markers of Cardiorenal Health in a Rat Model of Early-Stage Chronic Kidney Disease. BioMed Research International.
20
High intensity interval training in CKD 20. 21.
22.
23.
24. 25. 26. 27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
Yu, Y., et al., A rat RNA-Seq transcriptomic BodyMap across 11 organs and 4 developmental stages. Nat Commun, 2014. 5: p. 3230. Marques, F.Z., et al., Gene expression profiling reveals renin mRNA overexpression in human hypertensive kidneys and a role for microRNAs. Hypertension, 2011. 58(6): p. 1093-8. Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001. 25(4): p. 402-8. Briskey, D.R., et al., Optimized method for quantification of total F(2)-isoprostanes using gas chromatography-tandem mass spectrometry. J Pharm Biomed Anal, 2014. 90: p. 161-6. de Souza, P.S., et al., Therapeutic action of physical exercise on markers of oxidative stress induced by chronic kidney disease. Life Sci, 2012. 91(3-4): p. 132-6. Abruzzo, P.M., et al., Moderate exercise training induces ROS-related adaptations to skeletal muscles. Int J Sports Med, 2013. 34(8): p. 676-87. Speeckaert, M.M., et al., Tumor necrosis factor receptors: biology and therapeutic potential in kidney diseases. Am J Nephrol, 2012. 36(3): p. 261-70. Espin, R., et al., TNF receptors regulate vascular homeostasis in zebrafish through a caspase-8, caspase-2 and P53 apoptotic program that bypasses caspase-3. Dis Model Mech, 2013. 6(2): p. 383-96. Higuchi, Y., et al., Tumor necrosis factor receptors 1 and 2 differentially regulate survival, cardiac dysfunction, and remodeling in transgenic mice with tumor necrosis factor-alpha-induced cardiomyopathy. Circulation, 2004. 109(15): p. 1892-7. Luo, Y., et al., Endothelial-specific transgenesis of TNFR2 promotes adaptive arteriogenesis and angiogenesis. Arterioscler Thromb Vasc Biol, 2010. 30(7): p. 1307-14. Al-Lamki, R.S., et al., TNFR1- and TNFR2-mediated signaling pathways in human kidney are cell type-specific and differentially contribute to renal injury. FASEB J, 2005. 19(12): p. 1637-45. Padilla, J., et al., Differential changes in vascular mRNA levels between rat iliac and renal arteries produced by cessation of voluntary running. Exp Physiol, 2013. 98(1): p. 337-47. Aggarwal, S., S. Gollapudi, and S. Gupta, Increased TNF-alpha-induced apoptosis in lymphocytes from aged humans: changes in TNF-alpha receptor expression and activation of caspases. J Immunol, 1999. 162(4): p. 2154-61. Agarwal, D., et al., Chronic exercise modulates RAS components and improves balance between pro- and anti-inflammatory cytokines in the brain of SHR. Basic Res Cardiol, 2011. 106(6): p. 1069-85. Zahorska-Markiewicz, B., et al., Serum concentrations of TNF-alpha and soluble TNF-alpha receptors in obesity. Int J Obes Relat Metab Disord, 2000. 24(11): p. 1392-5. Luo, Z.F., et al., Prevention of diabetic nephropathy in rats through enhanced renal antioxidative capacity by inhibition of the proteasome. Life Sci, 2011. 88(11-12): p. 512-20. Manning, R.D., Jr., N. Tian, and S. Meng, Oxidative stress and antioxidant treatment in hypertension and the associated renal damage. Am J Nephrol, 2005. 25(4): p. 3117. Montezano, A.C. and R.M. Touyz, Molecular mechanisms of hypertension--reactive oxygen species and antioxidants: a basic science update for the clinician. Can J Cardiol, 2012. 28(3): p. 288-95.
21
High intensity interval training in CKD 38.
Pinto-Sietsma, S.J., et al., Urinary albumin excretion is associated with renal functional abnormalities in a nondiabetic population. J Am Soc Nephrol, 2000. 11(10): p. 1882-8. Agarwal, D., et al., Chronic exercise preserves renal structure and hemodynamics in spontaneously hypertensive rats. Antioxid Redox Signal, 2012. 16(2): p. 139-52. Smart, N.A., et al., Exercise & Sports Science Australia (ESSA) position statement on exercise and chronic kidney disease. J Sci Med Sport, 2013. 16(5): p. 406-11. Tucker, P.S., et al., Clinical and research markers of oxidative stress in chronic kidney disease. Biomarkers, 2013. 18(2): p. 103-15. Dounousi, E., et al., Oxidative stress is progressively enhanced with advancing stages of CKD. Am J Kidney Dis, 2006. 48(5): p. 752-60. Nikolaidis, M.G., et al., Effect of chronic wheel running on the fatty acid composition of phospholipids and triacylglycerols in rat serum, skeletal muscle and heart. Acta Physiol Scand, 2004. 181(2): p. 199-208. Ayre, K.J., et al., Exercise training reduces skeletal muscle membrane arachidonate in the obese (fa/fa) Zucker rat. J Appl Physiol (1985), 1998. 85(5): p. 1898-902. Keller, G., et al., Nephron number in patients with primary hypertension. N Engl J Med, 2003. 348(2): p. 101-8. Alvarez, M.C., et al., Is cardiac hypertrophy in spontaneously hypertensive rats the cause or the consequence of oxidative stress? Hypertens Res, 2008. 31(7): p. 1465-76.
39. 40. 41. 42. 43.
44. 45. 46.
highlights
Oxidative stress and inflammation are linked to chronic kidney disease. We assessed high intensity interval training in a model of chronic kidney disease. We examined genes related to endogenous antioxidant enzymes and inflammation. High intensity interval training, alone, beneficially influenced these genes.
Graphical abstract
22