High-level expression of a hyperthermostable Thermotoga maritima xylanase in Pichia pastoris by codon optimization

Journal of Molecular Catalysis B: Enzymatic 78 (2012) 72–77

Contents lists available at SciVerse ScienceDirect

Journal of Molecular Catalysis B: Enzymatic journal homepage: www.elsevier.com/locate/molcatb

High-level expression of a hyperthermostable Thermotoga maritima xylanase in Pichia pastoris by codon optimization Huiyong Jia a , Guangsen Fan a , Qiaojuan Yan b , Yuchun Liu a , Ye Yan a , Zhengqiang Jiang a,∗ a b

Department of Biotechnology, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing 100083, China Bioresource Utilization Laboratory, College of Engineering, China Agricultural University, Beijing 100083, China

a r t i c l e

i n f o

Article history: Received 4 November 2011 Received in revised form 20 February 2012 Accepted 20 February 2012 Available online 28 February 2012 Keywords: Codon optimization Gene expression Hyperthermostable xylanase Pichia pastoris Thermotoga maritima

a b s t r a c t The second xylanase gene (xynB) from the hyperthermophilic Thermotoga maritima was optimized according to the codon usage of Pichia pastoris and expressed in P. pastoris. The optimized gene (xynBop) shared 77.8% of nucleotide sequence identity with that of native gene. A total of 232 nucleotides were changed and the G + C ratio was simultaneously increased from 42.7% to 43.1%. The recombinant xylanase (XynBop) was secreted into the culture medium that reached a total extracellular protein concentration of 10.1 g l−1 with an activity of 40,020 U ml−1 in 5-l fermentor culture. The recombinant enzyme was optimally active at pH 5.5 and at 100 ◦ C, respectively. The secreted expression level makes the enzyme a good candidate for hyperthermostable xylanase production. © 2012 Elsevier B.V. All rights reserved.

1. Introduction Xylanase (EC 3.2.1.8) has wide applications in the feed, paper and pulp, foodstuff and energy industry [1], as it can be used to exploit the second most abundant polysaccharide (xylan) in nature [2]. So far many xylanase genes from many fungi and bacteria such as Paecilomyces thermophila [3], Bispora sp. MEY-1 [4], Streptomyces halstedii JM8 [5], and Bacillus licheniformis [6] have been cloned and overexpressed in Escherichia coli and Pichia pastoris. Nowadays, due to the use of elevated temperatures in industrial processes, more effort is being put into the isolation of thermostable xylanases to improve the efficiency in bleaching process [7]. Many thermostable xylanases from thermophilic microorganisms such as Sulfolobus solfataricus, Thermomyces lanuginosus, Rhodothermus marinus, Thermomonospora alba, Thermotoga neapolitana, Bacillus halodurans, Clostridium stercorarium, Thermotoga maritima, and P. themophila [8–13] have been isolated and characterized. However, the demand for broad application of thermostable xylanases has stimulated the research to improve the enzyme production. To improve heterologous expression of proteins, many strategies have been developed in P. pastoris expression system. It includes high heterologous gene copy number [14], appropriate

∗ Corresponding author at: PO Box 294, China Agricultural University, No. 17 Qinghua Donglu, Haidian District, Beijing 100083, China. Tel.: +86 1062737689; fax: +86 1082388508. E-mail address: [email protected] (Z. Jiang). 1381-1177/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.molcatb.2012.02.009

signal peptide [15], strong promoters [16] and fermentation conditions [17]. It has now been indicated that the difference in codon usage between the native gene sequence and the expression host can affect the expression level of recombinant proteins [18]. Therefore, the codon optimization technique has been widely used to increase the expression of foreign proteins and usually results in 10- to 50-fold increase in target protein production [19]. In our previous work, a second xylanase gene (xynB) from the hyperthermophilic T. maritima has been cloned and expressed in E. coli [20] as well as P. pastoris [21]. The recombinant xylanase B (XynB) as a thermostable glycoside hydrolase family-10 xylanase was shown to be highly specific towards xylans and is a promising enzyme in the food, pulp and paper industry [22–24]. However, the low expression does not allow the recombinant protein to be applied practically and economically in industry. Therefore, the goal of our present study was to achieve high-level expression of hyperthermostable xylanase in P. pastoris by optimization of codon and other parameters. 2. Materials and methods 2.1. Strains, vectors, reagents and media The P. pastoris strain GS115 and the expression vector pPIC9K was purchased from Invitrogen (San Diego, CA). Pfu DNA polymerase was purchased from Promega (Madison, MI, USA) and T4 DNA ligase from Biolabs (New England Biolabs, USA). Multifunctional DNA purification kit was purchased from BioTeke (Beijing,

H. Jia et al. / Journal of Molecular Catalysis B: Enzymatic 78 (2012) 72–77

China). E. coli strain JM109 (Stratagene) was used for propagation and manipulation of plasmids. All other chemicals used were analytical grade reagents unless otherwise stated. Yeast extract peptone dextrose (YPD) medium, minimal dextrose (MD) Medium, minimal methanol (MM) medium, buffered glycerol complex (BMGY) medium, buffered methanol complex (BMMY) medium were prepared according to the manual of Pichia Expression Kit (Version F, Invitrogen). Fermentation Basal Salts (BSM) Medium and PTM1 Trace Salts used for fermentation were prepared according to the Pichia Fermentation Process Guidelines (Invitrogen).

2.2. Codon optimization and synthesis of the gene The codon usage of xynB (GenBank AE000512) from T. maritima was analyzed using Graphical Codon Usage Analyser (http://gcua.schoedl.de/), and was optimized by replacing the codons predicted to be less frequently used in P. pastoris with the frequently used ones by DNAworks software (http://mcl1.ncifcrf.gov/dnaworks/). Signal peptide was analyzed by SignalP 4.0 server (http://www.cbs.dtu.dk/services/SignalP/). N-Glycosylation sites were predicted using NetNglyc1.0 The optimized (http://www.cbs.dtu.dk/services/NetNglyc/). gene (xynBop) was synthesized by Sangon (Shanghai, China).

2.3. Construction of expression plasmid and transformation of P. pastoris The synthetic DNAs encoding the mature region of XynBop without the predicted signal sequence were amplified by PCR using appropriate sets of forward primer TMxynBOPF (ATCGATGGTACGTATCCCAGAATGTAAGTCTAAGGGAGC) and reverse primer TMxynBOPR (ATCGATGCCCTAGGTTACTTACGTTCCTCGATCTTTTTTTC), SnaBI and AvrII sites (underlined) were added to the forward and reverse primers, respectively. The purified PCR product was cloned in frame downstream of the ␣-factor prepro-sequence, yielding the recombinant plasmid pPIC9K-xynBop. The native xylanase gene (xynB) from T. maritima was cloned into pPIC9K using primers TMxynBF (ATCGATGGTACGTATCTCAGAATGTATCTCTGAGAGAACTC) and TMxynBR (ATCGATGCCCTAGGTCATTTTCTTTCTTCTATCTTTTTCTC), resulting in the recombinant plasmid pPIC9K-xynB. The recombinant plasmids were checked by DNA sequencing.

2.4. Transformation of P. pastoris and screening of multiple inserts P. pastoris GS115 competent cells were transformed with 10 ␮g of SalI-linearized pPIC9K-xynBop and pPIC9K-xynB plasmids by electroporation method, respectively. His+ transformants were recovered on MD (minimal dextrose) agar plates (1.34% YNB, 2% glucose, 4 × 10−5 % biotin, 1.5% agar). After incubation for 3 days at 30 ◦ C, the His+ transformants were resuspended with sterile water, and 103 cells were plated on YPD (yeast extract dextrose) plates containing Geneticin 418 (G418, Life Technologies, Gaithersburg, MD, USA) at a final concentration of 0.25, 0.5, 1.0, 2.0 and 4.0 mg ml−1 , putative multi-copy inserts were screened according to their resistance to G418. To differentiate Mut+ (methanol utilization plus) from Muts (methanol utilization slow) phenotype, methanol metabolization was checked by plating clones onto MM and MD plates according to the manual of Multi-copy Pichia expression kit (Version F, Invitrogen).

73

2.5. Expression of xynBop and xynB in P. pastoris shake-flask cultures The single colonies of recombinant P. pastoris clone were isolated from 4.0 mg ml−1 G418-YPD plate. The seeds were inoculated in 10 ml of BMGY medium in a 100 ml shake flask and incubated at 30 ◦ C and 250 rpm until the culture reached an OD600 = 2.0–6.0 (approximately 16–18 h). The cells were harvested by centrifugation and resuspended in 50 ml of BMMY medium (containing 0.5% methanol instead of glycerol as the sole carbon source) and incubated at 30 ◦ C and 250 rpm. Methanol (100%) was added every 24 h to ensure a final concentration of 0.5%. After 5 days of induction, the cells were pelleted by centrifugation at 10,000 rpm for 10 min at 4 ◦ C, the supernatant was used as crude enzyme. 2.6. High cell density fermentation High cell density fermentation was carried out in a 5-l bioreactor according to the Pichia Fermentation Process Guidelines (Version B, 053002). The His+ Mut+ clone of P. pastoris isolated from G418YPD plate was grown in 10 ml BMGY medium, in a 100 ml flask for 16 h at 30 ◦ C and 250 rpm. The culture was then inoculated into 200 ml of BMGY medium in a 1-l flask for 16–18 h at 30 ◦ C and 250 rpm, until the cell density reached an OD600 of more than 10.0. The batch culture was carried out with an initial culture volume of 2.0 l inoculated with the 200 ml preculture. The fermentor contained BSM medium plus 4.35 ml of PTM1 trace salts solution (per liter of BSM). The fermentor was maintained at 30 ◦ C at an agitation rate of 700 rpm. The pH was maintained at 5.0 by addition of ammonium hydroxide, dissolved oxygen was maintained ≥20% of air saturation by introduction of air to the fermentor at rate of about 1.0 vvm (volume per volume fermentor per minute). The fed batch culture on glycerol was initiated by starting the fedbatch medium at a rate of 18.4 ml h−1 l−1 once the dissolved oxygen increase was observed. For the methanol induction, the glycerol fed-batch phase was continued for 6 h, and then a methanol feed containing 12 ml PTM1 trace salts per liter methanol (adjusted to pH 6.0) was initiated. The methanol feed was ramped up from an initial rate of 3.6–10.9 ml h−1 l−1 over a 4-h period. Fed-batch fermentation was continued until 10 days. Culture was taken and the crude protein was collected by centrifugation at 10,000 × g for 15 min at 4 ◦ C, supernatant was withdrawn and dialyzed for analysis on SDS–PAGE. Enzyme activity and protein concentration were determined. 2.7. Assay of xylanase activity and protein determination Xylanase activity was assayed according to the method of Bailey [25]. All enzyme assays, unless otherwise stated, were carried out at 90 ◦ C for 10 min in 50 mM citrate buffer (pH 5.5). The reaction containing 0.9 ml of 1.0% (w/v) birchwood xylan and 0.1 ml of a suitably diluted enzyme solution was stopped by adding 1 ml of 1.0% (w/v) dinitrosalicylic acid (DNS). The amount of reducing sugar liberated was determined using xylose (Sigma) as the standard. One unit of xylanase activity is defined as the amount of enzyme that produced 1 ␮mol of reducing sugars per minute. Enzyme assays at 100 ◦ C and at 105 ◦ C were done in glycerol bath using glass test tube with rubber seals. Protein concentrations were measured by the Lowry method [26] using BSA (bovine serum albumin) as the standard. 2.8. SDS–PAGE and zymogram SDS-PAGE was performed using 12.5 (w/v) acrylamide in gels as described by Laemmli [27]. Protein bands were visualized by Coomassie brilliant blue R-250 staining. The molecular weight

74

H. Jia et al. / Journal of Molecular Catalysis B: Enzymatic 78 (2012) 72–77

Fig. 1. Alignment of nucleotide sequence between the synthetic gene (upper, xynBop) and the native gene (lower, xynB). Mismatched nucleotides were marked with “*”.

standard used was the low molecular weight calibration kit for SDS electrophoresis (Amersham): phosphorylase b (97.2 kDa), albumin (66.4 kDa), ovalbumin (44.3 kDa), carbonic anhydrase (29.0 kDa), trypsin inhibitor (20.1 kDa), a-lactalbumin (14.3 kDa). The xylanase zymogram analysis was done according to Schwarz et al. [28]. Further, the recombinant enzyme (XynBop) was deglycosylated by denaturing the protein at 100 ◦ C for 10 min prior to the addition of endoglycosidase H (Endo H, New England BioLabs) at 37 ◦ C for 2 h according to the manufacturer’s instructions.

2.9. Characterization of the recombinant xylanase B (XynBop) The influence of pH on xylanase activity was determined at 90 ◦ C using 50 mM of different buffers. The buffers used were citrate (pH 3.0–6.0), phosphate (pH 6.0–8.0), 2-(N-morpholino) ethane sulfonic acid (MES; pH 5.5–6.5), 3-(N-morpholino)-propane sulphonic acid (MOPS; pH 7.0–7.5), 2-(cyclohexylamino) ethanesulfonic acid (CHES; pH 8.0–10.0), (cyclohexylamino)-1-propanesulphonic acid (CAPS; pH 10.0–11.0) and glycine–NaOH (pH 11.0–12.0). The pH stability was determined by incubating the enzyme in different buffers for 30 min at 90 ◦ C over various pH ranges. To estimate the optimal temperatures, activity of enzyme was determined using the standard assay at the temperature range from 50 ◦ C to 105 ◦ C in 50 mM citrate (pH 5.5) with a final protein concentration of 0.0001 mg ml−1 . The thermal stability was determined by incubating the enzyme (0.5 mg ml−1 ) in pH 5.5 (50 mM citrate) for 30 min at the above temperature range, followed by cooling on ice. The residual xylanase activities were then measured according to the

standard assay method. The Km and Vmax values were calculated using “GraFit” software.

3. Results 3.1. Synthesis of codon-optimized gene and expression in P. pastoris Analysis of the DNA sequence of native xynB using Graphical Codon Usage Analyser revealed that some amino acid residues were encoded by codons that are rarely used in P. pastoris. These codons TCG (Ser), CTC (Leu), AGC (Ser) and GCG (Ala) shared less than 10% of usage percentage. The rare codons in xynB that may result in lower level of expression in P. pastoris were replaced by frequently used ones, and the G + C content was adjusted to an appropriate range (from 42.7% to 43.1%). The optimized gene (xynBop) shared 77.8% of nucleotide sequence identity with that of native gene (xynB) (Fig. 1). The frequency range is shown in Table 1. The synthetic gene (xynBop) and native gene (xynB) were cloned into the expression vector pPIC9K, in frame downstream of the ␣-factor prepro-sequence, yielding the recombinant plasmids pPIC9K-xynBop and pPIC9KxynB, respectively. The recombinant plasmids were linearized and then transformed into P. pastoris. Several thousands of positive colonies were obtained on MD plates after the transformation of P. pastoris with the plasmid. The positive clones were further screened for potential multiple inserts with YPD plates containing various concentration of G418. Five His+ Mut+ colonies from YPD plate containing 4.0 mg ml−1 of G418 showing the higher xylanase activity

H. Jia et al. / Journal of Molecular Catalysis B: Enzymatic 78 (2012) 72–77

75

Table 1 Comparison of the codon usage for native (xynB) and synthetic (xynBop) xylanase gene targeted at Pichia pastoris for expression. AA

Codon

Host fraction

xynB

xynBop

AA

Codon

Host fraction

xynB

xynBop

Gly

GGG GGA GGT GGC GAG GAA GAT GAC GTG GTA GTT GTC GCG GCA GCT GCC AGG AGA CGG CGA CGT CGC AGT AGC TCG TCA TCT TCC AAG AAA

0.10 0.32 0.44 0.14 0.43 0.57 0.58 0.42 0.19 0.15 0.42 0.23 0.06 0.23 0.45 0.26 0.16 0.48 0.05 0.10 0.16 0.05 0.15 0.09 0.09 0.19 0.29 0.20 0.53 0.47

3 8 6 1 10 24 10 9 11 2 9 2 8 8 2 2 2 13 0 0 0 0 2 4 2 0 6 2 10 19

0 3 8 7 18 16 10 9 4 2 11 7 0 8 7 5 7 4 0 0 4 0 6 0 0 2 2 6 21 8

Asn

AAT AAC ATG ATA ATT ATC ACG ACA ACT ACC TGG TGA TAA TGT TGC TAT TAC TTG TTA CTG CTA CTT CTC TTT TTC CAG CAA CAT CAC

0.49 0.51 1.00 0.19 0.50 0.30 0.11 0.24 0.40 0.25 1.00 0.18 0.53 0.65 0.35 0.46 0.55 0.33 0.16 0.16 0.11 0.16 0.08 0.54 0.46 0.39 0.61 0.57 0.43

4 15 7 10 5 13 3 3 3 2 10 1 0 3 1 5 14 8 1 5 0 7 6 7 11 6 1 3 5

4 15 7 11 9 8 2 1 6 2 10 0 1 3 1 11 8 10 1 5 5 6 0 5 13 4 3 4 4

Glu Asp Val

Ala

Arg

Ser

Lys

in the shake flask culture were used for high-cell density fermentation. 3.2. High cell density fermentation for production of recombinant xylanase B (XynBop) Upon methanol induction, the xylanase activity in the supernatant reached a maximum of 40,020 U ml−1 after 228-h induction with a heterologous protein concentration of 10.1 g l−1 (Fig. 2). Compared with the expression of native gene (xynB) in P. pastoris (14,394 U ml−1 ), the expression level of codon optimized gene (xynBop) was increased by 2.8-fold (Fig. 2A). The recombinant protein (XynBop) accounted for 85% of the total protein in the medium as estimated by the Software Quantity One (Fig. 2B). Analysis of secreted proteins present in the supernatant by SDS-PAGE showed there were three forms of the xylanase with molecular masses close to 40 kDa that were consistent with the calculated value, and all of them showed xylanase activity on zymogram (Fig. 3). Endo H treatment of XynBop resulted in a shift in the protein band on SDS–PAGE (Fig. 3), confirming that N-glycosylation is present in the recombinant xylanase. 3.3. Characterization of the recombinant enzyme The recombinant xylanase (XynBop) exhibited the highest xylanase activity at pH 5.5 (Fig. 4A). It was stable over a pH range of 4.0–12.0, retaining over 80% of its initial activity (Fig. 4B). XynBop exhibited its optimal activity at 100 ◦ C (Fig. 5A). The enzyme

Met Ile

Thr

Trp Stop Cys Tyr Leu

Phe Gln His

displayed extreme thermostability that it is retained its initial activity after being treated at 105 ◦ C for 30 min (Fig. 5B). The Michaelis–Menten constants of recombinant XynBop were determined for birchwood xylan, beechwood xylan and oat-spelt xylan (Table 2). The Km and Kcat values were 0.65 mg ml−1 and 74.3 s−1 for birchwood xylan, 0.41 mg ml−1 and 42.2 s−1 for beechwood xylan, and 1.37 mg ml−1 and 76.7 s−1 for oat-spelt xylan.

4. Discussion P. pastoris is now widely used for heterologous production of recombinant proteins owing to its high level expression, efficient secretion, proper protein folding and the potential to a high-cell density fermentation [29,30]. Due to the discrepancy of codon usage between the host and their original organisms, researchers have used codon optimization to increase the expression of a variety of proteins [31–33]. In this study, the G + C content of xynB from T. maritima was adjusted from 42.6% to 43.1% which is in the appropriate range for Pichia system. In addition to codon choice, the copy number of the gene cassette generally has an effect on the amount of protein expressed [14,34]. In this study, to make the optimized gene (xynBop) and native gene (xynB) carrying the same copy number of gene cassette, the putative multi-copy inserts were selected for expression by screening with the same concentration of G418. Hundreds of xynBop or xynB harboring recombinants from G418-plates were randomly picked out for shake-flask culture, five of which showed high activity and were further cultured in 5-l fed batch fermentation. The colonies used for high cell density

Table 2 Kinetic parameters of recombinant XynBop. Substrate

Vmax (␮mol min−1 mg−1 )

Km (mg ml−1 )

Kcat (s−1 )

Kcat /Km (mg−1 s−1 ml)

Birchwood xylan Beechwood xylan Oat-spelt xylan

4455 ± 179 2533 ± 131 4602 ± 92

0.65 ± 0.06 0.41 ± 0.04 1.37 ± 0.06

74.3 42.2 76.7

114 103 56

76

H. Jia et al. / Journal of Molecular Catalysis B: Enzymatic 78 (2012) 72–77

Relative activity (%)

(A)

100 80 60 40 20 0 2

4

2

4

6

8

pH

10

12

14

(B) 100 Relative activity (%)

80

Fig. 2. Time course profile of recombinant xylanase secretory production in P. pastoris high-density fermentation (A) and SDS–PAGE analysis (B). Symbols: protein content of XynBop (䊉), xylanase activity of XynBop (), protein content of XynB (), xylanase activity of XynB (). Xylanase activity was determined by DNS method. Samples of culture supernatants were diluted 10 times, 10 ␮l of which was subjected to SDS–PAGE. Lane M, low molecular weight standard protein markers. The time course indicate culture supernatants after 24 h, 48 h, 72 h, 96 h, 120 h, 144 h, 168 h, 192 h, 216 h, respectively. The values given are the average of separate experiments performed in triplicate. The error bars indicate standard deviations.

fermentation were screened from YPD plate containing 4.0 mg ml−1 of G418 that possessed recombinant putative multi-copy inserts. It may be possible to further increase the expression by increasing the gene copy number [14], using a more favorable signal sequence [15], or optimizing the conditions of fermentation [17]. Furthermore, the expression level was found to have greatly increased by codon optimization. The optimized gene (xynBop) subcloned in pPIC9K was truncated that is without predicted

Fig. 3. SDS–PAGE of deglycosylated recombinant protein in supernatant. Lane M, standard protein molecular weight markers; lane 1, culture supernatant (20 ␮g); lane 2, culture supernatant (20 ␮g) after treatment with Endo H at 100 ◦ C for 10 min; lane 3, XynBop (10 ␮g) without treatment with Endo H; lane 4, XynBop (10 ␮g) after Endo H treatment; lane 5, Endo H.

60 40 20 0 6

8

10

12

14

pH Fig. 4. pH optimum (A) and stability (B) of the recombinant xylanase XynBop. The influence of pH on the ␤-D-xylanase activity was determined at 90 ◦ C using 50 mM of different buffers: citrate (), MES (), phosphate (), MOPS (䊉), CHES (*), CAPS () and glycine–NaOH (). The values given are the average of separate experiments performed in triplicate. The error bars indicate standard deviations.

signal peptide coding sequence. By optimization, the xynBop was expressed in P. pastoris at a significantly higher level (10.1 g l−1 ) having xylanase activity of 40020 U ml−1 in 5-l fermentor after 228-h induction. To our knowledge, it is significantly higher than most other reported results [35,36], except Luo et al. [37] who achieved a higher level of production of a thermophilic and acid stable xylanase in a 3.7-l fermenter (73,400 U ml−1 ). Thus, XynBop potentially may be a good candidate for industrial use due to its hyperthermostable property and high-expression level. Nglycosylation is an important post-translational modification that plays a crucial role in a number of physiological and biochemical properties of a protein such as enzyme targeting, stability and function [38–40]. Deglycosylation of the recombinant protein revealed that it was N-linked glycosylated which is consistent with the predicted result, since that there is one putative glycosylation site (N–F–T) in the primary sequence of XynBop. Recently, the yeast Kluyveromyces lactis has been developed for the extracellular production of thermostable xylanases [41,42]. XynA from Dictyoglomus thermophilum Rt46B.1 expressed in K. lactis reached a concentration of 130 mg l−1 in shake flask cultures under selective conditions [41]. Also a ␤-1,4-xylanase gene (xynA) from Thermotoga sp. strain FjSS3-B.1 expressed in K. lactis was secreted to a level of 120 mg l−1 in shake-flasks in YPD medium [41]. Furthermore, Yang et al. transformed xynB into P. pastoris and the amount of recombinant protein secreted into the culture reached to 207 mg l−1 in 5 l bioreactor after incubation for 5 days induction

H. Jia et al. / Journal of Molecular Catalysis B: Enzymatic 78 (2012) 72–77

Relative activity (%)

(A)

References

100 80 60 40 20 0

50

60

70

80

90

100

110

Temperature (°C)

Relative activity (%)

(B) 100 80 60 40 20 0

77

50

60

70

80

90

100

110

Temperature (°C) Fig. 5. Optimal temperature (A) and thermostability (B) of the recombinant xylanase XynBop. The values given are the average of separate experiments performed in triplicate. The error bars indicate standard deviations.

[21]. Zhang et al. [43] expressed xynB in Aspergillus niger and the recombinant enzyme was secreted at a concentration of 500 mg l−1 . In this study, xynBop was expressed in P. pastoris at a significantly higher level (10.1 g l−1 ), which is much higher than the expression systems mentioned above. In conclusion, high-level extracellular production of XynBop was achieved whereby the highest concentration of secreted protein reached 10.1 g l−1 in P. pastoris by codon-optimizing the gene sequence of xynB from T. maritima. The recombinant enzyme exhibited extreme thermostability up to 105 ◦ C. These results have great implications for the production and future applications of the thermostable xylanase. Acknowledgements This work was financially supported by the Transformation Fund for Agricultural Science and Technology Achievements (Project No. 2010GB23600652) and the National High Technology Research and Development Program of China (863 Program, No. 2011AA100905).

[1] R.A. Prade, Biotechnol. Genet. Eng. Rev. 13 (1995) 101–131. [2] Q.K. Beg, M. Kapoor, L. Mahajan, G.S. Hoondal, Appl. Microbiol. Biotechnol. 56 (2001) 326–338. [3] M. Zhang, Z.Q. Jiang, S.Q. Yang, C.W. Hua, L.T. Li, Bioresour. Technol. 101 (2010) 688–695. [4] H. Luo, J. Yang, J. Li, P. Shi, H. Huang, Y. Bai, Y. Fan, B. Yao, Appl. Microbiol. Biotechnol. 86 (2010) 1829–1839. [5] A. Ruiz-Arribas, J.M. Fernadez, P. Sanchez, A. Garda, R.I. Santamaria, Appl. Environ. Microbiol. 6 (1995) 2414–2419. [6] M.Q. Liu, G.F. Liu, Protein Expr. Purif. 57 (2008) 101–107. [7] S. Subramaniyan, P. Prema, Crit. Rev. Biotechnol. 22 (2002) 33–64. [8] L. Dahlberg, O. Holst, J.K. Kristjansson, Appl. Microbiol. Biotechnol. 40 (1993) 63–68. [9] J. Blanco, J.J.R. Coque, J. Velasco, J.F. Martin, Appl. Microbiol. Biotechnol. 48 (1997) 208–217. [10] J. Lin, L.M. Ndlovu, S. Singh, B. Pillay, Biotechnol. Appl. Biochem. 30 (1999) 73–79. [11] R. Cannio, N. Di Prizito, M. Rossi, A. Morana, Extremophiles 8 (2004) 117–124. [12] C. Tachaapaikoon, Y.S. Lee, K. Rantanakhanokchai, S. Pinitglang, K.L. Kyu, M.S. Rho, S. Lee, J. Microbiol. Biotechnol. 16 (2006) 613–618. [13] S.Q. Yang, Q.J. Yan, Z.Q. Jiang, L.T. Li, H.M. Tian, Y.Z. Wang, Bioresour. Technol. 97 (2006) 1794–1800. [14] M. Manuel, C. Cecilia, H. Lester, P. Jose, V. Laura, V. Jorge, T. Yanet, H. Abdel, P. Liuba, B. Vladimir, G. Liudys, L. Emilio, C. Lila, M. Eduardo, Biotechnol. Lett. 27 (2005) 339–345. [15] M. Akira, T.A. Yumiko, Biosci. Biotechnol. Biochem. 65 (2001) 2291–2293. [16] G. Stadlmayr, A. Mecklenbräuker, M. Rothmüller, M. Maurer, M. Sauer, D. Mattanovich, B. Gasser, J. Biotechnol. 150 (2010) 519–529. [17] J.G. Zhang, X.D. Wang, E.Z. Su, G.C. Fang, Y.H. Ren, D.Z. Wei, Biochem. Eng J. 41 (2008) 74–78. [18] D. Teng, Y. Fan, Y.L. Yang, Z.G. Tian, J. Luo, J.H. Wang, Appl. Microbiol. Biotechnol. 74 (2007) 1074–1083. [19] S.O. Nikolay, J.S. Willem, A.J. Maarten, Protein Expr. Purif. 24 (2002) 18–24. [20] Z.Q. Jiang, A. Kobayashi, M.M. Ahsan, L.T. Li, M. Kitaoka, K. Hayashi, J. Biosci. Bioeng. 92 (2001) 423–428. [21] M.H. Yang, Y. Li, G.H. Guan, Z.Q. Jiang, Acta Microbiol. Sinica 45 (2005) 236–240. [22] Z.Q. Jiang, W. Deng, Y.P. Zhu, L.T. Li, Y.J. Sheng, K. Hayashi, J. Mol. Catal. B: Enzym. 27 (2004) 207–213. [23] Z.Q. Jiang, X.T. Li, S.Q. Yang, L.T. Li, Y. Li, W.Y. Feng, Appl. Microbiol. Biotechnol. 70 (2006) 65–71. [24] Z.Q. Jiang, A. Le Bail, A.M. Wu, J. Cereal Sci. 47 (2008) 172–179. [25] M.J. Bailey, P. Biely, K. Poutanen, J. Biotechnol. 23 (1992) 257–270. [26] O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall, J. Biol. Chem. 193 (1951) 265–275. [27] U.K. Laemmli, Nature 227 (1970) 680–685. [28] W.H. Schwarz, K. Bronnenmeier, F. Grabnitz, W.L. Staudenbauer, Anal. Biochem. 64 (1987) 72–77. [29] S. Macauley-Patrick, M.L. Fazenda, B. McNeil, L.M. Harvey, Yeast 22 (2005) 249–270. [30] N.P. Mchunu, S. Singh, K. Permaul, J. Biotechnol. 141 (2009) 26–30. [31] S.Y. Hu, L.W. Li, J.J. Qiao, Y.J. Guo, L.S. Cheng, J. Liu, Protein Expr. Purif. 47 (2006) 249–257. [32] H. Wang, Q.L. Wang, F.F. Zhang, Y.H. Huang, Y.L. Ji, Y.Y. Hou, Protein Expr. Purif. 60 (2008) 97–102. [33] J.K. Yang, L.Y. Liu, J. Mol. Catal. B: Enzym. 63 (2010) 164–169. [34] J.J. Clare, M.A. Romanos, F.B. Rayment, J.E. Rowedder, M.A. Smith, M.M. Payne, K. Sreekrishna, C.A. Henwood, Gene 105 (1991) 205–212. [35] V. Ruanglek, R. Sriprang, N. Ratanaphan, P. Tirawongsaroj, D. Chantasigh, S. Tanapongpipat, K. Pootanakit, L. Eurwilaichitr, Enzyme Microbiol. Technol. 41 (2007) 19–25. [36] S. Ahmed, S. Riaz, A. Jamil, Appl. Microbiol. Biotechnol. 84 (2009) 19–35. [37] H.Y. Luo, J. Li, J. Yang, H. Wang, Y.H. Yang, H.Q. Huang, P.J. Shi, T.Z. Yuan, Y.L. Fan, B. Yao, Extremophiles 13 (2009) 849–857. [38] P.M. Rudd, T. Elliott, P. Cresswell, I.A. Wilson, R.A. Dwek, Science 291 (2001) 2370–2376. [39] A. Helenius, M. Aebi, Science 291 (2001) 2364–2369. [40] R.J. Sola, K. Griebenow, J. Pharm. Sci. 98 (2009) 1223–1245. [41] D.J. Walsh, P.L. Bergquist, Appl. Environ. Microbiol. 63 (1997) 3297–3300. [42] D.J. Walsh, M.D. Gibbs, P.L. Bergquist, Extremophiles 2 (1998) 9–14. [43] J.X. Zhang, J. Pan, G.H. Guan, Y. Li, W. Xue, G.M. Tang, A.Q. Wang, H.M. Wang, Enzyme Microbiol. Technol. 43 (2008) 513–516.