High-throughput SNP genotyping based on solid-phase PCR on magnetic nanoparticles with dual-color hybridization

Journal of Biotechnology 131 (2007) 217–222

High-throughput SNP genotyping based on solid-phase PCR on magnetic nanoparticles with dual-color hybridization Hongna Liu a,b,1 , Song Li a,b,1 , Zhifei Wang a , Meiju Ji a , Libo Nie b , Nongyue He a,b,∗ a

State Key Laboratory of Bioelectronics (Chien-Shiung Wu Laboratory), School of Biological Science and Medical Engineering, Southeast University, Nanjing 210096, China b Key Laboratory of Green Packaging and Application of Biological Nanotechnology of Hunan Province, Hunan University of Technology, Zhuzhou 412008, China Received 23 March 2007; received in revised form 4 June 2007; accepted 26 June 2007

Abstract Single-nucleotide polymorphisms (SNPs) are one-base variations in DNA sequence that can often be helpful when trying to find genes responsible for inherited diseases. In this paper, a microarray-based method for typing single nucleotide polymorphisms (SNPs) using solid-phase polymerase chain reaction (PCR) on magnetic nanoparticles (MNPs) was developed. One primer with biotin-label was captured by streptavidin coated magnetic nanoparticles (SA-MNPs), and PCR products were directly amplified on the surface of SA-MNPs in a 96-well plate. The samples were interrogated by hybridization with a pair of dual-color probes to determine SNP, and then genotype of each sample can be simultaneously identified by scanning the microarray printed with the denatured fluorescent probes. The C677T polymorphisms of methylenetetrahydrofolate reductase (MTHFR) gene from 126 samples were interrogated using this method. The results showed that three different genotypes were discriminated by three fluorescence patterns on the microarray. Without any purification and reduction procedure, and all reactions can be performed in the same vessel, this approach will be a simple and labor-saving method for SNP genotyping and can be applicable towards the automation system to achieve high-throughput SNP detection. © 2007 Elsevier B.V. All rights reserved. Keywords: Magnetic nanoparticles; Single nucleotide polymorphisms; Solid-phase PCR; Dual-color hybridization

1. Introduction Single nucleotide polymorphisms (SNPs) are the most abundant forms of sequence variations between individuals and occur at about one per 500–1000 bp in the human genome (Marshall, 1997). SNPs, because they are usually biallelic, are more amenable to automated detection; they are also regarded as ideal genetic markers in linkage disequilibrium analysis for identifying genetic factors associated with common diseases or adverse drug responses due to their accessible class of polymorphisms present and genetic stability (Pennisi, 1998). So methods for SNP analysis are needed as a technology basis for a better

Abbreviations: SNP, single nucleotide polymorphism; MNP, magnetic nanoparticle; MTHFR, methylenetetrahydrofolate reductase; SA, streptavidin; SSC, standard saline citrate; PBS, phosphate-buffered saline. ∗ Corresponding author. Tel.: +86 25 83792245; fax: +86 25 57712719. E-mail address: [email protected] (N. He). 1 These two authors contributed equally to this work. 0168-1656/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.jbiotec.2007.06.023

understanding of the genetic basis for complex diseases, and to realize the potential of pharmacogenetics (Ranade et al., 2001). Microarray platform has been widely used for highly parallel genomic analyses, due to their highly multiplex capabilities, low cost and can be highly parallel readout for large-scale samples. Over the past several years, multiplexing high-throughput methods based on microarrays to discover and measure SNPs have been developed and commercialized (Flavel et al., 2003; Erdogan et al., 2001; Hultin et al., 2005), while, with the procedures for purification and concentration of targets in sample preparation these technologies are usually time-consuming and not suitable for automatic operation. So these methods have limited their utility in a high-throughput polymorphism detection to meet the challenges of the new genomics era. Furthermore, a rapid, simple, high-throughput parallel screening protocol for SNPs detection over thousands of samples is still required. Magnetic nanoparticles (MNPs) have already been successfully used in various fields of biology and medicine such as magnetic targeting (of drugs, genes), magnetic resonance imag-

218

H. Liu et al. / Journal of Biotechnology 131 (2007) 217–222

Table 1 Oligonucleotides used in this study Name

Type

Sequence 5 -3

C677T FP C677T RP 677CC probe 677TT probe C677T-WT C677T-MT

Forward primer Biotin-labeled reverse primer Wild type probes Mutant type probes Wild simulated target Mutant simulated target

TGAAGGAGAAGGTGTCTGCGGGA Biotin-(T)15 -AGGACGGTGCGGTGAGAGTG Cy3-CGGGAGCCGATTT Cy5-CGGGAGTCGATTT Biotin-(T)15 -GCCCTCGGCTAAA Biotin-(T)15 -GCCCTCAGCTAAA

The italicized base representing the recognition position.

2.2. Preparation of oligonucleotides

ing, immunoassays, cell separation, RNA and DNA purification, for their unique higher dispersion capability in aqueous solution, higher separation efficiency in magnetic field and easy operation in autoworkstations (Niemeyer, 2001; Zhao et al., 2003; Ingram et al., 2005). Furthermore, some methods using magnetic nanoparticles as platforms for SNPs genotyping were developed soon. Typically, Yoshino et al. developed a SNP detection using bacterial magnetic particles (BMP), the results were observed at a single particle level by fluorescence microscopy (Yoshino et al., 2003). They have succeeded in detecting a single particle as the minimal detectable unit in BMP assays, while the detection of this approach could not avoid the background of bacterial magnetic particles, and not suitable for high-throughput analysis. With the technique described above, the combination of elements referred both array-based “readout” technology and magnetic nanoparticles will facilitate the development of highthroughput genotyping methods (Fan et al., 2006). Herein, we present a methodology with PCR amplification directly on MNPs, hybridization with allele-specific probes labeled with dual-color fluorescence (Cy3, Cy5) for multiplex SNP profiling in conjunction with microarrays. In our method, all steps of the preparation can be performed in the same vessel by simple additions of solution and incubation, and then genotypes are discriminated by scanning the microarray printed with the denatured fluorescent probes onto an unmodified glass slide. Therefore, this method is particularly suitable for automation. Without the necessary procedures for purification and complex reduction of PCR products, the application of this strategy to large-scale SNP studies will be simple, labor-saving, high sensitive and potential for automation.

MNPs about 100 nm in diameter were prepared according to the previously published method (Wang et al., 2006). MNPs were modified firstly with 3-aminopropyl triethoxysilane (APTS) and then with glutaraldehyde as a linkage between the amine group of APTS on MNPs surface and streptavidin. The aldehyde-MNPs (10 mg) were washed thrice with 0.1 M phosphate-buffered saline (PBS, pH 7.4) for 20 min at room temperature with pulsed sonication. Then MNPs were magnetically separated from the mixture using a neodymium-boron (Nd-B) magnet and the supernatant was discarded. They were then incubated with streptavidin (100 mg/mL) in PBS buffer for 30 min at room temperature with pulsed sonication, and streptavidin were immobilized onto the MNPs surface. The streptavidin coated MNPs (SA-MNPs) were magnetically washed thrice with PBS buffer to remove excess unconjugated streptavidin and finally dispersed in PBS buffer with the concentration of 4 mg/mL and stored at 4 ◦ C.

2. Materials and methods

2.4. Solid-phase PCR

2.1. DNA Samples

MNPs-bound primers were prepared using every 15 pmol biotin-labeled reverse primers covalently immobilized onto 50 ␮g SA-MNPs. The PCR reaction was performed in 30 ␮l mixture contained 10 mM Tris–HCl (pH 8.3), 50 mM KCl, 2.0 mM MgCl2 , 200 ␮M each of the deoxynucleotide triphosphates, 100 ng template DNA, 1.25 U of Taq DNA polymerase (TaKaRa), 0.5 ␮M forward primer and 50 ␮g MNPs-bound reverse primer. As negative controls, SA-MNPs without biotinlabeled reverse primers were used to replace the SA-MNPs with bounded primers in amplification and genotyping procedure,

Peripheral bloods of 126 different patients with gastric carcinoma were obtained from Changsha Central Hospital (Changsha, China). A written informed consent was signed by all participants. Procedures were in accordance with the Helsinki Declaration for the Ethical Treatment of Human Subjects. Genomic DNA sample was extracted from 100 ␮l blood for each patient using a QIAamp DNA Blood Mini Kit (Qiagen).

The 677 methylenetetrahydrofolate reductase (MTHFR) polymorphisms were selected as targets. One set of PCR primers was designed to amplify a section (213 bp) of the methylenetetrahydrofolate reductase (MTHFR) gene containing the C677T SNP locus. The sequences of all oligonucleotides including PCR primers, allele-specific dual-color probes and simulated targets used in this study are shown in Table 1. All oligonucleotides were synthesized and purified by Shanghai Sangon Biologic Engineering Technology and Service Co. Ltd. (Shanghai, PR China). 2.3. Immobilization of streptavidin onto MNPs

H. Liu et al. / Journal of Biotechnology 131 (2007) 217–222

while the positive controls were obtained as dsDNA by traditional PCR. Then PCR amplification was carried out in 96-well plate in MJ PTC-220 PCR system. After an initial denaturation at 95 ◦ C for 5 min, amplification was carried out for 35 cycles of 15 s denaturation at 95 ◦ C, 30 s annealing at 62 ◦ C, and 30 s extension at 72 ◦ C, and extension was additionally performed at 72 ◦ C for 7 min. After amplification, the reaction complexes were washed twice with ddH2 O, then the complexes were resuspended with 20 ␮l ddH2 O and denatured at 95 ◦ C for 5 min and kept on ice for 1 min. After magnetic separation, the supernatant ssDNA was removed from each well to save for analysis using 1% agarose gel electrophoresis, and the concentration of ssDNA was determined by measuring the absorbance at 260 nm using ultraviolet spectrophotometer (Pgeneral, China). The ssDNAMNPs complexes were washed twice with ddH2 O, and then stored in the plate at 4 ◦ C until hybridization. 2.5. Effect of hybridization temperature on SNP detection In our study, biotin-labeled wild and mutant simulated targets were used to optimize the hybridization temperature instead

219

of biotin-labeled PCR products. Fifty microgram MNPs contained 15 pmol wild or mutant simulated target oligonucleotides were hybridized with allele-specific dual-color probes designed at various temperatures. The target hybridization mixture (20 ␮l) contained 7 ␮l hybridization solution (Sangon), 20 pmol probe 677CC and 677TT, respectively. Then the hybridization was conducted in a PCR tube using a PTC-220 thermocycler under a 102 ◦ C heat cover at various temperatures in hybridization mixture for 40 min. After hybridization, hybrid-MNPs complexes were separated using a Nd/B magnet and washed subsequently at the same hybridization temperature with 2× SSC containing 1 g/L SDS, 0.1× SSC containing 1 g/L SDS, 5 min for each wash, followed by a second wash in 3× SSC, then resuspended in 20 ␮l 3× SSC buffer. After a denaturation procedure, the denatured probe solutions were printed directly onto a cleaned glass slide to fabricate a microarray. After printing, the microarrays were snap-dried for 2 s on a hot plate (100 ◦ C), and then scanned with a 4100 A Microarray Analysis System (Axon), which was fitted with filters for Cy3 and Cy5. The images acquired by the scanner were analyzed with software Genepix Pro 6.0. For each fluorescent image, the average pixel intensity within each circle

Fig. 1. A schematic outline of the MNPs-PCR based genotyping method. The PCR products were directly amplified on the surface of SA-MNPs, after amplification, the reaction complexes were denatured and magnetically separated, then the ssDNA bounded on SA-MNPs hybridized with a pair of dual-color probes, finally the probes hybridized with ssDNA-MNPs were denatured and printed on an unmodified glass slide. Green, yellow and red spots indicate homozygous wild type (HoW, CC), heterozygote (He, CT), and homozygous mutant (HoM, TT) genotypes, respectively.

220

H. Liu et al. / Journal of Biotechnology 131 (2007) 217–222

was determined and a local background using mean pixel intensity was computed for each spot. The net signal was determined by subtraction of this local background from the mean average intensity for each spot. 2.6. Genotyping of 126 samples using dual-color probes Fig. 1 shows all procedures for SNP detection using MNPsPCR and dual-color probes hybridization. The ssDNA-MNPs complexes of each sample were hybridized with probes 677CC and 677TT in the 96-well plate at the optimized temperature. The procedures of hybridization and scanning of SNP microarray were consistent with the method described above. In principle, the homozygous wild type samples completely matched with probes 677CC yielded a strongly fluorescent Cy3 spots (green fluorescence). A strongly fluorescent Cy5 spots (red fluorescence) were shown for the homozygous mutant samples. The heterozygote yielded both Cy3 and Cy5 spots and, therefore, presented the strongly “yellow” fluorescence because of the overlapping of Cy3 and Cy5. Finally, according to our microarray genotyping results, fifteen representative samples including three genotypes were sequenced to validate the microarray results. 3. Results and discussion 3.1. The results of PCR amplification Fig. 2a shows agarose gel electrophoresis analysis of supernatant after amplification on the MNPs containing a denatured procedure. Amplification fragments were clearly found at about 213 bp from the electrophoresis image, which indicated PCR could go on successfully using 35 cycles and annealing at 62 ◦ C when one biotin-labeled primer was bound to the SA-MNPs surface. While, the ssDNA band intensities were not as high as usual dsDNA, it was because ethidium bromide stained ssDNA inherently less efficient than it did for dsDNA due to the dif-

ference in structures of ssDNA and dsDNA. Fig. 2b shows that the concentration of the supernatant ssDNA were between 68 and 131 ␮g/mL which were much lower than the positive control (over 300 ␮g/mL) amplified by conventional PCR. It was because that MNPs bound primers were harder to anneal with the targets in solid-phase PCR, though the biotin-labeled reverse primer were designed with Poly (T)15 spacer to reduce the steric resistance. Simultaneously, we could see the intensities of ssDNA among the six samples were different from each other; this might because that the amounts of gene copies from different templates were different after PCR amplification. 3.2. Effect of hybridization temperature on SNP detection In hybridization-based genotyping method, hybridization temperature is an important factor for accurate discrimination. Based upon the Tm values of the allele-specific detection probes, a pair of simulated biotin-labeled target oligonucleotides (mutant and wild) was designed to hybridize with the dualcolor detection probes at 33, 35, 37, 39, and 41 ◦ C, respectively. Fig. 3a and b shows fluorescence intensities of the denatured probes after hybridization using wild and mutant simulated target oligonucleotides, respectively. The highest fluorescence intensity was obtained at 33 ◦ C. However, the completely match probe could not be discriminated very easily from the singlebase mismatch probe at this temperature, the signal ratio (match: mismatch) of wild and mutant target was only 1.42 and 2.3, respectively. Fig. 3a shows that, with the increase of hybridization temperature to 39 ◦ C, the wild simulated target got a distinct signal ratio 11.5. When hybridization temperature came to 41 ◦ C, the signal ratio reduced to 7.3 due to the Cy3 fluorescence intensities decreased sharply. As shown in Fig. 3b, when hybridization was performed at 37 ◦ C, the mutant simulated target got the highest match: mismatch ratio (i.e., 12), while the fluorescence intensities were relatively strong. The optimum temperature of wild simulated target was about 2 ◦ C higher than the mutant target; it was because that the melting temperature of 677CC probe is higher than 677TT probe. Based on the above hybridization results, the further assays for hybridization of the 126 samples were performed at the optimum temperature of 38 ◦ C. 3.3. SNP detection

Fig. 2. Detection of PCR amplification on SA-MNPs. (a) Electrophoresis analysis of supernatant single strand PCR products amplified on SA-MNPs (wells 3–8) using 1% agarose gel. Well 1 showed the negative control without bounding primers on SA-MNPs, and well 2 indicated the positive control with conventional PCR. (b) The PCR concentrations of the corresponding wells.

According to dual-color fluorescent hybridization principle, three kinds of different fluorescent signal of SNP locus should be shown in the overlapped images of the microarray for three genotypes as shown in Fig. 1, the homozygous wild type (HoW CC), homozygous mutant type (HoM TT) and heterozygote type (He CT) yield strongly green, red and yellow spots, respectively. The genotyping results obtained for 126 different samples and 4 negative controls analyzed for the SNP site are shown in Fig. 4a. The expected scores and good discrimination were obtained between the two alleles for C677T locus. The complete array was spotted in four replicates and the fluorescence pattern was highly reproducible between replicates (Fig. 4). The three genotypes for the locus were very easily discriminated. Among the 126

H. Liu et al. / Journal of Biotechnology 131 (2007) 217–222

221

Fig. 3. Effect of hybridization temperature on SNP detection. (a) Hybridization results of wild simulated targets hybridized with dual-color probes at various temperatures. (b) Hybridization results of mutant simulated targets hybridized with dual-color probes at various temperatures. The signal ratios (match: mismatch) of fluorescence intensities at each temperature were labeled above the columns.

different samples, 62 samples showing strongly green spots indicated homozygous wild genotypes, and 15 samples displaying a ‘red’ fluorescence showed homozygous mutant genotypes, after overlapping, 49 samples yielded strongly ‘yellow’ fluorescence as shown in Fig. 4a and they actually indicated heterozygote at the locus. The fluorescence intensities of Cy3 and Cy5 from each spot were measured by Microarray Analysis Systems and used to generate points on an XY scatter plot (Fig. 4b). Quantification of the signal intensities gave a relative value of >1000 for both of the homozygous and heterozygous type samples. Homozygous and heterozygous SNP genotypes were discriminated as clusters on the graph, and the negative control was separated from them. The genotypes were then distinguished by comparing their fluorescence signal ratio (Cy3: Cy5). The signal ratios were >4.5 for the homozygous wild genotypes and <0.21 for the homozygous mutant genotypes on average, confirming a homozygous genotype, while the ratio between 0.75 and 1.9 indicates a het-

erozygous genotype. Thus, the clear difference in ratios among the three clusters allows unequivocal genotype assignment for the investigated SNP locus. We could also see that different samples scored different fluorescence intensities, this problem was mainly caused by the differences in concentration of PCR products from different samples (Fig. 2b). However, the genotyping results were not influenced by this problem. Fifteen representative samples were chosen to be validated by sequencing after conventional PCR amplification, and each of the determinations was consistent with the data obtained from sequencing results (data not shown). Previously, we have developed microarray-based genotyping methods, based on dual-color fluorescence hybridization (Ji et al., 2004; Hou et al., 2004). The experiment successfully demonstrated that PCR products subjected to dual-color hybridization on a microarray could be used to analyze molecular markers. However, PCR products have to be purified and condensed to a high concentration (>300 ng/␮L). This will be a

Fig. 4. (a) The genotyping results of 126 different samples and 4 negative controls assayed for the C677T locus of the MTHFR gene. Each sample was spotted four replicates in a column. (b) All spots were measured for the Cy3 and Cy5 fluorescence intensities to generate a scatter plot.

222

H. Liu et al. / Journal of Biotechnology 131 (2007) 217–222

time-consuming and laborious task. So, a magnetic nanoparticlebased genotyping approach was developed for avoiding the procedure of purification and concentration (Li et al., 2006). The biotin-labeled PCR product was immobilized directly on magnetic nanoparticles, and then dual-color hybridization was performed in the PCR tube. However, the superabundant unreacted biotin-labeled primers were also captured by the SAMNPs, which made the cost high when many samples need to be analyzed. Herein, we described another magnetic nanoparticlebased high-throughput discrimination of SNP based on solid phase MNPs-PCR and dual-color fluorescent probes hybridization. The PCR products were directly amplified on the surface of SA-MNPs in 96-well plate avoiding any purification and reduction procedure, after hybridization, the genotypes of all the checked samples were simultaneously identified by scanning the microarray printed with the denatured fluorescent probes. One major advantage of this method is that the cost is very competitive. Comparing with the previous method, we successfully reduced the amount of SA-MNPs used in one reaction from 80 to 50 ␮g using solid phase PCR, and the procedure was simpler. The applications of magnetic nanoparticles offer advantages over conventional methods due to quick processing times, reduced chemical requirements, and ease of magnetic separation. Furthermore, their single-domain magnetic properties make this approach well suitable for automated processes. In our study, all steps, including PCR, hybridization, denaturation and washing were performed in the same vessel, which made the detection procedure become much simpler and faster than the previously reported genotyping methods based on microarray, and it also would be applicable towards the automated workstation system to achieve high-throughput SNP detection. Acknowledgement This work was supported by National Natural Scientific Foundation of China (Project Nos. 60571032, 60121101, 30600736, 90606027), the 863 National High Technology Research and Development Program (Grant Nos. 2006AA 02Z133 and 2006AA03Z357).

References Erdogan, F., Kirchner, P., Mann, W., Ropers, H.H., Nuber, U.A., 2001. Detection of mitochondrial single nucleotide polymorphisms using a primer elongation reaction on oligonucleotide microarrays. Nucleic Acids Res. 29 (7), e36. Flavel, A.J., Bolshakov, V.N., Booth, A., Jing, R., Russel l, J., Ellis, T.H., Isaac, P., 2003. A microarray-based high throughput molecular marker genotyping method: the tagged microarray marker (TAM) approach. Nucleic Acids Res. 31 (19), e115. Fan, J.B., Chee, M.S., Gunderson, K.L., 2006. Highly parallel genomic assays. Nat. Rev. Genet. 7 (8), 632–644. Hou, P., Ji, M.J., Li, S., Lu, Z.H., 2004. Microarray-based approach for high-throughput genotyping of single-nucleotide polymorphisms with layerby-layer dual-color fluorescence hybridization. Clin. Chem. 50, 1955– 1957. Hultin, E., Ka¨ller, M., Ahmadian, A., Lundeberg, J., 2005. Competitive enzymatic reaction to control allele-specific extensions. Nucleic Acids Res. 35 (5), e48. Ingram, R., Tagoh, H., Riggs, A.D., Bonifer, C., 2005. Rapid, solid-phase based automated analysis of chromatin structure and transcription factor occupancy in living eukaryotic cells. Nucleic Acids Res. 33 (1), e1. Ji, M.J., Hou, P., Li, S., He, N.Y., Lu, Z.H., 2004. Microarray-based method for genotyping of functional single nucleotide polymorphisms using dual-color fluorescence hybridization. Mutat. Res. 548 (1–2), 97–105. Li, S., Liu, H.N., Wang, Z.F., Hou, P., Guo, Y.F., He, Q.G., He, N.Y., 2006. Magnetic particles-based high-throughput genotyping method with dualcolor fluorescence hybridization. Anal. Biochem. 359, 277–279. Marshall, E., 1997. The hunting of the SNP. Science 278, 2046–2048. Niemeyer, C.M., 2001. Nanoparticles, Proteins, and Nucleic Acids: Biotechnology Meets Materials Science. Angew. Chem. Int. Ed. 40, 4128–4158. Pennisi, E., 1998. A closer look at SNPs suggests difficulties. Science 281, 1787–1789. Ranade, K., Chang, M.S., Ting, C.T., Pei, D., Hsiao, C.F., Olivier, M., Pesich, R., Hebert, J., Chen, Y-D.I., Dzau, V.J., Curb, D., Olshen, R., Risch, N., Cox, D.R., Botstein, D., 2001. High-Throughput Genotyping with Single Nucleotide Polymorphisms. Genome Res. 11, 1262–1268. Wang, Z.F., Guo, H.S., Yu, Y.L., He, N.Y., 2006. Synthesis and characterization of a novel magnetic carrier with its composition of Fe3 O4 /carbon using hydrothermal reaction. J. Magn. Magn. Mater. 302 (2), 397–404. Yoshino, T., Tanaka, T., Takeyama, H., Matsunaga, T., 2003. Single nucleotide polymorphism genotyping of aldehyde dehydrogenase 2 gene using a single bacterial magnetic particle. Biosens. Bioelectron. 18, 661–666. Zhao, X.J., Tapec-Dytioco, R., Wang, K.M., Tan, W.H., 2003. Collection of Trace Amounts of DNA/mRNA Molecules Using Genomagnetic Nanocapturers. Anal. Chem. 75 (14), 3476–3483.