Higher plant RecA-like protein is homologous to RadA

DNA Repair 5 (2006) 80–88

Higher plant RecA-like protein is homologous to RadA Toyotaka Ishibashi a,c , Minako Isogai a , Hiroyuki Kiyohara a , Masahiro Hosaka a , Hiroyuki Chiku a , Asami Koga a , Taichi Yamamoto a , Yukinobu Uchiyama a , Yoko Mori a , Junji Hashimoto b , Juan Ausi´o c , Seisuke Kimura a , Kengo Sakaguchi a,∗ a

Department of Applied Biological Science, Faculty of Science and Technology, Tokyo University of Science, 2641 Yamazaki, Noda-shi, Chiba-ken 278-8510, Japan b National Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305-8602, Japan c Department of Biochemistry and Microbiology, University of Victoria, Victoria, BC, Canada V8W 3P6 Received 17 January 2005; received in revised form 12 July 2005; accepted 26 July 2005 Available online 2 September 2005

Abstract A novel RecA-like protein, differing from Dmc1 and Rad51, was characterized in Oryza sativa L. cv. Nipponbare. Because the protein is homologous to bacterial RadA, the gene was designated OsRadA. The open reading frame was predicted to encode a 66 kDa protein of 619 amino acid residues and was found in plants but not animals or yeast. OsRadA showed D-loop and single-stranded DNA-dependent ATPase activities. Gene expression was found to be high in meristematic tissues, and was localized in the nucleus. An RNAi mutant of Arabidopsis thaliana RadA (AtRadA) was sensitive to mutagenic agents such as UV and MMC, suggesting that RadA functions in DNA repair. © 2005 Elsevier B.V. All rights reserved. Keywords: RadA; Plant DNA repair; Rice; RecA-like

1. Introduction Chromosomal DNA can undergo damage from external factors such as ultraviolet rays (UV), ionizing radiation and chemical substances, as well as through the actions of endogenous products of metabolism. The accumulation of nucleic acid lesions can lead to disruption of normal metabolic activity, abnormal growth and development and, in reproductive tissues, to the inability to reproduce. The repair of lesions in genetic material is thus essential for survival. Double strand breaks (DSBs) constitute the most critical damage, with altered DNA being replaced by homologous recombination (HR) and non-homologous end joining (NHEJ) [1]. HR, which utilizes an undamaged homolog to faithfully restore the sequence at the break site, appears to be ∗ Corresponding author. Tel.: +81 4 7124 1501x3409; fax: +81 4 7123 9767. E-mail address: [email protected] (K. Sakaguchi).

1568-7864/$ – see front matter © 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.dnarep.2005.07.010

active predominantly in the S and G2 phases of the cell cycle when sister chromatids are available [2,3]. In eubacteria, RecA protein plays a pivotal role in homologue recombination and related repair, mediating the recognition of DNA sequence similarity and strand exchange between two DNA molecules [2]. In eukaryotes, RAD51 and DMC1 share significant sequence homology with the bacterial RecA gene [4,5]. Five Rad51 paralogues (RAD51B, RAD51C, RAD51D, XRCC2, XRCC3) in vertebrates have 20–30% amino acid sequence identity with one another [6–9]. Physical interactions between the five human Rad51 paralogs have been demonstrated using the yeast twohybrid assay [10], and co-expression of Xrcc3–Rad51C and Xrcc2–Rad51D in Escherichia coli, and Rad51B–Rad51C in Saccharomyces cerevisiae has shown that they can be purified as stable complexes [11–13]. In vivo, they form two complexes in solution, a Xrcc3/Rad51C heterodimer and a Rad51B/Rad51C/Rad51D/Xrcc2 heterotetramer [11,14,15]. In higher plants, homologs of RAD51 and DMC1 have

T. Ishibashi et al. / DNA Repair 5 (2006) 80–88

been identified [16], and five Rad51 paralogues (RAD51B, RAD51C, RAD51D, XRCC2, XRCC3) have recently been found and analyzed [17,18]. The Arabidopsis thaliana homolog protein AtRAD51 is not necessary for maintaining genome integrity under normal conditions. In contrast, the mutant line atrad51-1 is completely sterile and defective in male and female meioses. Unlike yeast DMC1, AtDMC1 is expressed not only in reproductive tissues but also in leaves and cultured cell suspension. Furthermore, it has been shown by two-hybrid analyses that AtXrcc3 interacts with AtRad51 and AtRad51C, and after ␥-ray exposure the expression of AtXRCC3 and AtRAD51C is increased [17]. Chloroplastic homologs of the bacterial RecA protein RecA-AT, from the pea plant (Pisum sativum L.) and A. thaliana, are also induced by MMS [19–21]. In bacteria, there are many groups of genes involved in recombination other than recA, including radA. Bacterial RadA may be related to the HR-related repair system [22,23]. The RadA protein contains a RecA-like NTPase in the central region. The C terminus of RadA is related to LonB protease, an ATP-dependent serine protease that binds to DNA and that regulates capsular polysaccharide synthesis. The active-site serine is present in E. coli RadA, but that residue is replaced by alanine in many eubacteria radA orthologues. Orthologues of radA carrying all of these sequence motifs are ubiquitous among the eubacteria. The radA gene of archaea, despite its name, is not related to the radA of eubacteria. In this work, we isolated and characterized a plant radA homolog that may be a repair protein universally present in higher plants.

81

nylon membranes (Hybond-N, Amersham). After prehybridization, filters were probed with 32 P-labeled OsRadA cDNA at 42 ◦ C for 16 h followed by washing twice with 2 × SSC + 0.1% SDS at room temperature for 15 min, and three times with 0.1 × SSC + 0.1% SDS at 65 ◦ C for 20 min. 2.4. Organelle fractionation Nucleus and chloroplast fractions were isolated from 10day-old rice seedlings with a Nucleus Isolation Kit (Sigma) and a Chloroplast Isolation Kit (Sigma) according to the manufacturer’s procedure. 2.5. Immunological analysis Polyclonal antibodies against OsRadA were raised in rabbits using purified protein [25]. Anti-rabbit IgG conjugated with alkaline phosphatase (Promega) was used as a secondary antibody with nitroblue tetrazolium and 5-bromo-4-chloro3-indolyl phosphate as substrates. 2.6. Immunofluorescence microscopy Immunostaining of tobacco BY-2 cells was carried out as described previously [26]. Cells were incubated for 1 h with antibody against OsRadA, diluted at 1:100 or 1:10 and treated for 1 h with FITC-conjugated anti-rabbit IgG (Sigma) diluted 1:10 as a secondary antibody. The cells were also stained with a solution of 20 ␮g/ml DAPI for 5 min before examination under a fluorescence microscope.

2. Materials and methods 2.7. Overexpression of recombinant OsRadA 2.1. Plant materials Rice plants (Oryza sativa L. cv. Nipponbare) were cultivated in a growth chamber with a 16 h light:8 h dark cycle at 28 ◦ C. Suspension–cultured cells of rice were cultured as described [24]. A. thaliana (Columbia) seeds were germinated on MS medium or soil, and plants were grown in a growth chamber under a 16 h light:8 h dark cycle at 23 ◦ C. 2.2. Cloning of OsRadA Insert DNA of the rice EST clone c98273 was excised and used to screen a rice cDNA library by plaque hybridization. Many plaques produced strong hybridization signals. Insert DNA was excised as pBluescript SK+ phagemids and sequenced. The nucleotide sequence data is in the DDBJ/EMBL/GenBank database under accession number AB111516. 2.3. Northern hybridization Aliquots of total RNA (20 ␮g) were resolved on 1.2% formaldehyde–agarose gels and transferred onto

The OsRadA coding region and OsRadA 251–280 aa deletion (OsRadA
251–280) mutant cDNA were cloned into the pCold I expression vector (Takara) and the protein was expressed by transforming the construct into the E. coli STAR (DE3) host (Invitrogen) and grown in 500 ml of LB medium containing 50 ␮g/ml ampicillin. Cells were grown to an absorbance (A600) of 0.5, and isopropyl ␤-dthiogalactoside was added to a final concentration of 1 mM. Cells were grown at 16 ◦ C for 12 h and harvested by centrifugation at 3000 × g for 10 min. Cell pellets were resuspended in 10 ml ice-cold binding buffer (20 mM Tris–HCl pH 7.9, 0.5 M NaCl, 5 mM imidazole, 0.1% NP-40) and sonicated with 15 bursts of 10 s each. Cell lysates were centrifuged at 39,000 × g for 20 min, the soluble protein fraction was collected as a crude extract and loaded onto 10 ml His-Bind resin (Novagen). The columns were washed with 50 ml binding buffer and then with 50 ml of wash buffer (20 mM Tris–HCl pH7.9, 0.5 M NaCl, 20 mM imidazole, 0.1% NP-40). The bound protein was eluted with 30 ml elution buffer (20 mM Tris–HCl pH7.9, 0.5 M NaCl, 500 mM imidazole). Eluted protein was dialyzed against buffer A (50 mM Tris–HCl pH 7.5, 1 mM EDTA, 5 mM 2-mercaptoethanol, 15% glycerol,

82

T. Ishibashi et al. / DNA Repair 5 (2006) 80–88

0.1% NP-40), and the dialysate was loaded onto a Mono Q HR5/5 column (Amersham Pharmacia Biotech) equilibrated with buffer A. After washing, the fraction was collected with 20 ml of a linear gradient of 0–1 M NaCl in buffer A. The eluted OsRadA and OsRadA
(251–280) were dialyzed against buffer A. 2.8. ATPase assay The ATPase activity of OsRadA was measured by the method described previously [27], using [␥-32 P]ATP. A 2 ␮M OsRadA, 400 nCi of [␥-32 P]ATP and 100 ␮M cold ATP were incubated with or without 2.5 ng/␮l of single-stranded or double-stranded M13 DNA (Takara) in buffer containing 25 mM K-HEPES (pH 7.2), 5 mM MgCl2 , 100 ␮g/ml BSA and 1 mM DTT at 37 ◦ C. Aliquots of the reactions were analyzed by thin layer chromatography. The amounts of ATP and Pi were quantified from autoradiography using an image analyzer (BAS3000, Fuji Film).

selected on MS agar media containing kanamycin, rifampicin and chloramphenicol. 2.11. Sensitivity for UV-B and MMC About 40 seedlings were grown on a petri plate in MS agar for 1 week, and irradiated with UV-B with the plate lid removed. UV-B lamps (TL01L; Philips) were used to irradiate A. thaliana seedlings at doses of 5000, 10,000, 20,000 and 30,000 J/m2 at a distance of 25 cm from six 20 W UVB lamps. Intensity was measured with a Spectroline digital radiometer DRC-100X (Spectronic) using a 300 nm filter (DIX 300). After irradiation, A. thaliana seedlings were incubated in a growth chamber under a 16 h light:8 h dark cycle at 23 ◦ C for 1 week. One-week-old seedlings were treated with several concentrations of MMC in strength MS liquid for sensitivity analysis in a growth chamber under a 16 h light:8 h dark cycle at 23 ◦ C for 1 week. Twenty-five seedlings were tested in each assay.

2.9. D-loop analysis Reactions (20 ␮l) contained 5 -32 P-end labeled 83mer ssDNA (TTGATAAGAGGTCATTTTTGCGGATGGCTTAGAGCTTAATTGCTGAATCTGGTGCTGTAGCTCAACATGTTTTAAATATGCAA) (1.25 ␮M, nucleotides), and the indicated concentration of OsRadA in buffer (50 mM Tris–HCl (pH 8.0), 15 mM MgCl2 , 2 mM ATP, 2 mM DTT, 100 ␮g/ml BSA, 20 mM CP and 2 U CPK). After 10 min at 37 ◦ C, M13 mp18 RF DNA (38.06 ␮M, nucleotides) (Takara) was added and incubation was continued for a further 10 min. Reactions were stopped by the addition of one-fifth volume of stop buffer (5% SDS and 10 mg/ml proteinase K) followed by a 20 min incubation at 37 ◦ C. 32 P-labeled DNA products were analysed by electrophoresis through 1% agarose gels in TAE buffer at 4 V/cm for 2.5 h, dried onto filter paper and visualized by autoradiography. 2.10. A. thaliana RNAi analysis Sequences encoding the inverted-repeat RNA were cloned into the pBE2113 intermediate vector, which contains an enhanced CaMV 35S promoter, and a nopaline synthase promoter: neomycin phosphotransferase (Pnos: NPTII) gene for the selectable marker [28]. 460 bp of GUS (1038–1498 bp) were cloned into the vector as the 5 and 3 arms of the intron. RNAi AtRadA transgenic lines were constructed by cloning a gene-specific cDNA fragment into the binary vector pBE2113. AtRadA was amplified by PCR using the primer pair: AtRadA-5 (TCAAACCGTTTACCTAAAAGAT) and AtRadA-3 (AGCTTGCTTCATAAGAACTGCA). These primers were used to obtain a fragment of 510 bp corresponding to nt 600–1110 of the AtRadA cDNA (At5g50340), which was introduced into Agrobacterium tumefaciens strain EHA105, and transformed into wild type (Columbia; Col0) plants by floral infiltration [29,30]. Transgenic lines were

3. Results 3.1. Identification and molecular cloning of a RecA-like protein (OsRadA) from rice The rice EST database was searched using the tBLASTn program and clone c98273 was found to show significant homology to E. coli RadA. Screening of a rice cDNA library resulted in the isolation of a 2.3 kb clone designated as O. sativa RadA (OsRadA). The open reading frame of OsRadA encodes a predicted product of 619 amino acid residues with a molecular mass of 66 kDa, which is different in size from other RadA proteins. We also identified a homolog of OsRadA from the genomic sequence of A. thaliana (At5g50340). The deduced amino acid sequence of OsRadA was compared with eukaryotic RadA homologs and found to have 40.4% sequence identity with AtRadA, 29.8% with BsRadA, 24.9% with EcRadA, 26.3% with PaRadA and 26.7% with SaRadA. As shown in Fig. 1, OsRadA protein has a high degree of conservation in the RecA-like NTPase domain (66.2% with AtRadA, 48.6% with BsRadA, 36.6% with EcRadA, 36.6% with PaRadA and 42.8% with SaRadA). There was no nucleotide sequence similar to OsRadA found in the genomic sequences of Homo sapiens, Drosophila melanogaster or S. cerevisiae. Therefore, OsRadA was considered to be a novel RecA-like protein present specifically in higher plants (Fig. 1). 3.2. Expression of OsRadA in different organs of the rice plant is correlated with cell proliferation To determine the expression patterns of OsRadA in the rice plant, northern hybridization analysis was performed.

T. Ishibashi et al. / DNA Repair 5 (2006) 80–88

83

Fig. 1. Alignment of predicted amino acid sequences of OsRadA, Arabidopsis thaliana (At), Bacillus subtillis (Bs), Escherichia coli (Ec), Pseudomonas aeruginosa (Pa) and Staphylococcus aureus (Sp) RadA homologs.

Total RNA samples isolated from organs of 50- and 150day-old rice plants (Fig. 2A) were blotted and probed with 32 P-labeled OsRadA cDNA. OsRadA was strongly detected in shoot apical meristems, young leaves, roots and root tips

Fig. 2. (A) Expression of OsRadA by Northern analysis in different organs. Each lane contains 20 ␮g of total RNA isolated from shoot apical meristem (lane 1), young leaves (lane 2), mature leaves (lane 3), rice cultured cells (lane 4), roots (lane 7), root tips (lane 8) from 50-day-old rice plants, or flag leaves (lane 5) and ears (lane 6) from approximately 150-day-old rice plants. The blot was probed with 32 P-labeled OsRadA cDNA (upper panel). Similar amounts of RNA were loaded in each lane, as confirmed by ethidium bromide staining (lower panel). (B) Effects of sucrose starvation on the expression levels of OsRadA. Rice cells were cultured in suspension for 6 (lane 1 and 2) or 10 days (lane 3) with (lane 1) or without (lanes 2 and 3) sucrose, or cultured for 6 days before sucrose was added to the medium (lane 4). Aliquots of 20 ␮g of total RNA isolated from the cultured cells were separated on a 1.2% agarose gel containing formaldehyde and then blotted and probed with 32 P-labeled OsRadA cDNA. Similar amounts of RNA were loaded in each lane, as confirmed by ethidium bromide staining (lower panel).

(lanes 1, 2, 7 and 8 in Fig. 2A) and weakly in mature leaves, flag leaves and ears (lanes 3, 5 and 6 in Fig. 2A). Shoot apical meristematic tissues and young leaves contained numerous proliferating cells, while mature leaves had no proliferating cells. Cell proliferation in meristematic tissues is very active and the level of DNA replication in the meristem may be high [31]. Transcription of OsRadA may be related to the level of cell proliferation.

Fig. 3. Subcellular localization of OsRadA. (A) Western blotting analysis of nuclei and chloroplast fractions of 10-day-old rice seedlings probed with anti-OsRadA, anti-DS9 or anti-OsPCNA antibodies. (B) Localization of OsRadA in tobacco BY2 cells. Left panel: DAPI staining. Right panel: FITC staining for OsRadA. The bar represents 10 ␮m.

84

T. Ishibashi et al. / DNA Repair 5 (2006) 80–88

OsRadA was actively transcribed in rice suspension cells (lane 1 in Fig. 2B). When cell proliferation was temporarily halted for 6 or 10 days by the removal of sucrose from the growth medium, expression of OsRadA was significantly reduced, but not completely inhibited (lanes 2 and 3 in Fig. 2B). When the growth-halted cells began to re-grow following the addition of sucrose to the medium, OsRadA was again expressed at high levels (lane 4 in Fig. 2B). These

results suggest that the expression of OsRadA is correlated with cell proliferation. 3.3. Subcellular localization of OsRadA The subcellular localization of OsRadA was investigated by fractionation analysis in rice seedlings and immunostaining in tobacco BY2 cells using an antibody against OsRadA.

Fig. 4. D-loop and ATPase activities of OsRadA. (A) SDS-PAGE analysis of the purified OsRadA protein and OsRadA
(251–280) protein. (B) ATPase activity of OsRadA. OsRadA (2 ␮M), [␥-32 P]ATP (400 nCi) and 100 ␮M of ATP were incubated with or without DNA at 37 ◦ C, and aliquots were analyzed by thin layer chromatography. Each value is the average of three separate samples and bars indicate SD. (C–E) D-loop activity of OsRadA. (C) Incubation times were 1 min (lane 3), 2 min (lane 4), 5 min (lane 5), 10 min (lane 6), 20 min (lane 7) and 30 min (lane 8) with 2 ␮M OsRadA, 10 min (lane 2) with 2 ␮M BSA or 10 min (lane 1) without protein. (D) OsRadA was added at 0 ␮M (lane 1), 0.125 ␮M (lane 3), 0.25 ␮M (lane 4), 0.5 ␮M (lane 5), 1 ␮M (lane 6), 2 ␮M (lane 7) and 5 ␮M (lane 8) or BSA at 2 (lane 2) ␮M. (E) Optimum temperature. Incubation at 16 ◦ C (lane1), 23 ◦ C (lane 2), 30 ◦ C (lane 3), 37 ◦ C (lanes 4, 9, 10), 42 ◦ C (lane 5), 50 ◦ C (lane 6), 60 ◦ C (lane 7) or 70 ◦ C (lane 8). In lane 1–8, 2 ␮M OsRadA, lane 9, 2 ␮M BSA, lane 10, no protein. (F–H) Relative activities in (C–E). The OsRadA
(251–280) D-loop assay was performed at 2 ␮M OsRadA
(251–280), 10 min incubation and 37 ◦ C. Each value is the average of three separate samples and bars indicate S.D.

T. Ishibashi et al. / DNA Repair 5 (2006) 80–88

85

3.4. Biochemical characterization of OsRadA ATPase and strand transfer (D-Loop) activities were measured to characterize the biochemical properties of OsRadA (Fig. 4). Purified OsRadA protein was shown in Fig. 4A. As shown in Fig. 4B, like most RecA-like proteins, ATPase activity of OsRadA proved to be dependent on single-stranded DNA. D-loop activity reached a maximum 5–10 min after the reaction began (Fig. 4C and F) was protein quantitydependent (Fig. 4D and G) and 37 ◦ C was the optimal temperature (Fig. 4E and H). At 16 or 23 ◦ C, OsRadA did not have a D-loop activity (Fig. 4E and H). An inactivation mutant of OsRadA, OsRadA
(251–280), (see Fig. 4A.) did not have D-loop activity (Fig. 4F). This discards the possibility that the D-loop activity could be derived from any contamination from the E. coli expression strain. These data suggest that, like OsRad51 and OsDmc1, OsRadA also has functions as a strand transfer protein in rice, and perhaps generally in higher plants. 3.5. Analysis of the AtRadA RNAi mutant

Fig. 4. (Continued ).

Fig. 3A is a western blotting analysis pattern for OsRadA in subcellular organelles such as nuclei and chloroplasts. DS9 is a homolog of bacterial FtsH protein and is localized in chloroplasts [32]. The sliding clamp OsPCNA (O. sativa proliferating cell nuclear antigen) is an important factor involved in DNA replication and repair, and is localized in the nucleus [33]. Signals occurred only in the nuclear fraction (lane 1 in Fig. 3A), and not in the chloroplast fraction (lane 2 in Fig. 3A). For confirmation, we immunostained tobacco BY2 cells (Fig. 3B). A single band was detected in tobacco BY2 cell crude extracts by the antibody, indicating that the OsRadA homolog is present in tobacco BY2 cells (data not shown). In Fig. 3B, the left and right panels show DAPI and FITC staining, respectively, of cells, RadA being localized in the nucleus (Fig. 3). These results suggested that OsRadA functions in the nucleus and not in the chloroplast.

Fig. 5A shows the AtRadA RNAi vector construct, and Fig. 5B indicates the amount of AtRadA present in the three AtRadA RNAi mutant lines. The RadA proteins of all AtRadA RNAi mutant lines were reduced in comparison to the wild type (Fig. 5B). However, AtRadA RNAi mutant lines were viable and phenotypic differences from the wild type were marginal. Therefore, RNAi line 3 (lane 4 in Fig. 5B) was tested in the following experiments: One-week-old seedlings were treated with UV-B (Fig. 5C), or transferred to MS medium containing 5, 10 or 20 ␮M of MMC (Fig. 5D), or exposed to 5000, 10,000, 20,000 or 30,000 J/m2 of UVB (Fig. 5C) for 1 week. The RNAi mutant seedlings were more sensitive to these mutagens. In wild type, bleaching of the seedlings was apparent beginning at a dose of about 40,000 J/m2 of UV-B (data not shown). When compared with the wild type plants, growth of the mutant seedlings was noticeably affected by 30,000 J/m2 of UV-B (Fig. 5C). Similarly, at 5, 10 and 20 ␮M of MMC, root growth of the mutant seedlings was mildly suppressed compared to the wild type (Fig. 5D).

4. Discussion A novel RecA-like protein from rice was shown by amino acid sequence comparison to be a homolog of RadA in bacteria, and thus, termed O. sativa RadA (OsRadA). A homolog was also found in the genome of A. thaliana (AtRadA) (Fig. 1). It is clear that OsRadA differs from O. sativa RecA-like genes such as RAD51, the RAD51 paralogues and DMC1. RadA homologs do not appear to be present in mammals and yeast, indicating that this gene is not universal among higher organisms, and may be limited to higher plants. Further work is needed to determine the distribution of RadA-like genes in

86

T. Ishibashi et al. / DNA Repair 5 (2006) 80–88

Fig. 5. AtRadA RNAi transformant line analysis. (A) Construct of AtRadA RNAi vector. (B) Western blotting analysis using anti-OsRadA and anti-␤ tubulin antibodies. Lane 1, Wild type seedlings; lanes 2–4, AtRadA RNAi mutant plants. (C) Sensitivity of the AtRadA RNAi mutant to UV-B. The UV-B dosage is shown above the top row (0, 5000, 10,000, 20,000, 30,000 J/m2 ). (D) Root lengths of the wild type and AtRadA RNAi mutant with several concentrations of MMC. The MMC concentrations tested are 0, 5, 10, 20 and 40 ␮M. Values are an average of triplicate assays and bars indicate S.D.

other taxa. OsRadA was shown to be a typical RecA-like protein. RadA was thought to be a RecA-like protein found only in bacteria, and to our knowledge, there has been no other report to date of RadA in plants, yeast or animals. Since OsRadA showed activities of strand transfer and a DNA-dependent ATPase activity like its eubacterial counterparts, it is likely that its physiological characteristics have been retained in plants (Fig. 4). In higher plants, the rigid partitioning of cell proliferation means that repair can separately occur in tissues in which DNA does or does not replicate. Since OsRadA is expressed in shoot and root apical meristems and in cultured cells, its function correlates with proliferating tissues, and in the present experiments using sucrose, the expressed amounts of OsRadA changed with cell multiplication (Fig. 2). The AtRadA RNAi mutant line with reduced expression proved to be viable. However, the AtRadA RNAi mutant is not a null mutant, therefore we could not determine the role of RadA on fertility or as an essential factor in meristem growth. A small amount RadA may be sufficient for normal

growth, but reduced expression may increase sensitivity to DNA damaging agents such as UV-B and MMC (Fig. 5). In bacteria, RadA appears to participate as a member of a redundant group of Holliday junction processing enzymes [23]. This may be the same in plants since RNAi has no drastic effect either on sensitivity to genotoxic agents or on plant growth. In the root apical meristem, OsRadA was found to be transcribed more than in above-ground tissues except for the shoot apical meristem, though the roots were not subjected to UV-illumination. However, the AtRadA RNAi mutant line was more sensitive to mutagens such as UV-B and MMC than the wild type. The expression of HR-related factors is more prevalent in shoot apical meristematic tissues than in mature leaves [31]. The expression of AtRAD51 is mostly somatic, although AtDMC1 is expressed only in meiotic tissues [17]. AtRad51 may play a pivotal role in HR in nuclear DNA replication. The responses of plants to UV irradiation are quite distinct from yeast and mammalian cells, possibly due to differences in environmental exposure. In higher

T. Ishibashi et al. / DNA Repair 5 (2006) 80–88

plants, the above-ground meristems may need more active repair systems to remove cyclobutane pyrimidine dimers and pyrimidine (6–4) pyrimidone photoproducts more quickly than yeast and mammalian cells. This is because plant cells enter meiosis only after significant vegetative growth and because mutations that accumulate over time in somatic tissues may be passed on to the gametophytes [34]. Unlike yeast and mammalian cells, intact plants use sunlight for photosynthesis, and are thus, unavoidably exposed to the UV radiation present in solar radiation [35–37]. To overcome this increased damage, higher plants may have RadA-like protein(s) to participate in a redundant group of Holliday junction processing enzymes. The results of this work may indicate that RadA is involved with DNA repair in higher plants, but an assay of DNA repair is required to show direct involvement. Acknowledgements We thank the Rice Genome research Program (RGP) of Japan for providing the rice EST clone C98273. We also wish to express our appreciation to Dr. Mitsuhara and Dr. Ohashi (National Institute of Agrobiological Sciences) for providing the pBE2113 vector and Dr. Seo (National Institute of Agrobiological Sciences) for providing the polyclonal antibody against DS9. This work was supported by the grant from the Ministry of Agriculture, Forestry and Fisheries of Japan (Rice Genome Project IP-5006) and by the grant from the Ministry of Education, Science, Sports and Culture of Japan (Grantin-Aid for Young Scientists (B), 15770031). This work was also supported by a grant from Futaba Electronics Memorial Foundation (Japan), The Asahi Glass Foundation (Japan), The Sumitomo Foundation (Japan) and a Canadian Institutes of Health Research (CIHR) grant MOP-57718 (to JA). References [1] J. Thacker, A surfeit of RAD51-like genes? Trends Genet. 15 (1999) 166–168. [2] H.J. Dunderdale, S.C. West, Recombination genes and proteins, Curr. Opin. Genet. Dev. 4 (1994) 221–228. [3] J.E. Haber, DNA recombination: the replication connection, Trends Biochem. Sci. 24 (1999) 271–275. [4] A. Shinohara, H. Ogawa, T. Ogawa, Rad51 protein involved in repair and recombination in S. cerevisiae is a RecA-like protein, Cell 69 (1992) 457–470. [5] T. Ogawa, X. Yu, A. Shinohara, E.H. Egelman, Similarity of the yeast RAD51 filament to the bacterial RecA filament, Science 259 (1993) 1896–1899. [6] R.D. Johnson, N. Liu, M. Jasin, Mammalian XRCC2 promotes the repair of DNA double-strand breaks by homologous recombination, Nature 401 (1999) 397–399. [7] D.K. Bishop, U. Ear, A. Bhattacharyya, C. Calderone, M. Beckett, R.R. Weichselbaum, A. Shinohara, Xrcc3 is required for assembly of Rad51 complexes in vivo, J. Biol. Chem. 273 (1998) 21482–21488. [8] M.K. Dosanjh, D.W. Collins, W. Fan, G.G. Lennon, J.S. Albala, Z. Shen, D. Schild, Isolation and characterization of RAD51C, a new human member of the RAD51 family of related genes, Nucleic Acids Res. 26 (1998) 1179–1184.

87

[9] D.L. Pittman, L.R. Weinberg, J.C. Schimenti, Identification, characterization, and genetic mapping of Rad51d, a new mouse and human RAD51/RecA-related gene, Genomics 49 (1998) 103–111. [10] D. Schild, Y.C. Lio, D.W. Collins, T. Tsomondo, D.J. Chen, Evidence for simultaneous protein interactions between human Rad51 paralogs, J. Biol. Chem. 275 (2000) 16443–16449. [11] H. Kurumizaka, S. Ikawa, M. Nakada, K. Eda, W. Kagawa, M. Takata, S. Takeda, S. Yokoyama, T. Shibata, Homologous-pairing activity of the human DNA-repair proteins Xrcc3.Rad51C, Proc. Natl. Acad. Sci. U.S.A. 98 (2001) 5538–5543. [12] H. Kurumizaka, S. Ikawa, M. Nakada, R. Enomoto, W. Kagawa, T. Kinebuchi, M. Yamazoe, S. Yokoyama, T. Shibata, Homologous pairing and ring and filament structure formation activities of the human Xrcc2* Rad51D complex, J. Biol. Chem. 277 (2002) 14315–14320. [13] S. Sigurdsson, S. Van Komen, W. Bussen, D. Schild, J.S. Albala, P. Sung, Mediator function of the human Rad51B-Rad51C complex in Rad51/RPA-catalyzed DNA strand exchange, Genes Dev. 15 (2001) 3308–3318. [14] J.Y. Masson, M.C. Tarsounas, A.Z. Stasiak, A. Stasiak, R. Shah, M.J. McIlwraith, F.E. Benson, S.C. West, Identification and purification of two distinct complexes containing the five RAD51 paralogs, Genes Dev. 15 (2001) 3296–3307. [15] K.A. Miller, D.M. Yoshikawa, I.R. McConnell, R. Clark, D. Schild, J.S. Albala, RAD51C interacts with RAD51B and is central to a larger protein complex in vivo exclusive of RAD51, J. Biol. Chem. 277 (2002) 8406–8411. [16] V.I. Klimyuk, J.D. Jones, AtDMC1, the Arabidopsis homologue of the yeast DMC1 gene: characterization, transposon-induced allelic variation and meiosis-associated expression, Plant J. 11 (1997) 1–14. [17] K. Osakabe, T. Yoshioka, H. Ichikawa, S. Toki, Molecular cloning and characterization of RAD51-like genes from Arabidopsis thaliana, Plant Mol. Biol. 50 (2002) 71–81. [18] J.Y. Bleuyard, C.I. White, The Arabidopsis homologue of Xrcc3 plays an essential role in meiosis, Embo J. 23 (2004) 439–449. [19] H. Cerutti, M. Osman, P. Grandoni, A.T. Jagendorf, A homolog of Escherichia coli RecA protein in plastids of higher plants, Proc. Natl. Acad. Sci. U.S.A. 89 (1992) 8068–8072. [20] H. Cerutti, H.Z. Ibrahim, A.T. Jagendorf, Treatment of pea (Pisum sativum L.) protoplasts with DNA-damaging agents induces a 39kilodalton chloroplast protein immunologically related to Escherichia coli RecA, Plant Physiol. 102 (1993) 155–163. [21] J. Cao, C. Combs, A.T. Jagendorf, The chloroplast-located homolog of bacterial DNA recombinase, Plant Cell Physiol. 38 (1997) 1319–1325. [22] C.E. Beam, C.J. Saveson, S.T. Lovett, Role for radA/sms in recombination intermediate processing in Escherichia coli, J. Bacteriol. 184 (2002) 6836–6844. [23] B. Carrasco, M.C. Cozar, R. Lurz, J.C. Alonso, S. Ayora, Genetic recombination in Bacillus subtilis 168: contribution of Holliday junction processing functions in chromosome segregation, J. Bacteriol. 186 (2004) 5557–5566. [24] A. Baba, S. Hasezawa, K. Syono, Cultivation of rice protoplasts and their transformation mediated by Agrobacterium spheroplast, Plant Cell Physiol. 27 (1986) 463–471. [25] H. Towbin, T. Staehelin, J. Gordon, Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications, Proc. Natl. Acad. Sci. U.S.A. 76 (1979) 4350–4354. [26] S. Hasezawa, T. Nagata, Dynamic organization of plant microtubules at the three distinct transition points during the cell cycle progression of synchronized tabacco BY-2 cells, Bot. Acta 104 (1991) 206–211. [27] T. Nara, F. Hamada, S. Namekawa, K. Sakaguchi, Strand exchange reaction in vitro and DNA-dependent ATPase activity of recombinant LIM15/DMC1 and RAD51 proteins from Coprinus cinereus, Biochem. Biophys. Res. Commun. 285 (2001) 92–97. [28] I. Mitsuhara, M. Ugaki, H. Hirochika, M. Ohshima, T. Murakami, Y. Gotoh, Y. Katayose, S. Nakamura, R. Honkura, S. Nishimiya,

88

[29]

[30]

[31]

[32]

T. Ishibashi et al. / DNA Repair 5 (2006) 80–88 K. Ueno, A. Mochizuki, H. Tanimoto, H. Tsugawa, Y. Otsuki, Y. Ohashi, Efficient promoter cassettes for enhanced expression of foreign genes in dicotyledonous and monocotyledonous plants, Plant Cell Physiol. 37 (1996) 49–59. C.F. Chuang, E.M. Meyerowitz, Specific and heritable genetic interference by double-stranded RNA in Arabidopsis thaliana, Proc. Natl. Acad. Sci. U.S.A. 97 (2000) 4985–4990. N.A. Smith, S.P. Singh, M.B. Wang, P.A. Stoutjesdijk, A.G. Green, P.M. Waterhouse, Total silencing by intron-spliced hairpin RNAs, Nature 407 (2000) 319–320. S. Kimura, Y. Tahira, T. Ishibashi, Y. Mori, T. Mori, J. Hashimoto, K. Sakaguchi, DNA repair in higher plants; photoreactivation is the major DNA repair pathway in non-proliferating cells while excision repair (nucleotide excision repair and base excision repair) is active in proliferating cells, Nucleic Acids Res. 32 (2004) 2760–2767. S. Seo, M. Okamoto, T. Iwai, M. Iwano, K. Fukui, A. Isogai, N. Nakajima, Y. Ohashi, Reduced levels of chloroplast FtsH protein in tobacco mosaic virus-infected tobacco leaves accelerate the hypersensitive reaction, Plant Cell 12 (2000) 917–932.

[33] S. Kimura, T. Suzuki, Y. Yanagawa, T. Yamamoto, H. Nakagawa, I. Tanaka, J. Hashimoto, K. Sakaguchi, Characterization of plant proliferating cell nuclear antigen (PCNA) and flap endonuclease-1 (FEN-1), and their distribution in mitotic and meiotic cell cycles, Plant J. 28 (2001) 643–653. [34] A.E. Staplenton, C.S. Thornber, V. Walbot, UV-B component of sunlight causes measurable damage in field grown maize (Zea mays L.): developmental and cellular heterogeneity of damage and repair, Plant Cell Environ. 20 (1997) 279–290. [35] L.O. Bjorn, S. Widell, T. Wang, Evolution of UV-B regulation and protection in plants, Adv. Space Res. 30 (2002) 1557– 1562. [36] W. Bilger, T. Johnsen, U. Schreiber, UV-excited chlorophyll fluorescence as a tool for the assessment of UV-protection by the epidermis of plants, J. Exp. Bot. 52 (2001) 2007–2014. [37] A. Britt, C.Z. Jiang, Generation, identification, and characterization of repair–defective mutants of Arabidopsis, Methods Mol. Biol. 113 (1999) 31–40.