Peroxisomal Pex11 is a pore-forming protein homologous to TRPM channels

    Peroxisomal Pex11 is a pore-forming protein homologous to TRPM channels Sabrina Mindthoff, Silke Grunau, Laura L. Steinfort, Wolfgang Girzalsky, J. Kalervo Hiltunen, Ralf Erdmann, Vasily D. Antonenkov PII: DOI: Reference:

S0167-4889(15)00397-3 doi: 10.1016/j.bbamcr.2015.11.013 BBAMCR 17724

To appear in:

BBA - Molecular Cell Research

Received date: Revised date: Accepted date:

22 July 2015 16 October 2015 16 November 2015

Please cite this article as: Sabrina Mindthoff, Silke Grunau, Laura L. Steinfort, Wolfgang Girzalsky, J. Kalervo Hiltunen, Ralf Erdmann, Vasily D. Antonenkov, Peroxisomal Pex11 is a pore-forming protein homologous to TRPM channels, BBA - Molecular Cell Research (2015), doi: 10.1016/j.bbamcr.2015.11.013

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT 1

PT

Peroxisomal Pex11 is a pore-forming protein homologous to TRPM channels

Institut für Biochemie und Pathobiochemie, Abt. Systembiochemie, Ruhr-Universität, Bochum, Germany

b

These authors contributed equally to this work

TE

*

D

MA

c

Faculty of Biochemistry and Molecular Medicine and Biocenter Oulu, University of Oulu, Oulu, Finland

NU

a

SC

RI

Sabrina Mindthoffa,c, Silke Grunaub,c, Laura L. Steinforta,c, Wolfgang Girzalskya, J. Kalervo Hiltunenb, Ralf Erdmanna,* and Vasily D. Antonenkovb,*

Correspondence should be addressed to:

AC CE P

Dr. Vasily Antonenkov (author to communicate) Faculty of Biochemistry and Molecular Medicine, Biocenter Oulu, University of Oulu, P.O. Box 3000, FI-90014 Oulu, Finland, Tel. +358 40 512 3964; Fax +358 8 531 5037 E-mail: [email protected] Dr. Ralf Erdmann

Institut für Biochemie und Pathobiochemie, Abt. Systembiochemie, Ruhr-Universität Bochum, D-44780 Bochum, Germany, Tel. +49 234 322 4943; Fax +49 234 321 4266 E-mail: [email protected]

ACCEPTED MANUSCRIPT 2

Abstract

PT

More than thirty proteins (Pex proteins) are known to participate in the biogenesis of peroxisomes – ubiquitous oxidative organelles involved in lipid and ROS metabolism. The Pex11 family of homologous proteins is

RI

responsible for division and proliferation of peroxisomes. We show that yeast Pex11 is a pore-forming protein sharing sequence similarity with TRPM cation-selective channels. The Pex11 channel with a conductance of Λ=4.1

SC

nS in 1.0 M KCl is moderately cation-selective (PK+/PCl-=1.85) and resistant to voltage-dependent closing. The estimated size of the channel’s pore (r~0.6 nm) supports the notion that Pex11 conducts solutes with molecular mass below 300-400 Da. We localized the channel’s selectivity filter. Overexpression of Pex11 resulted in acceleration of

NU

fatty acids β-oxidation in intact cells but not in the corresponding lysates. The β-oxidation was affected in cells by expression of the Pex11 protein carrying point mutations in the selectivity filter. These data suggest that the Pex11-

MA

dependent transmembrane traffic of metabolites may be a rate-limiting step in the β-oxidation of fatty acids. This conclusion was corroborated by analysis of the rate of β-oxidation in yeast strains expressing Pex11 with mutations mimicking constitutively phosphorylated (S165D, S167D) or unphosphorylated (S165A, S167A) protein. The

D

results suggest that phosphorylation of Pex11 is a mechanism that can control the peroxisomal β-oxidation rate.

TE

Our results disclose an unexpected function of Pex11 as a non-selective channel responsible for transfer of metabolites across peroxisomal membrane. The data indicate that peroxins may be involved in peroxisomal

AC CE P

metabolic processes in addition to their role in peroxisome biogenesis.

Keywords: membrane channels/β-oxidation/peroxisomes/protein phosphorylation/TRP channels

Highlights 

Yeast peroxisomal Pex11 protein is a non-selective channel.



Pex11 shares sequence similarity with TRPM channels.



β-Oxidation in intact cells is modulated by Pex11.



Phosphorylation of Pex11 may regulate peroxisomal β-oxidation.

ACCEPTED MANUSCRIPT 3

1. Introduction Peroxisomes are ubiquitous oxidative organelles of eukaryotic cells. These organelles are surrounded by a single membrane and they contain several dozen enzymes, including many involved in lipid metabolism [1]. Cells can

PT

adapt the number and enzyme composition of peroxisomes to the cellular needs and members of the Pex11 protein family are considered as key players in proliferation of peroxisomes and regulation of peroxisomes abundance in all

RI

eukaryotic organisms studied [2]. Peroxisomes proliferate by growth and division of pre-existing organelles, but they can also form de novo from the endoplasmic reticulum via a maturation process [3]. However, the extent to

SC

which this processes contribute to peroxisome formation differs among species. In yeast, peroxisomes are predominantly formed by fission of pre-existing organelles [4], whereas in mammalian cells both processes are

NU

supposed to operate simultaneously [5]. In the yeast Saccharomyces cerevisiae (S.cerevisiae) Pex11 and its homologues Pex25 and Pex27 comprise the Pex11 protein family [6]. Whereas Pex11 plays a clearly defined role in peroxisome proliferation by growth and division, the function of Pex25 and Pex27 is less understood. Pex25 is

MA

known to interact with the GTPase Rho1 [7] and Pex27 has been implicated in regulating size and number of peroxisomes [8].

D

In mammals, three homologous isoforms of Pex11 exist – Pex11α, Pex11β, and Pex11γ [9-12]. A significant homology was detected between yeast Pex11 and all three mammalian Pex11 isoforms, while no mammalian

TE

orthologoes are known for Pex25 and Pex27 [13]. The mammalian Pex11β is expressed constitutively throughout tissues and induces proliferation of peroxisomes. The tissue-specific Pex11α is inducible and triggers peroxisome

AC CE P

proliferation to a lesser extent than Pex11β [11]. A knock-out of Pex11α in mice has no striking phenotype, whereas a knock-out of Pex11β is lethal [12,14,15]. Recently, the first patient with a defect of peroxisome proliferation due to mutation in the PEX11β gene was identified, which was presented with congenital cataract, mild intellectual disability, progressive hearing loss, and sensory nerve involvement [16]. The functional role of the constitutively expressed and tissue-specific Pex11γ in peroxisomal biogenesis still has to be elucidated [17]. Deletion of yeast Pex11 results in few ‘giant’ peroxisomes and inability of cells to grow on fatty acids, while an overexpression of the protein not only leads to an elevated amount of small peroxisomes but also promotes elongation of peroxisomal membrane [18,19]. It is thought that Pex11β accumulates at one specific site of the peroxisomal membrane [19] that leads to curvature of the membrane induced by a Pex11 N-terminal amphipatic helix [20]. Tubular structures are formed by Pex11-dependent recruitment of phospholipids and membrane proteins including the import machinery. Finally, a daughter organelle emerges from constricted areas and by recruitment and function of dynamin like proteins (DLPs), like Vps1 and Dnm1 in yeast and DLP1 in human, the fission is completed [19,21,22]. The prominent role of Pex11 in peroxisomal proliferation is out of question [2-4,13] but important additional functions of the Pex11 family members may be underestimated. Indeed, deletion of the yeast Pex11 affects βoxidation of fatty acids that can be attributed to abnormalities in metabolites transport across the peroxisomal membrane [23].

ACCEPTED MANUSCRIPT 4 The mechanistic role of the peroxisomal membrane in metabolite transfer has emerged only recently [24]. The membrane contains an unusual combination of transporters specific for hydrophobic lipids (ABC transporters) and for some ‘bulky’ solutes such as ATP (ATP carrier) and cofactors (NAD/FAD/CoA carrier) side by side with nonselective channels conducting solutes with molecular mass below 300-400 Da. Several channel-forming activities

PT

have been described in the peroxisomal membrane from different species by means of electrophysiological techniques [24]. One of these activities has been attributed to mammalian Pxmp2 protein [25]. However, knock-out

RI

of this protein in mice showed only a minor phenotype, indicating that peroxisomes apparently contain other channels beside Pxmp2 [25,26]. Pxmp2 belongs to a small family of integral membrane proteins comprising four

SC

members – Pxmp2, MPV17, MP-L, and FKSG24 (MPV17L2) – in mammals, and two members – Sym1 and Yor292 – in the yeast S. cerevisiae cells (see ref. [27] for details). Surprisingly, the only member of the Pxmp2

NU

family of homologous proteins, the Pxmp2 protein itself, was detected in the peroxisomal membrane [28,29]. All other mammalian members of this family were localized in the inner mitochondrial membrane [30-32]. The mitochondrial localization was shown also for the yeast Sym1 protein [33], while intracellular localization of the

MA

Yor292c gene product is not known. At least several members of the Pxmp2 protein family – Pxmp2 [25], MPV17 [27], and Sym1 [34] – form membrane channels. However, it seems that the function of these channels is quite different in peroxisomes and in mitochondria [25,27,34]. Likewise, genome of some species, e.g. Trypanosoma

D

brucei, does not contain genes coding for proteins homologous to Pxmp2 although the channel-forming activities

TE

were detected in peroxisomes isolated from these organisms [35]. All together, these data suggest that the peroxisomal membrane from different species may contain channel proteins unrelated to the Pxmp2 protein family.

AC CE P

We report here that yeast Pex11 forms a non-selective membrane channel and that it shows sequence similarity to transient receptor potential (TRP) cation-selective channels [36,37]. In vivo detection of the rate of β-oxidation revealed an involvement of the Pex11 channel in transmembrane transfer of metabolites and in regulation of peroxisomal metabolic processes. The data show that Pex11 is a multi-purpose protein performing distinct functions in peroxisome biogenesis and metabolism.

ACCEPTED MANUSCRIPT 5

2. Materials and methods 2.1. Yeast strains and growth conditions

PT

The S. cerevisiae strain UTL-7A (MATa, ura3-52, trp1, leu2-3/112) was used as wild-type strain for the generation of several isogenic deletion strains by the ‘short flanking homology’ method [38]. The resulting deletion strains

RI

were pex3Δ [39] and pex11Δ [6]. Standard media for the cultivation of yeast strains were prepared as described [40]. YNO medium contained 0.1% (v/v) oleic acid, 0.05% (w/v) Tween 40, 0.1% (w/v) yeast extract and 0.67% (w/v)

SC

yeast nitrogen base without amino acids, adjusted to pH 6.0. Medium with 0.005% (w/v) lauric acid as sole carbon source contained 0.2% (v/v) Tween 40, 0.3% (w/v) yeast extract, 0.5% (w/v) peptone and 10 mM potassium-

NU

phosphate buffer, pH 6.0. When necessary the auxotrophic requirements were added [41].

MA

2.2. Plasmids and cloning strategies

For expression of Pex11 from S. cerevisiae fused to C-terminal hexahistidyl-(His6)-tag, the PEX11-coding region was amplified by PCR with primers RE808 (sense) 5`-TTAAGAATTCATGGTCTGTGATACACTGG-3` and (antisense)

5`-TTAAGTCGACCTAGTGATGGTGATGGTGATGTGTAGCTTTCCACATG-3`

and

D

RE809

genomic DNA as template. The PCR product was cloned as an EcoRI–SalI fragment into the yeast expression vector

TE

pRSFOXpterm [6], harboring the oleic acid-inducible FOX3 promoter (pMSC1). Amino-acid substitutions D170K/E171K/E173K/D174K in Pex11-His were generated by use of the ‘Quick Change mutagenesis kit’ (Agilent

AC CE P

Technologies) combined with pMSC1 as template and primers: RE2804 (sense) 5’-GTCAAGGCAAAATCACAA AGCCAAGGCAAGAAGCATAAGAAGCACAAGAAGGTACTAGGGAAGGCATAC-3’)

and

RE2805

(antisense) 5’-GTATGCCTTCCCTAGTACCTTCTGTGCTTCTTATGCTTCTTGCCTTGGCTTTGTGATTTTGC CTTGAC-3’ for the reaction. The same strategy was applied to create the phosphomimetic point mutations using ‘Quick Change II mutagenesis kit’ (Stratagene) combined with pMSC1 as template and primers for amino-acid substitutions S165A/S167A: RE3810 (sense) 5‘-GCGTTTGTCAAGGCAAAAGCACAAGCCCAAGGCGATGA GCATGAG-3’ and RE3811 (antisense) 5‘-CTCATGCTCATCGCCTTGGGCTTGTGCTTTTGCCTTGACAAAC GC-3’ and for amino-acid substitutions S165D/S167D: RE4091 (sense) 5’-GCGTTTGTCAAGGCAAAAGAC CAAGACCAAGGCGATGAGCATGAG-3’ and RE4092 (antisense) 5‘-CTCATGCTCATCGCCTTGGTCTTG GTCTTTTGCCTTGACAAACGC-3’. 2.3. In silico analysis Blast

search

for

homologous

protein

sequences

was

carried

out

using

the

ExPASy

server

(http://web.expasy.org/blast). Multiple sequence alignments of protein sequences were prepared using ClustalW (http://www.ch.embnet.org/software/ClustalW.html). The consensus sequence was constructed using a WebLogo application (http://weblogo.berkeley.edu). Four secondary structure prediction programs available on the ExPASy server (http://www.expasy.org/old_tools): PROF (http://www.aber.ac.uk/~phiwww/prof/), GORIV (http://npsapbil.ibcp.fr/cgi-bin_automat.pl?page=npsa_gor4),

Jpred3

(http://www.compbio.dundee.ac.uk/www-jpred),

and

ACCEPTED MANUSCRIPT 6 APSSP (http://imtech.res.in/raghava/apssp/) were used. The α-helixes predicted by at least 3 out of 4 applied programs and long enough to penetrate membrane lipid bilayer (18 amino acids) were chosen for further analyses. Transmembrane

segments

of

the

sequences

were

predicted

using

HMMTOP

program

(http://www.enzim.hu/hmmtop/) and hydropathy plot was calculated according to Kyte and Doolittle

PT

(http://web.expasy.org/cgi-bin/protscale/). The hydrophobic moment of the whole sequence of yeast Pex11 was calculated using the EMBOSS server (http://mobyle.pasteur.fr/cgi-bin/portal.py?form=hmoment). The helical wheel of

the

Pex11

α-helical

segments

were

performed

RI

representations

using

Java

Applet

using UCSF Chimers software.

NU

2.4. Subcellular fractionation and isolation of peroxisomes

SC

(http://cti.itc.virginia.edu/~cmg/Demo/wheel/wheelApp.html). 3D models of the Pex11 α-helix were constructed

Yeast cells were grown on medium containing oleic acid, harvested, and treated to obtain spheroplasts as described

MA

previously [40]. After gentle homogenization, cell lysates were subjected to differential centrifugation. Highly purified peroxisomes were obtained by density gradient centrifugation of the light mitochondrial fraction in a preformed linear 2.25-24% (w/v) Optiprep (Iodixanol; Axis-shield PoC AS) gradient [42]. The resulting fractions

D

were analyzed using markers for different organelles to assess purity of peroxisomal preparations. Activity of

TE

marker enzymes was measured as described [42]. 2.5. Fluorescence and electron microscopy

AC CE P

Fluorescence microscopy of live cells transformed with plasmid pGFP-SKL as a fluorescent peroxisome reporter was performed using yeast strains grown on oleic acid [43]. For transmission electron microscopy, intact yeast cells were fixed with 1.5% (w/v) KMnO4 and prepared as described [40]. 2.6. Fatty acids β-oxidation assay in intact cells and cell lysates The β-oxidation assay was essentially performed as described [23,44]. To measure the rate of β-oxidation of fatty acids in intact cells, oleic acid grown cells were sedimented, washed with water and resuspended in phosphatebuffered saline (PBS) to an OD600=1.5 units. [1-14C] Oleic (55.4 mCi/mmol), [1-14C] lauric (53 mCi/mmol) or [114

C] octanoic (57 mC/mmol) acids (Moravek Biochemicals) were used as substrates. An aliquot of 80 μl of cell

suspension was mixed with 320 μl of PBS containing 5.0 nmol of radiolabeled fatty acid. After incubation for 20 min at 30oC, 0.3 ml of cold PBS and 0.3 ml of 3.0 M perchloric acid were added and the mixture was kept on ice for 30 min. After centrifugation at 14000 rpm for 10 min, 600 μl of supernatants were recovered and unreacted fatty acids were extracted by treatment four times with 3.0 ml hexane. 400 μl of the aqueous layer was used to quantify the acid-soluble radioactivity in a liquid scintillation counter. In preliminary experiments the reactions were followed over time and a linear dependence between the duration of incubation and the level of β-oxidation was shown. The linear dependence was also detected between the β-oxidation rate and the amount of protein in the sample. The β-oxidation rates in wild-type cells were taken as a reference (100%). The absolute amount of

14

C-

ACCEPTED MANUSCRIPT 7 labeled acid-soluble products of oleic, lauric, and octanoic acid oxidation in the wild-type strain (mean values) was 220, 350 and 140 pmol/min/OD600, respectively. Each experiment was performed at least three times. Fatty acids βoxidation was also measured in cell-free lysates prepared by lysing spheroplasts. An assay medium contained 150 mM Tris-Cl, pH 8.5, 5.0 mM ATP, 5.0 mM MgCl 2, 50 μM FAD, 1.0 mM NAD+, 0.5 mM NADPH, 0.5 mM CoA,

PT

0.01% (w/v) Triton X-100, 0.5 U/ml acyl-CoA synthetase (Sigma-Aldrich) and 12 μM radioactive fatty acid. The mean values of the 14C-labelled products of oleic, lauric and octanoic acids β-oxidation in lysates of the wild-type

SC

2.7. Production and purification of recombinant yeast Pex11

RI

cells were 7.2, 2.8 and 2.1 nmol/min/mg protein, respectively.

A single colony of yeast cells expressing recombinant Pex11 was grown overnight at 30 oC in 2 ml of YNBG

NU

medium, the resulting culture was inoculated to 50 ml of the same medium and cultivated at 30 oC to OD600=10 units. After sedimentation, cells were resuspended to OD600=1.0 unit in 500 ml of YNBGO medium and grown at 30oC for

MA

24 h. The cells were harvested by centrifugation and mechanically disrupted using glass beads. The resulting mesh was centrifuged at 1500 g (Eppendorf A-4-81) for 10 min to remove glass beads and cell debris. Subsequently, the membrane fragments were sedimented by centrifugation at 100000 g (Sorvall T-647.5) for 1.0 h. The sediment was

D

resuspended in a small volume of lysis buffer [300 mM NaCl, 10% (v/v) glycerol, 50 mM sodium phosphate, pH=7.5] containing protease inhibitors, homogenized, and protein concentration was adjusted to 10 mg/ml.

TE

Membrane proteins were solubilized using 0.5% (w/v) Fos-cholin-10 for 2.0 h at 4oC. Insoluble material was sedimented, the resulting supernatant was applied to an Ni-NTA superflow cartridge (Qiagen). After washing of the

AC CE P

column with buffer [300 mM NaCl, 10% (v/v) glycerol, 10 mM imidazole, 50 mM sodium phosphate, pH=7.5] containing 0.1% (w/v) Fos-cholin-10 the proteins were eluted using a gradient of 10-500 mM imidazole. After analysis of protein composition of the eluted fractions by SDS-PAGE, the samples containing Pex11 were combined, concentrated and subjected to size-exclusion chromatography using Superose 12 column (GE Healthcare). The elution buffer was: 100 mM NaCl, 10% (v/v) glycerol, 50 mM sodium phosphate, pH=7.5 containing 0.1% (w/v) Fos-cholin-10.

2.8. Analysis of the oligomeric structure of yeast Pex11 To analyze the oligomer state of the purified Pex11 protein we used the Wyatt MiniDawn static light scattering detector connected to the ÄCTA purification unit. With this method the absolute molecular mass is detected without the calibration of the size-exclusion column. Blue-native PAGE electrophoresis was carried out using linear 5%17% (w/v) polyacrylamide-gradient gels which were formed with a 4% (w/v) overlay. Samples containing purified Pex11 were supplemented with a tenfold concentrated loading dye [5% (w/v) Coomassie brilliant blue, 500 mM 6amino-n-caproic acid and 100 mM Tris-Cl, pH 7.0]. The electrophoresis was started at 35 mV for 1h and continued for 4 h at 200 mV at room temperature. Cross-linking of purified Pex11 was performed according to instructions from manufacturer (Pierce). The aliquots of samples containing Pex11 (~ 0.1 mg/ml) were incubated with 0.2 mM ethylene glycolbis (sulfosuccinimidylsuccinate) at different concentrations for 30 min at room temperature and then subjected to SDS-PAGE followed immunoblot analysis using anti-His-tag antibodies.

ACCEPTED MANUSCRIPT 8 2.9. SDS-PAGE and Western blotting SDS-PAGE was run using 10% (w/v) polyacrilamide gels. The gels were stained using Coomassie blue or silver nitrate. After Western blotting, the immunodetection was performed with anti-rabbit-IgG IRDye800CW or anti-

PT

mouse-IgG IRDye800CW as secondary antibodies using the Odyssey infrared imaging system (Li-Cor Biosciences). Polyclonal rabbit antibodies were raised against S.cerevisiae Pex11 and for marker proteins of subcellular organelles

SC

yeast mitochondrial VDAC1/Porin (ab110326) were from Abcam.

RI

[42,45]. Monoclonal anti-His-tag antibodies (αHis5) were from Qiagen and mouse monoclonal antibodies against

2.10. Mass spectrometry and circular dichroism (CD) analysis

NU

The identity of purified recombinant Pex11 was confirmed using matrix-assisted laser desorption ionization time-offlight mass spectrometric analysis. The samples were subjected to SDS-PAGE and gel was stained with Coomassie R-350. The protein appeared as a single band was eluted from the gel and the resulting sample was applied to a

MA

Voyager DE PRO spectrometer (Applied Biosystems). The CD spectra (190-250 nm) were recorded on a Jasco J715 spectro-polarimeter using a 2-mm cuvette containing Pex11 (0.1 mg/ml) in 10 mM potassium phosphate buffer

D

(pH 6.8) and 0.1% (w/v) Foc-choline-10. CD data presented are the averages from four separate measurements.

TE

2.11. Detection and analysis of channel-forming activity Multiple channel recording (MCR) and single channel analysis (SCA) were conducted as described in our previous

AC CE P

publications [25,27] using Planar Lipid Bilayer Workstation equipped with a BC-535 amplifier and 8-pole low-pass Bessel filter (Warner Instruments). Acquisition and analysis were performed using the pCLAMP software (Axon Instruments). Due to relatively large area of a planar lipid bilayer used in the MCR setting, this procedure allows detection of dozens insertion events in the same membrane preparation over a limited period of time (minutes). However, MCR is less sensitive than SCA and do not allow a high time resolution of the recordings. MCR was exploited to detect a large number of insertion events aiming to reveal optimal conditions for measurements and quantify mean current amplitudes of the channels using histograms of insertion frequency (bin size 2.0 pA). Detailed analysis of the properties of Pex11 channel was performed using SCA that allows electrophysiological characterization at high-time resolution of a single channel molecule. In both cases (MCR and SCA settings) purified Pex11 was dissolved in 0.5% (w/v) Genapol X-080 (Fluka) and an aliquot of the sample (2-5 μl, the total amount of protein was less than 10 μg) was added to the trans compartment of the chamber. The compartments (4.0 ml each) were connected with a pair of Ag/AgCl electrodes via 3.0 M KCl-agar bridges and equipped with magnetic stirrers. The membrane proteins were solubilized from purified peroxisomes using 0.5% (v/v) Genapol X-080 and immediately used for measurement of the channel-forming activity. Frequency of insertion events was low at electrolyte content less than 0.5 M KCl and steadily increased with an elevation of salt concentration. This apparently reflects the hydrophobic nature of the isolated Pex11. Increase in concentration of charged solutes like KCl may force the Pex11 protein to escape into the hydrophobic environment of membrane lipid bilayer. Therefore, most measurements were made at high electrolyte concentrations (usually 1.0 M - 3.0 M KCl). If not mentioned

ACCEPTED MANUSCRIPT 9 otherwise, the electrolyte was buffered with 10 mM Tris-Cl, pH 7.2 and contained 5.0 mM DTT. Single channel conductance as a function of electrolyte concentration was measured after detection of a single channel insertion at 3.0 M KCl, than the electrolyte was diluted with buffer to reach lower KCl concentrations. Detection of reversal potentials was carried out by establishing a two-fold (1.0 M KCl trans/0.5 M KCl cis compartment) salt gradient

PT

after formation of a stable lipid bilayer and insertion of a single channel. The current was initially measured at zero holding potential followed by stepwise application of different voltages or by using voltage-ramp protocol. Voltage-

RI

dependent gating of the channel was analyzed at different holding potentials by mean currents calculation for a period of time 40 sec. Data (open probability – Popen) were normalized to the currents detected for the fully open

SC

states at the corresponding holding potentials. Estimation of the pore diameter of Pex11 channel was done using polymer-exclusion method (see ref. [25,27] for more details). The average conductance was calculated from 30-40

NU

single insertion events registered using SCA. The data are presented as ratio of the channel conductance without (G0) and with (G) non-electrolyte plotted against hydrated radii of non-electrolytes: ethylene glycol, 0.26 nm; glycerol, 0.31 nm; arabinose, 0.34 nm; PEG200, 0.43 nm; PEG300, 0.60 nm; PEG400, 0.70 nm; PEG600, 0.78 nm;

MA

PEG1000, 0.94 nm; PEG2000, 1.22 nm; PEG3400, 1.63 nm. The bath solution contained symmetrical 3.0 M KCl and 20% (w/v, final concentration) non-electrolyte. The holding potential was +5.0 mV.

D

2.12. Statistical analysis

TE

All quantitative data are expressed as mean ± standard deviation (SD). The data were analyzed by two-tailed

AC CE P

Student’s t test and P-values less than 0.05 were considered significant.

ACCEPTED MANUSCRIPT 10

3. Results Routine Blast search using amino acid sequences of the Pex11 proteins from different species as a query persistently revealed the similarity of these proteins to members of transient receptor potential (TRP) ion channel family

PT

comprising melastatin subfamily (TRPM). The closest similarity was observed between mouse proteins – Pex11α and TRPM8 (Fig. S1A). The region of similarity covers more than 40% of the total Pex11α sequence (Fig. 1A and

RI

Fig. S1B) and is located right in the core of the channel-forming domain of TRPM8 protein (Fig. 1A and Fig. S1C). Using homologous sequences of mouse Pex11α and TRPM8 proteins as a query we first searched for corresponding

SC

sequences within Pex11 and TRPM family members and then conducted multiple alignments of the recovered sequences. The result revealed a region of similarity that is conserved throughout both families (Fig. 1B and Fig.

NU

S2A). This in turn predicted that Pex11 proteins might also possess channel function. We decided to study an apparent channel-forming activity of yeast S. cerevisiae Pex11 because it is abundantly present in peroxisomal membranes, its deletion affects growth of yeast cells on oleic acid [18,46] and it has been implicated with a role in

MA

peroxisomal β-oxidation and metabolite transport [23]. Therefore, as a first step, we inspected the sequence of yeast Pex11 for the presence of features supporting its channel-like properties. If the channel’s pore is formed by αhelixes, they should be: (I) amphipathic and (II) long enough to penetrate the membrane lipid bilayer (minimum 18

D

amino acids long) [47]. We identified in the sequence of Pex11 six α-helical motifs with no less than 18 residues

TE

(Fig. S2B). Analysis of the hydrophobic moment of the full-length Pex11 revealed several regions with amphipathic properties (Fig. S2C). These regions mostly coincided with the location of predicted α-helixes. Helical wheel (Fig.

them.

AC CE P

S3A) and 3D surface (Fig. S3B) representations of the α-helixes confirmed an amphipathic nature for several of

To investigate whether Pex11 is indeed a membrane channel, the recombinant protein was isolated from the S.cerevisiae crude membrane fraction. The protein appeared as a single band on SDS-PAGE gels stained with Coomassie (Fig. 1C and Fig. S4A) or silver (Fig. S4B), indicating that purification was to apparent homogeneity. Western blot analysis did not reveal any admixture of the purified preparations of Pex11 protein by mitochondrial voltage-dependent anion channel (VDAC) (Fig. S4C). The authenticity of the Pex11 was confirmed by mass spectrometry. A circular dichroism (CD) recording revealed a typical alpha-helical spectrum (Fig. 1D). Channel-forming activity of isolated Pex11 was studied using planar lipid bilayer technique. We first applied multiple channel recording (MCR) and detected characteristic stepwise increase in current (Fig. 1E), indicating that Pex11 indeed forms channels. In the histogram of insertion events (Fig. 1F), the dominant peak of activity with an average conductance of 9.6 nS (symmetrical 3.0 M KCl as an electrolyte) was observed. UV absorbance monitoring during size-exclusion chromatography of the isolated Pex11 detected several protein forms with different mobility in the column (Fig. 2A). The relative abundance of these forms varied depending on the batch of purified Pex11 (data not shown). Treatments of the samples by mild sonication (data not shown) or storage of them at +4oC were accompanied by redistribution of the protein forms in favor of the lower molecular mass compounds (blue line on Fig. 2A). Static light scattering analysis revealed that the molecular masses of the

ACCEPTED MANUSCRIPT 11 detected Pex11 forms are 28 kDa (absorbance peak 3 on Fig. 2A), 60 kDa (peak 2), and 120 kDa (peak 1), respectively. These data were confirmed using cross-linking experiments (Fig. 2B). The results indicate that purified Pex11 represents a mixture of monomers, homodimers, and homotetramers and that subunits of oligomeric structures are only loosely associated. On histograms of insertion events registered by MCR of the samples

PT

containing predominantly dimer and monomer forms of Pex11 (marked on Fig. 2A as A and B, respectively) only low-conductance sublevels were resolved with an average conductance of 2.0 nS and 4.8 nS (3.0 M KCl as an

RI

electrolyte, Fig. 2C). This result supports the notion that each subunit of the Pex11 oligomer forms its own pore in

SC

the membrane.

To explain the role for Pex11 in elongation of peroxisomes, one can expect formation of a network of Pex11

NU

oligomers in the areas of peroxisomal membrane protrusion [19,48]. Therefore, we tried to establish whether or not the Pex11 protein is assembled in large oligomeric complexes. Size-exclusion chromatography of recombinant Pex11 solubilized from purified peroxisomal fraction using Fos-cholin-10 revealed mainly tetrameric forms (data

MA

not shown). However, during isolation of Pex11 using mild detergent Genapol X-080 instead of Fos-cholin-10 we noticed a mobility shift (lower retention time) of the purified protein (Fig. 2D) that might indicate an existence of protein complexes or formation of large protein-detergent micelles. Blue-native electrophoresis of the Pex11

D

samples isolated using Genapol X-080 revealed only traces of polymeric complexes while bulk of the protein was recovered as homodimeric and homotetrameric forms (Fig. 2E). MCR corroborated this observation showing the

TE

main conductance levels characteristic for mono-, di-, and tetrameric forms of the channel – in average, 10%, 15%, and 80% of the total amount of insertion events, respectively (data not shown). Nevertheless, in rare cases (less than

AC CE P

1% of the total amount of insertion events) highly unstable super-large conductance activities showing multiple subconductance states were registered (Fig. 2F,G). Apparently, this reflects an insertion of a cluster of Pex11 channels showing cooperative gating of monomers. This observation may indicate that Pex11 is able to form planar polymeric structures where each monomer is still active as a channel. Using single-channel analysis (SCA), we found that the channel conductance depended on electrolyte concentration (Fig. 3G). Application of the voltage-step (Fig. 3B) and voltage-ramp (Fig. 3C) protocols revealed near-linear dependence of the channel current on holding potential. An average slope conductance of Λ=4.1±0.2 nS, n=9 (in symmetrical 1.0 M KCl) was calculated (Fig. 3D). The channel was resistant to voltage-dependent closing in the range of holding potentials ±120 mV (Fig. 3E). In asymmetric electrolyte solutions (trans/cis 1.0:0.5 M KCl), a reversal potential of Erev=6.0 mV was obtained (Fig. 3F) that corresponds to a selectivity PK+/PCl-~1.85. Therefore, the channel is slightly cation-selective. To estimate the size of the channel’s pore, we used the polymer exclusion method and determined a diameter of vestibule of D~1.6 nm and a diameter of a constriction zone (the narrowest part of the pore) of D~1.2 nm (Fig. 3G). Next, we investigated highly purified preparations of solubilized peroxisomal membranes from wild-type yeast cells and detected a channel-forming activity with near identical properties as the isolated recombinant Pex11 protein (Fig. 4A). The activity was characterized by mean slope conductance Λ=3.9±0.4 nS in 1.0 M KCl, weak cation selectivity (PK+/PCl- ratio~1.80) and resistance to voltage-dependent closing. Comparative MCR showed that the

ACCEPTED MANUSCRIPT 12 peak of high-conductance insertion events is clearly detectable with protein preparations from wild-type peroxisomes (Fig. 4B, upper panel) but is missing when Pex11-deficient particles were analyzed (Fig. 4B, lower panel). This activity is attributed to native Pex11 since it displays a similar mean conductance as the recombinant

PT

protein and is missing in peroxisomes from pex11Δ strain. Selectivity determining sequence is responsible for key properties of the membrane channel. It is located in the

RI

narrowest part of the channel’s pore and usually is highly hydrophilic, contains one or few charged amino acids and hence determinates ion-selectivity of the channel. The region of similarity between TRPM8 and Pex11 proteins

SC

includes a short amino acid segment at its C-terminal end (Fig. 1A and Fig. S1C) predicted as the TRPM8 ion selectivity determining sequence [49]. We considered that the Pex11 selectivity sequence might be similar to that of

NU

TRPM channels. To test this, we used mouse Pex11α sequence covering the region corresponding to the TRPM8 selectivity determining sequence (see Fig. S1B) as a query to detect similar sequences within members of the Pex11 family. Next, the recovered sequences were aligned with known amino acid segments apparently comprising ion

MA

selectivity sequences for TRPM channels (Fig. 4C). The resulting alignment showed candidate amino acids forming core of the yeast Pex11 selectivity sequence: Asp170, Glu171, Asp173, and Glu174. As expected for the ion selectivity determining sequence, these amino acids are located in highly hydrophilic region of the protein (Fig. S3C).

D

To verify our in silico prediction, we substituted the negatively charged amino acids of the apparent selectivity

TE

determining sequence by positively charged lysines (Fig. 4D), aiming to reverse ion selectivity of the channel. Indeed, the isolated mutant variant (Pex11-His4K) showed evident anion selectivity: PK+/PCl-~0.17 (Fig. 4E and Fig.

AC CE P

S5A). Beside the change in ion selectivity, the properties of the Pex11-His4K channel were similar to that of the wild-type channel (Fig. S5B-F). Intriguingly, peroxisomes were enlarged in the Pex11-His4K mutant that was shown by fluorescence microscopy (Fig. S6A). However, transmission electron microscopy revealed extensive clustering of peroxisomes in the Pex11-His4K cells that may contribute to the appearance of enlarged peroxisomal images under fluorescence microscopy (Fig. S6B). Likewise, the change in ion selectivity affected growth of the mutant strain on fatty acids as a sole carbon source. The growth on medium-chain lauric acid was completely blocked (Fig. S7). This may be due to the high toxicity of lauric acid that apparently aggravates the cells response to disturbances in peroxisomal metabolism. To reveal the role of Pex11 channel in peroxisomal metabolism in vivo, we analyzed the rate of fatty acids βoxidation in the intact yeast cells and in the corresponding lysates. This well-established procedure has been widely used to study permeability properties of peroxisomal membrane in vivo [23,44]. According to our prediction, manipulations of the content of Pex11 channel in peroxisomal membrane (Fig. 5A) as well as the introduction of mutations modulating channel’s properties would affect the transmembrane transfer of metabolites required for fatty acids β-oxidation and ultimately result in activation or suppression of this pathway at in vivo conditions. Indeed, we found that the β-oxidation is blocked nearly completely in the intact pex11Δ cells (Fig. 5B) whereas it is not severely disrupted in the corresponding control cell lysates (Fig. S8A). These results are in line with the previous observations [23] and indicate that deletion of the Pex11 channel may prevent transfer of metabolites across the peroxisomal membrane. In contrast, overexpression of Pex11 effectively stimulates the rate of β-oxidation in intact

ACCEPTED MANUSCRIPT 13 cells (Fig. 5B). The rate of induction is much higher for long-chain oleic acid (C18:1) relative to medium chain lauric (C12:0) and octanoic (C8:0) acids. Of note, mutations in the selectivity determining sequence of Pex11 (Pex11-His4K) led to suppression of the β-oxidation in intact cells (Fig. 5B).

PT

Protein phosphorylation is a powerful posttranslational mechanism aimed in regulating the function of many membrane channels including members of the TRP family of cation channels homologous to Pex11 [50].

RI

Interestingly, yeast Pex11 undergoes reversible phosphorylation that was shown to be involved in modulation of peroxisomal division and abundance [51,52]. We noticed that the putative phosphorylation sites in the Pex11 (Ser165,

SC

Ser167) are localized in close vicinity to the channel’s ion selectivity determining sequence (Fig. 4D). This implies that properties of the Pex11 channel might be modulated by phosphorylation. Therefore, we generated yeast strains expressing constitutively phosphomimetic (Ser165,Ser167→Asp165,Asp167) and constitutively unphosphorylated

NU

(Ser165,Ser167→Ala165,Ala167) variants of Pex11. These strains were designated as Pex11-HisD and Pex11-HisA, respectively. Both purified mutant proteins showed channel-forming activity (Fig. S9A-E). Their conductance was

MA

comparable with wild-type Pex11 (Λ=4.0 nS and Λ=4.3 nS in 1.0 M KCl for Pex11-HisA and Pex11-HisD, respectively), suggesting similarity in the size of the channel’s pore. Strikingly, the mutation mimicking phosphorylation significantly affects ion-selectivity of the channel. The Pex11-HisD channel is substantially more

D

selective to cations relative to its unphorphorylated counterpart (Fig. S9D-F) showing the reversal potential of Εrev=+12.0 mV in asymmetric electrolyte solutions (trans/cis 1.0:0.5 M KCl) that corresponds to a selectivity

TE

PK+/PCl-~6.0. An evident shift in the ion selectivity after phosphorylation of the channel can be expected if one considers location of large, negatively charged phosphate groups just on the verge of the channel’s pore. Predictably,

AC CE P

the phosphate ions should attract positively charged solutes creating a local elevation in the concentration of cations near the channel’s pore. Surprisingly, the Pex11-HisD channel was prone to partial closing at different membrane potentials revealing transition between four sub-conductance states (Fig. S9C,E). These sub-conductance states may reflect an independent gating of four Pex11 channels in one homotetrameric structure of the protein (see above). Voltage-dependent gating of the Pex11 channel is however unlikely relevant to physiology of peroxisomes because according to common view supported by a large number of indirect evidences the membrane potential of these organelles (created mainly due to Donnan equilibrium) is quite low (see review [24] for details). Despite of the aberrant properties of the Pex11-HisD channel, we did not find a significant delay in the growth of the yeast strain containing this protein on oleic or lauric acids relative to the wild-type cells. Similarly, growth of the mutant strain containing Pex11-HisA was also unaffected (Fig. S7). The morphology of peroxisomes has been reported as underproliferated in the Pex11-HisA cells whereas the Pex11-HisD cells contained hyperdivided, small particles [51]. Introduction of phosphomimetic mutations into Pex11 protein did result in strong modulation of the rate of fatty acids β-oxidation in intact cells (Fig. 5B, right panel and Fig. S8B). The intensity of β-oxidation was increased significantly in the Pex11-HisA cells. In contrast, the rate of β-oxidation in the Pex11-HisD cells was much lower than in other strains carrying recombinant Pex11. All together, these data strongly suggest that the rate of peroxisomal β-oxidation is under regulatory control by phosphorylation of the Pex11 channel protein.

ACCEPTED MANUSCRIPT 14

4. Discussion A striking finding of our report is the sequence similarity between Pex11 and TRPM proteins that spreads onto the ion selectivity determining sites of these channels. This indicates common evolutional roots for both protein families

PT

which however serve very different functions in living cells. TRPM proteins belong to a large superfamily of TRP cation-selective channels conducting monovalent (K+/Na+) and/or divalent (Ca+2) cations. The TRP

RI

receptors/channels are predominantly localized in the plasma membrane and most of them involved in sensing of diverse physiological stimuli such as cold and warm, nociception, and osmotic pressure [36,37,49,53]. The pore

SC

region of the TRP channels is formed by four identical protein subunits [54,55] that is in contrast to the Pex11 protein that, according to our observations, is able to form channel as a monomer. The TRPM subfamily consists of

NU

eight members. They show low conductance that varied for different channels from 25 pS to 120 pS (the data were obtained using patch-clamp recordings) [56]. The conductance of the closest homolog to Pex11 proteins – TRPM8 channel is about 80 pS. Some of the TRPM channels including TRPM8 are able to conduct both, mono- and divalent

MA

cations (Na+, K+, Ca+2) while others are selective towards monovalent or divalent cations. TRPM8 and some other TRPM channels are characterized by reduced open probabilities at negative membrane potentials. Thermosensation is considered as a primary function of the TRPM8 channel [56]. In contrast to highly selective TRPM channels,

D

yeast Pex11, as shown in this report, is a non-selective channel, forming a large pore in the peroxisomal membrane

TE

with a size-exclusion limit of 300-400 Da. This indicates that Pex11 functions as a channel allowing transfer of any small solute with no strong preference for certain metabolites. However, it seems that the Pex11 channel, like its functional counterpart – the mammalian peroxisomal Pxmp2 channel [24,25], does not conduct ‘bulky’ solutes such

AC CE P

as ATP and cofactors (NAD/H, NADP/H, CoA and its acetylated derivatives) because dimensions of these molecules exceed size of the channel’s pore (for instance, the estimated dimensions of the hydrated ATP molecule is 1.85 x 0.45 nm [57]). The ‘bulky’ compounds cross the peroxisomal membrane with a help of specific transporters [58-63].

An intriguing question is if indeed the Pex11 channel forms large pores in the membrane, how can the yeast cells survive a massive overexpression of this protein? Recent data clearly support a view that the peroxisomal membrane is open to small solutes (see ‘Introduction’ section) and in this sense it is similar to the outer membranes of mitochondria and chloroplasts (for review, see ref. [24]). Therefore, an insertion into peroxisomal membrane of a large amount of pore-forming proteins like Pex11 may not have a large-scale detrimental effect on the cell physiology. Moreover, an overexpression of Pex11 leads to decrease in size and increase in number of yeast peroxisomes [18] that apparently results in an extension of a total area of peroxisomal membrane in the cell. Indeed, this may help to accommodate an increasing amount of the overexpressed Pex11 protein. A key function of yeast peroxisomes is the β-oxidation of fatty acids [1,60]. This enzymatic process occurs in the lumen of peroxisomes and degrades activated fatty acids (acyl-CoA’s) to acetyl-CoA as the main final product. Because the peroxisomal membrane is impermeable to acyl-CoA’s and acetyl-CoA [24,60], several transport mechanisms are required to conduct acyl- and acetyl- moieties in and out of peroxisomes. Apparently, import of

ACCEPTED MANUSCRIPT 15 very long-chain fatty acids into peroxisomal lumen is facilitated by ATP-binding cassette (ABC) transporters Pxa1/Pxa2 (Fig. 5C). These proteins may also be responsible for the transfer of at least part of long-chain fatty acids [60-63]. However, transmembrane transport mechanisms for medium- and short-chain fatty acids have not yet been described. In contrast, export of acetyl groups out of yeast peroxisomes was extensively studied [64-66]. It seems

PT

that two enzymatic systems: carnitine pathway leading to formation of acetyl(acyl)-carnitine and glyoxylate cycle incorporating acetyl group into citrate molecule are involved in release of the β-oxidation products from

RI

peroxisomes. However, how acetyl(acyl)-carnitines and citric acid cross the peroxisomal membrane is not known.

SC

Owing to formation of relatively large, water-filled pore in the membrane, the Pex11 channel apparently is able to transfer substrates and products of the β-oxidation with an exception of ‘bulky’ or highly hydrophobic compounds (see above). In addition, one can predict that the channel may be involved in shuttling molecules such as malate and

NU

oxaloacetate or isocitrate and 2-oxoglutarate to keep a proper redox state of intraperoxisomal NAD+ and NADP+, respectively. These cofactors are required for the β-oxidation of saturated and unsaturated fatty acids [24,60,67,68].

MA

To gain more insight into the role of Pex11 channel in peroxisomal metabolism, we analyzed the rate of β-oxidation in living cells and lysates of wild-type and mutant cells using long- (oleic acid, C18:1) and medium-chain (lauric acid, C12:0 and octanoic acid, C8:0) fatty acids as substrates. Our data revealed that the rate of β-oxidation in living

D

cells is tightly linked to the amount of Pex11 and is influenced by modifications of the channel’s properties caused

TE

by point mutations. Indeed, in accordance with observations by others [23], we registered a nearly total suppression of the oxidation of fatty acids upon deletion of Pex11, while overexpression of this protein led to a drastic increase

AC CE P

in the rate of β-oxidation. Moreover, our data showed that point mutations introduced into the selectivity determining sequence of the Pex11 channel (Pex11-His4K) and phosphomimicking mutations (Pex11-HisA and Pex11-HisD) all strongly affect the rate of β-oxidation in living cells. All together our data support a view that Pex11 is intimately involved not only in biogenesis of peroxisomes but that it also plays an important role in metabolic processes in these organelles including β-oxidation of fatty acids. Our results do not exclude the previously proposed possibility that the Pex11-dependent modulation of peroxisomal morphology may also have an effect on β-oxidation [69,70]. However, comparison of peroxisomal morphology of pex11Δ mutant cells with and without expression of Pex11-His4K and Pex11-HisA (Fig. S5A,B) with the rate of fatty acid β-oxidation (Fig. 5B) revealed no correlation of the morphological appearance of peroxisomes and their βoxidation capacity. Strong dependence of the rate of β-oxidation on abundance and genetic modifications of Pex11 in intact cells but not in cell lysates is a key argument that like under in vitro conditions, this protein may function as a channel in vivo facilitating transfer of solutes across peroxisomal membrane. Moreover, it is obvious that at least under conditions of our experiments the Pex11-dependent transmembrane transfer of peroxisomal metabolites is a rate-limiting step in the whole process of β-oxidation in yeast cells. Currently, we have no experimental data clarifying transfer of what particular compound(s) limits the rate of β-oxidation. These metabolites may be substrates or products of this pathway as well as molecules required for activation of fatty acids inside peroxisomes [71,72] or for functioning of

ACCEPTED MANUSCRIPT 16 peroxisomal shuttle systems [67,73]. However, because the rate of β-oxidation strongly depends on the length of fatty acids used in our measurements (all other parameters were the same) one can predict that the level of the Pex11-dependent transmembrane transfer of free fatty acids determinates an efficiency of the whole process of their oxidative degradation. In this respect, very strong relative to other fatty acids stimulation of the oleic acid β-

PT

oxidation by over-expression of Pex11 protein (see Fig. 5B, left panel) can be readily explained by physical limitations in the transfer of this bulky and curved molecule along the channel’s pore. Likewise, significant shift

RI

towards cation selectivity of the Pex11 channel due to mutations mimicking phosphorylation of this protein should strongly limit the transfer of negatively charged free fatty acids across peroxisomal membrane and hence block their

SC

β-oxidation (see Fig. 5B, right panel).

NU

Because the phosphorylation event apparently occurs outside peroxisomes (according to our preliminary proteomics data the matrix of peroxisomes do not contain phosphorylated proteins; Ohlmeier and Antonenkov, unpublished results), one can predict transmembrane topology of amino acids forming the ion selectivity determining sequence

MA

of the yeast Pex11 channel. Close proximity of amino acids constituting this sequence to the site of phosphorylation (see Fig. 4D) indicates that the N-terminal part of it is situated near the outside surface of peroxisomal membrane facing cytosol.

D

As a whole, our data allow to conclude that phosphorylation of the Pex11 channel is a powerful negative regulator

TE

of the β-oxidation in yeast cells and substantiate the prediction that the Pex11-dependent transmembrane transfer of metabolites across peroxisomal membrane is a rate-limiting step in the oxidative degradation of fatty acids.

AC CE P

Interestingly, our results are in line with a previous report on the role of multifunctional cyclin-dependent protein kinase Pho85 in phosphorylation of Pex11 [51]. Pho85 is targeted to its substrates by cyclins and it phosphorylates a large set of proteins involved in transcription and metabolic activities. An overall output of the Pho85-dependent phosphorylation is suppression of cellular processes required in response to unsatisfactory environmental conditions [74].

Our data are clear in that yeast Pex11 has the properties of a non-selective channel, which is supposed to account for the transfer of metabolites across the peroxisomal membrane. However, there is also no doubt that Pex11 is involved in the oleic acid-induced proliferation of peroxisomes. Moreover, it was reported recently that Pex11 physically interacts with mitochondrial Mdm34 and that it plays a role in linking peroxisomes and mitochondria through the ERMES complex [75]. One can expect that presence of the Pex11 channel in contact sites connecting peroxisomes and mitochondria may be beneficial for transfer of metabolites between these organelles. Obviously, the most intriguing remaining question related to Pex11 is how this protein affords such multiple roles in the cell – as a metabolite channel in peroxisomal membrane and as a factor required for proliferation of peroxisomes.

ACCEPTED MANUSCRIPT 17

Figure legends Fig. 1. Sequence similarity between TRPM and Pex11 proteins and properties of isolated yeast Pex11. (A) Schematic representation of the position of similar regions (red) in sequences of mouse TRPM8 and yeast

PT

S.cerevisiae Pex11. Receptor (black) and channel (transparent) domains, and selectivity filter (blue) in the TRPM8 protein are marked. (B) Sequence alignment of amino acid segments from TPRM (mouse) and Pex11 (mouse and

RI

yeast) proteins. Identical (red), similar (green) amino acids and identical or similar amino acids found in at least five out of eight aligned sequences (bold) are shown. The sequence of yeast Pex11 is shown in Italics. (C) Size-exclusion

SC

chromatography of recombinant Pex11 protein isolated using Fos-cholin-10 as detergent. Aliquots from fractions containing Pex11 were subjected to SDS-PAGE and gels were stained with Coomassie blue. Positions of the

NU

molecular mass markers are shown. (D) Analysis of the secondary structure of isolated Pex11 using CD spectroscopy. The absorbance curve, especially minima at 208 nm and 220 nm, are indicative for α-helical structure. (E) Current trace of a bilayer indicating insertion of multiple channels. The freshly isolated Pex11 protein was

MA

analyzed. Electrolyte was symmetrical 3.0 M KCl buffered with 10 mM Tris-Cl, pH 7.2 and containing 5 mM DTT. (F) Histogram of insertion events observed during MCR (see Fig. 1E). Bin size is 2.0 pA. The total number of

D

insertion events (I.e.) is indicated.

Fig. 2. Oligomeric structure of isolated recombinant Pex11. (A) Size-exclusion chromatography of Pex11 protein

TE

purified using Fos-cholin-10 as detergent. The elution profiles of Pex11 before (red) and after (blue) storage of samples for two days at +4oC are shown. Main peaks of absorbance are numbered. Fractions which were used for

AC CE P

MCR (see panel C) are marked by underlined letters A and B. (B) Cross-linking of purified Pex11 protein. The samples were treated with a cross linker at different concentrations and then subjected to SDS-PAGE followed by immunostaining with anti-His-tag antibodies. Positions of monomers (*), dimers (**), and tetramers (***) of Pex11 are marked. (C) MCR of the different forms of purified Pex11. Fractions marked as A and B (panel A) were collected and analyzed for channel forming activity. Left histogram – fraction A, right histogram – fraction B. See legend to Fig. 1 (panels E and F) for further details. (D) Size-exclusion chromatography of Pex11 protein isolated using Genapol X-80 as detergent. Aliquots from fractions containing Pex11 were subjected to SDS-PAGE. (E) Bluenative electrophoresis of purified Pex11 protein (see panel D). Left panel: silver nitrate protein staining, right panel: immunodetection using anti-His-tag antibodies. Large oligomeric complexes are marked by asterisks. (F) Recording of a high-conductance channel activity using SCA. A time scale-expanded trace is shown below. Insertion event is marked by asterisk. (G) Amplitude histogram of the recording shown on panel F. Note multiple sub-conductance states indicating frequent gating of the channels. Fig. 3. SCA of purified Pex11. (A) Single channel conductance as a function of electrolyte concentration; n=4. (B) Single channel currents in response to the indicated voltage-step protocol. Symmetrical 3.0 M KCl as electrolyte. (C) Current trace of a single channel in response to the indicated voltage-ramp protocol. Electrolyte (panels C-E) was symmetrical 1.0 M KCl. (D) Current-voltage dependence for Pex11 channel; n=5-6. (E) Voltage-dependent open probability (Popen) of Pex11 channel; n=10-14. (F) Current-voltage relationship of a single channel under

ACCEPTED MANUSCRIPT 18 asymmetrical electrolyte conditions (trans/cis 1.0:0.5 M KCl); n=5-6. (G) Estimation of the pore diameter of Pex11 channel using polymer-exclusion method. Left panel: the average conductance was calculated from 30-40 single insertion events registered using SCA; the data are shown as ratio of the channel conductance without (G0) and with (G) non-electrolyte plotted against hydrated radii of non-electrolytes (see ‘Materials and methods’ for details). Right

PT

panel: second derivative of the results from left panel revealing two turning points. The left point (r~0.6 nm) indicates the size of molecules which transfer through the pore become restricted. The right point (r~0.8 nm)

RI

indicates the maximal size of molecules which are still conducted by the channel.

SC

Fig. 4. MCR of proteins solubilized from peroxisomal fractions (A,B) and identification of the selectivity determining sequence of yeast Pex11 channel (C-E). (A) Insertion of several channel-forming proteins (marked by

NU

asterisk) from wild-type peroxisomal membrane showing a conductance similar to that of recombinant Pex11. Electrolyte was symmetrical 3.0 M KCl. (B) Histograms of insertion events observed during MCR of proteins solubilized from peroxisomal membrane of wild-type cells (upper panel) and pex11Δ mutant cells (lower panel).

MA

Note the peak of current increments (marked by asterisk) with amplitudes corresponding to that of the recombinant Pex11 channel (see Fig. 1E,F). (C) Multiple alignments of the sequences representing putative pore regions of TRPM (mouse) and Pex11 (mouse and yeast) channels. Amino acids are marked as on Fig. S2A. (D) Comparison of

D

the putative pore regions of mouse TRPM5 and yeast Pex11. The predicted sites of the Pex11 protein phosphorylation are in frames. Amino acid sequence of the Pex11-His4K is shown below. (E) Current-voltage

TE

dependence of the Pex11-His4K channel; n=4-6. The data for wild-type Pex11 (dotted line) are shown for

AC CE P

comparison. Asymmetrical electrolyte was used (trans/cis 1.0:0.5 M KCl). Fig. 5. Pex11 protein levels and β-oxidation activity in oleic acid-induced yeast cells. (A) Induction of peroxisomal proteins (Pex11 and Fox3) in cell cultures grown on oleic acid-containing medium. Mitochondrial porin was used as a loading control. (B) Cells grown for 24 h on oleic acid-containing medium were incubated with 1-14C-labeled oleic (C18:1), lauric (C12:0) or octanoic (C8:0) acids and acid-soluble β-oxidation products were measured. The βoxidation rates in wild-type cells were taken as a reference (100%). (C) Schematic presentation of the apparent role of Pex11 channel and ABC transporters (Pxa1/Pxa2) in the transfer of fatty acids across peroxisomal membrane in yeast. Energy-dependent transfer of very long-chain fatty acids by means of ABC transporters should eventually lead to concentration of these acids inside peroxisomes (marked in bold) due to limitations in reverse diffusion of them through peroxisomal channels. This process may be beneficial for very long-chain fatty acids in competition with long- and medium-chain fatty acids for β-oxidation.

ACCEPTED MANUSCRIPT 19

PT

ACKNOWLEDGEMENTS We thank Prof. Dr. R. Wagner for reading the manuscript and A. Isomursu for technical assistance. This work was

RI

supported by grants from the Academy of Finland and the Sigrid Juselius Foundation, and by the Deutsche

NU

SC

Forschungsgemeinschaft (Grant RE178/2-4).

AUTHOR CONTRIBUTIONS

V.D.A., R.E., and J.K.H. conceived the project and analyzed the data; V.D.A., R.F., and W.G. designed

D

MA

experiments; S.M., S.G., L.S. and V.D.A. carried out experiments; V.D.A. and R.E. wrote the manuscript.

TE

COMPETING FINANCIAL INTERESTS

AC CE P

The authors declare no competing financial interests.

ACCEPTED MANUSCRIPT 20

References [1] V.D. Antonenkov, S. Grunau, S. Ohlmeier, J.K. Hiltunen, Peroxisomes are oxidative organelles, Antioxid.

[2]

PT

Redox Signal. 13 (2010) 525-537. S. Thoms, R. Erdmann, Dynamin-related proteins and Pex11 proteins in peroxisomes division and

RI

proliferation, FEBS J. 272 (2005) 169-181.

SC

[3] E.H. Hettema, A.M. Motley, How peroxisomes multiply, J. Cell Sci. 122 (2009) 2331-2336. [4] A.M. Motley, E.H. Hettema, Yeast peroxisomes multiply by growth and division, J. Cell Biol. 178 (2007)

NU

399-410.

[5] P.K. Kim, R.T. Mullen, U. Schumann, J. Lippincott-Schwartz, The origin and maintenance of mammalian

MA

peroxisomes involves a de novo PEX16-dependent pathway from the ER, J. Cell Biol. 173 (2006) 521-532. [6] H. Rottensteiner, K. Stein, E. Sonnenhol, R. Erdmann, Conserved function of Pex11p and the novel Pex25p and Pex27p in peroxisome biogenesis, Mol. Biol. Cell 14 (2003) 4316-4328.

D

[7] M. Marelli, J.J. Smith, S. Jung, E. Yi, A.I. Nesvizhskii, R.H. Christmas, R.A. Saleem, Y.Y. Tam, A.

TE

Fagarasanu, D.R. Goodlett, R. Aedersold, R.A. Rachubinski, J.D. Aitchison, Quantitative mass spectrometry reveals a role for the GTPase Rho1p in actin organization on the peroxisomal membrane, J. Cell Biol. 167 (2004)

AC CE P

1099-1112.

[8] Y.Y. Tam, J.C. Torres-Guzman, F.G. Vizeacoumar, J.J. Smith, M. Marelli, J.D. Aitchison, R.A. Rachubinski, Pex11-related proteins in peroxisome dynamics: a role for the novel peroxin Pex27p in controlling peroxisome size and number in Saccharomyces cerevisiae, Mol. Biol. Cell 14 (2003) 4089-4102. [9] I. Abe, K. Okumoto, S. Tamura, Y. Fujiki, Clofibrate-inducible, 28-kDa peroxisomal integral membrane protein is encoded by PEX11, FEBS Lett. 431 (1998) 468-472. [10] M. Passreiter, M. Anton, D. Lay, R. Frank, C. Harter, F.T. Wieland, K. Gorgas, W.W. Just, Peroxisome biogenesis: involvement of ARF and coatomer, J. Cell Biol. 141(1998) 373-383. [11] M. Schrader, B.E. Reuber, J.C. Morrell, G. Jimenez-Sanchez, C. Obie, T.A. Stroh, D. Valle, K.D. Smith, S.J. Gould, Expression of Pex11beta mediates peroxisome proliferation in the absence of extracellular stimuli, J. Biol. Chem. 273 (1998) 29607-29614. [12] X. Li, E. Baumgart, G.X. Dong, J.C. Morrell, G. Jimenez-Sanchez, D. Valle, K.D. Smith, S.J. Gould, PEX11alpha is required for peroxisome proliferation in response to 4-phenylbutyrate but is dispensable for peroxisome proliferator-activated receptor alpha-mediated peroxisome proliferation, Mol. Cell Biol. 22 (2002) 8226-8240.

ACCEPTED MANUSCRIPT 21 [13] J. Koch, C. Brocard, Membrane elongation factors in organelle maintenance: the case of peroxisome proliferation, Biomol. Concepts 2 (2011) 353-364. [14] X. Li, E. Baumgart, J.C. Morell, G. Jimenez-Sanchez, D. Valle, S.J. Gould, PEX11beta deficiency is lethal

PT

and impairs neuronal migration but does not abrogate peroxisomal function, Mol. Cell Biol. 22 (2002) 4358-4365. [15] H. Weng, X. Ji, Y. Naito, K. Endo, X. Ma, R. Takahashi, C. Shen, G. Hirokawa, Y. Fukushima, N. Iwai,

RI

Pex11α deficiency impairs peroxisome elongation and division and contributes to nonalcoholic fatty liver in mice,

SC

Am. J. Physiol. 304 (2013) E187-E196.

[16] M.S. Ebberink, J. Koster, G. Visser, F. van Spronsen, I. Stolte-Dijkstra, P.A. Smit, J.M. Fock, S. Kemp, R. PEX11β gene, J. Med. Genet. 49 (2012) 307-313.

NU

Wanders, H.R. Waterham , A novel defect of peroxisome division due to a homozygous non-sense mutation in the

MA

[17] A. Tanaka, K. Okumoto, Y. Fujiki, cDNA cloning and characterization of the third isoform of human peroxin Pex11p, Biochem. Biophys. Res. Commun. 300 (2003) 819-823. [18] R. Erdmann, G. Blobel, Giant peroxisomes in oleic acid-induced Saccharomyces cerevisiae lacking the

D

peroxisomal membrane protein Pmp27p, J. Cell Biol. 128 (1995) 509-523.

TE

[19] J. Koch, K. Pranjic, A. Huber, A. Ellinger, A. Hartig, C. Brocard, PEX11 family members are membrane

AC CE P

elongation factors that coordinate peroxisome proliferation and maintenance, J. Cell Sci. 123 (2010) 3389-3400. [20] L. Opaliński, J. Kiel, C. Williams, M. Veenhuis, I.J. van den Klei, Membrane curvature during peroxisome fission requires Pex11, EMBO J. 30 (2011) 5-16. [21] X. Li, S.J. Gould, The dynamin-like GTPase DLP1 is essential for peroxisome division and is recruited to peroxisomes in part by PEX11, J. Biol. Chem. 278 (2003) 17012-17020. [22] C. Williams, L. Opalinski, C. Landgraf, J. Costello, M. Schrader, A.M. Krikken, K. Knoops, A.M. Kram, R. Volkmer, I.J. van der Klei, The membrane remodeling protein Pex11p activates the GTPase Dnm1p during peroxisomal fission, Proc. Natl. Acad. Sci. USA 112 (2015) 6377-6382. [23] C. van Roermund, H.F. Tabak, M. van Den Berg, R.J. Wanders, E.H. Hettema, Pex11p plays a primary role in medium-chain fatty acid oxidation, a process that affects peroxisome number and size in Saccharomyces cerevisiae, J. Cell Biol. 150 (2000) 489-498. [24] V.D. Antonenkov, J.K. Hiltunen, Transfer of metabolites across the peroxisomal membrane, Biochim. Biophys. Acta 1822 (2012) 1374-1386.

ACCEPTED MANUSCRIPT 22 [25] A. Rokka, V.D. Antonenkov, R. Soininen, H. Immonen, P. Pirila, U. Bergmann, R. Sormunen, M. Wechström, R. Benz, J.K. Hiltunen, Pxmp2 is a channel-forming protein in mammalian peroxisomal membrane, PLoS One 4 (2009) e5090.

PT

[26] M.H. Vapola, A. Rokka, R.T. Sormunen, L. Alhonen, W. Schmitz, E. Conzelmann, A. Wärri, S. Grunau, V.D. Antonenkov, J.K. Hiltunen, Peroxisomal membrane channel Pxmp2 in the mammary fat pad is essential for

RI

stromal lipid homeostasis and for development of mammary gland epithelium in mice, Dev. Biol. 391(2014) 66-

SC

80.

[27] V.D. Antonenkov, A. Isomursu, D. Mennerich, M. H. Vapola, H. Weiher, T. Kietzmann, J.K. Hiltunen, The

potential, J. Biol. Chem. 290 (2015) 13840-13861.

NU

human mtDNA depletion syndrome gene MPV17 encodes a non-selective channel that modulates membrane

[28] N.H. Chen, D.I. Crane, C.J. Masters, Analysis of the major integral membrane proteins of peroxisomes from

MA

mouse liver, Biochim. Biophys. Acta 945 (1988) 135-144.

[29] A.M. Gouveia, C. Reguenga, M.E. Oliveira, C. Eckerskorn, C. Sa-Miranda, Alkaline density gradient

D

flotation of membranes: polypeptide composition of the mammalian peroxisomal membrane, Anal. Biochem. 274

TE

(1999) 270-277.

[30] A. Spinazzola, C. Viscomi, E. Fernandes-Vizarra, F. Carrara, P. D’Adamo, S. Calvo, R.M. Marsano, C.

AC CE P

Donnini, H. Weiher, P. Strisciuglio, R. Parini, E. Sarzi, A. Chan, S. DiMaurio, A. Rötig, P. Gasparini, I. Ferrero, V.K. Mootha, V. Tiranti, M. Zeviani, MPV17 encodes an inner mitochondrial membrane protein and is mutated in infantile hepatic mitochondrial DNA depletion, Nat. Genet. 38 (2006) 570-575. [31] S. Krick, S. Shi, W. Ju, C. Faul, S. Tsai, P. Mundel, E.P. Böttinger, Mpv17l protects against mitochondrial oxidative stress and apoptosis by activation of Omi/HtrA2 protease, Proc. Natl. Acad. Sci. 105 (2008) 1410614111.

[32] I. Dalla Rosa, R. Durigon, S.F. Pearce, J. Rorbach, E.M.A. Hirst, S. Vidoni, A. Reyes, G. Brea-Celio, M. Inczuk, M.W. Woellhaf, J.M. Herrmann, J.M. Huynen, I.J. Holt, A. Spinazzola, MPV17L2 is required for ribosome assembly in mitochondria, Nucleic Acid Res. 42 (2014) 8500-8515. [33] C. Dallabona, R.M. Marsano, P. Arzuffi, D. Ghezzi, P. Mancini, M. Zeviani, I. Ferrero, C. Donnini, Sym1, the yeast ortholog of the MPV17 human disease protein, is a stress-induced bioenergetic and morphogenetic mitochondrial modulator, Hum. Mol. Gen. 19 (2010) 1098-1107. [34] R. Reinhold, V. Kruger, M. Meinecke, C. Schulz, B. Schmidt, S.D. Grunau, B. Gulard, N. Wiedemann, M. van der Laan, R. Wagner, P. Rehling, J. Dudec, The channel-forming Sym1 protein is transported by the TIM23 complex in a presequence-independent manner, Mol. Cell Biol. 32 (2012) 5009-5021.

ACCEPTED MANUSCRIPT 23 [35] M. Gualdron-Lopez, M. Vapola, I. Miinalainen, J.K. Hiltunen, P. Michels, V.D. Antonenkov, Channelforming activities in the glycosomal fraction from the bloodstream form of Trypanosoma brucei, PLoS One 7 (2012) e34530.

PT

[36] M.X. Zhu (ed.) TRP Channels (CRC press, Boca Raton, Florida, USA, 2011).

RI

[37] P. Holzer, A.A. Izzo, The pharmacology of TRP channels, Brit. J. Pharm. 171 (2014) 2469-2473. [38] U. Güldener, S. Heck, T. Fielder, J. Beinhauer, J.H. Hegemann, A new efficient gene disruption cassette for

SC

repeated use in budding yeast. Nucleic Acids Res. 24 (1996) 2519-2524.

[39] A. Halbach, R. Rucktäschel, H. Rottensteiner, R. Erdmann, The N-domain of Pex22p can functionally

[40]

NU

replace the Pex3p N-domain in targeting and peroxisome formation, J. Biol. Chem. 284 (2009) 3906-3916. R. Erdmann, M. Veenhuis, D. Mertens, W.H. Kunau, Isolation of peroxisome-deficient mutants of

MA

Saccharomyces cerevisiae, Proc. Natl. Acad. Sci. USA 86 (1989) 5419-5423. [41] F.G. Ausubel, Current Protocols in Molecular Biology (Greene Publishing Associates, New York, USA

D

1992).

TE

[42] S. Grunau, S. Mindthoff, H. Rottensteiner, R.T. Sormunen, J.K. Hiltunen, R. Erdmann, V.D. Antonenkov, Channel-forming activities of peroxisomal membrane proteins from the yeast Saccharomyces cerevisiae, FEBS J.

AC CE P

276 (2009) 1698-1708.

[43] C. Brocard, G. Lametschwandtner, R. Koudelka, A. Hartig, Pex14p is a member of the protein linkage map of Pex5p, EMBO J. 16 (1997) 5491-5500. [44]

T. Nakagawa, T. Imanaka, M. Morita, K. Ishiguro, H. Yurimoto, A. Yamashita, N. Kato, Y. Sakai,

Peroxisomal membrane protein Pmp47 is essential in the metabolism of middle-chain fatty acids in yeast peroxisomes and is associated with peroxisome proliferation, J. Biol. Chem. 275 (2000) 3451-3461. [45] D. Kerssen, E. Hambruch, W. Klaas, H.W. Platta, B. Kruijff , R. Erdmann, W.H. Kunau, W. Schliebs, Membrane association of the cycling peroxisome import receptor Pex5p, J. Biol. Chem. 281(2006) 27003-27015. [46] P.A. Marshall, J.M. Dyer, M.E. Quick, J.M Goodman, Redox-sensitive homodimerization of Pex11p: a proposed mechanism to regulate peroxisomal division, J. Cell Biol. 135 (1996) 123-137. [47] G. Drin, B. Antonny, Amphipathic helices and membrane curvature. FEBS Lett. 584 (2010) 1840-1847. [48] M.J. Lingard, S.K. Gidda, S. Bingham, S.J. Rothstein, R.T. Mullen, R.N. Trelease, Arabidopsis Peroxin11ce, Fission 1b, and Dynamin-related protein3A cooperate in cell cycle-associated replication of peroxisomes. Plant Cell 20 (2008) 1567-1585.

ACCEPTED MANUSCRIPT 24 [49] G. Owsianik, K. Talavera, T. Voets, B. Nilius, Permeation and selectivity of TRP channels, Annu. Rev. Physiol. 68 (2006) 685-717.

PT

[50] X. Yao, H. Y. Kwan, Y. Huang, Regulation of TRP channels by phosphorylation. Neurosignals 14 (2005) 273-280. [51] B. Knoblach, R.A. Rachubinski, Phosphorylation-dependent activation of peroxisome proliferator protein

RI

PEX11 controls peroxisome abundance, J. Biol. Chem. 285 (2010) 6670-6680.

peroxisome division, Mol. Biol. Cell 23 (2012) 1307-1315. [53]

SC

[52] S. Joshi, G. Agrawal, S. Subramani, Phosphorylation-dependent Pex11p and Fis1p interaction regulates

T. Smani, G. Shapovalov, R. Skryma, N. Prevarskaya, J.A. Rosado, Functional and physiological

NU

implications of TRP channels, Biochim. Biophys. Acta 1853 (2015) 1772-1782. [54] N. Kedei, T. Szabo, J.D. Lile, J.J. Treanor, Z. Olah, M.J. Iadarola, P.M. Blumberg, Analysis of the native

MA

quaternary structure of vanilloid receptor 1, J. Biol. Chem. 276 (2001) 28613-28619. [55] M. Liao, E. Cao, D. Julius, Y. Cheng, Structure of the TRPV1 ion channel determined by electron cryo-

D

microscopy, Nature 504 (2013) 107-112.

TE

[56] A. Fleig, R. Penner, The TRPM ion channel subfamily: molecular, biophysical and functional features, Trends in Pharm. Sci. 25 (2004) 633-639.

AC CE P

[57] B. Bolter, J. Soll, K. Hill, R. Hemmler, R. Wagner, A rectifying ATP-regulated solute channel in the chloroplastic outer envelope from pea, EMBO J. 18 (1999) 5505-5516. [58]

L. Palmieri, H. Rottensteiner, W. Girzalsky, P. Scarcia, F. Palmieri, R. Erdmann, Identification and

functional reconstitution of the yeast peroxisomal adenine nucleotide transporter, EMBO J. 20 (2001) 5049-5059. [59] G. Agrimi, A. Russo, P. Scarcia, F. Palmieri, The human gene SLC25A17 encodes a peroxisomal transporter of coenzyme A, FAD and NAD+, Biochem. J. 443 (2012) 241-247. [60] J.K. Hiltunen, A. Mursula, H. Rottensteiner, R. Wierenga, A. Kastaniotis, A. Gurvitz, The biochemistry of peroxisomal beta-oxidation in the yeast Saccharomyces cerevisiae, FEMS Microbiol. Rev. 27 (2003) 35-64. [61] C.W.T. van Roemund, W.F. Visser, L. Ijlst, A. van Cruchten, M. Boek, W. Kulik, H.R. Waterham, R.J.A. Wanders, The human peroxisomal ABC half transporter ALDP functions as a homodimer and accepts acyl-CoA esters, FASEB J. 22 (2008) 4201-4208. [62] C.W.T. van Roemund, L. Ijlst, W. Majczak, H.R. Waterham, H. Folkerts, R.J.A. Wanders, K.J. Hellingwerf, Peroxisomal fatty acid uptake mechanism in Saccharomyces cerevisiae, J. Biol. Chem. 287 (2012) 20144-20153.

ACCEPTED MANUSCRIPT 25 [63] C. De Marcos-Lousa, C.W.T. van Roermund, V.V. Postis, D. Dietrich, I.D. Kerr, R.J.A. Wanders, S.A. Baldwin, A. Baker, F.L. Theodoulou, Intrinsic acyl-CoA thioesterase activity of a peroxisomal ATP binding cassette transporter is required for transport and metabolism of fatty acids, Proc. Natl. Acad. Sci. USA 110 (2013)

[64]

PT

1279-1284. C.W.T. van Roermund, E.H. Hettema, M. van den Berg, H.F. Tabak, R.J.A. Wanders, Molecular

RI

characterization of carnitine-dependent transport of acetyl-CoA from peroxisomes to mitochondria in Saccharomyces cerevisiae and identification of a plasma membrane carnitine transporter, Agp2p, EMBO J. 18

SC

(1999) 5843-5852.

[65] K. Strijbis, C.W.T. van Roermund, J. van den Burg, M. van den Berg, G.P. Hardy, R.J. Wanders, B. Distel,

NU

Contributions of carnitine acetyltransferase to intracellular acetyl unit transport in Candida albicans, J. Biol. Chem. 285 (2010) 24335-24346.

MA

[66] M. Kunze, A. Hartig, Permeability of the peroxisomal membrane: lessons from the glyoxylate cycle, Frontiers Physiol. 4 (2013) article 204.

D

[67] C.W.T. van Roermund, E. Hettema, A. Kal A, M. van den Berg, H.F. Tabak, R.J. Wanders, Peroxisomal βoxidation of polyunsaturated fatty acids in Saccharomyces cerevisiae: isocitrate dehydrogenase provides NADPH

TE

for reduction of double bonds at even positions, EMBO J. 17 (1998) 677-687.

AC CE P

[68] B. Henke, W. Girzalsky, V. Betreaux-Lecellier, R. Erdmann, IDP3 encodes a peroxisomal NADP-dependent isocitrate dehydrogenase required for the beta-oxidation of unsaturated fatty acids, J. Biol. Chem. 273 (1998) 3702-3711.

[69] J. Kiel, I. van der Klei, M.A. van den Berg, R.A.L. Bovenberg, M. Veenhuis, Overproduction of a single protein, Pc-Pex11p, results in 2-fold enhanced penicillin production by Penicillium chrysogenum, Fungal Gen. Biol. 42 (2005) 154-164.

[70] K. Piekarska, G. Hardy, E. Mol, J. van den Burg, K. Strijbis, C.W.T. van Roemund, M. van den Derg, B. Distel, The activity of the glyoxylate cycle in peroxisomes of Candida albicans depends on a functional βoxidation pathway: evidence for reduced metabolite transport across the peroxisomal membrane, Microbiology 154 (2008) 3061-3072. [71] L.J. Knoll, R. Johnson, J.I. Gordon, Biochemical studies of three Saccharomyces cerevisiae acyl-CoA synthetases, Faa1p, Faa2p, and Faa3p, J. Biol. Chem. 269 (1994) 16348-16356. [72] P.A. Watkins, J.M. Ellis, Peroxisomal acyl-CoA synthetases, Biochim. Biophys. Acta 1822 (2012) 14111420.

ACCEPTED MANUSCRIPT 26 [73] C.W.T. van Roemund, Y. Elgersma, N. Singh, R. Wanders, H.F. Tabak, The membrane of peroxisomes in Saccharomyces cerevisiae is impermeable to NAD(H) and acetyl-CoA under in vivo conditions, EMBO J. 14 (1995) 3480-3486.

PT

[74] D. Huang, H. Friesen, B. Andrews, Pho85, a multifunctional cyclin-dependent protein kinase in budding yeast, Mol. Microbiol. 66 (2007) 303-314.

RI

[75] M. Usaj, M. Brloznik, P. Kaferle, M. Zitnik, H. Wolinski, F. Leitner, S. Kohlwein, B. Zupan, U. Petrovic,

AC CE P

TE

D

MA

NU

ERMES complex, J. Mol. Biol. 427 (2015) 2072-2087.

SC

Genome-wide localization study of yeast Pex11 identifies peroxisome-mitochondria interactions through the

ACCEPTED MANUSCRIPT

AC CE P

TE

D

MA

NU

SC

RI

PT

27

ACCEPTED MANUSCRIPT

AC CE P

TE

D

MA

NU

SC

RI

PT

28

ACCEPTED MANUSCRIPT

AC CE P

TE

D

MA

NU

SC

RI

PT

29

ACCEPTED MANUSCRIPT

AC CE P

TE

D

MA

NU

SC

RI

PT

30

ACCEPTED MANUSCRIPT

AC CE P

TE

D

MA

NU

SC

RI

PT

31

ACCEPTED MANUSCRIPT 32

COMPETING FINANCIAL INTERESTS

AC CE P

TE

D

MA

NU

SC

RI

PT

The authors declare no competing financial interests.

ACCEPTED MANUSCRIPT 33

Yeast peroxisomal Pex11 protein is a non-selective channel.



Pex11 shares sequence similarity with TRPM channels.



β-Oxidation in intact cells is modulated by Pex11.



Phosphorylation of Pex11 may regulate peroxisomal β-oxidation.

AC CE P

TE

D

MA

NU

SC

RI



PT

Highlights