HLA class II antigens in rheumatic fever Analysis of the DR locus by restriction fragment-length polymorphism and oligotyping

HLA Class II Antigens in Rheumatic Fever Analysis of the DR Locus by Restriction Fragment-Length Polymorphism and Oligotyping Wagner Weidebach, Anna Carla Goldberg, Josely M. Chiarella, Luiza Guilherme, Rachel Snitcowsky, Fulvio Pileggi, and Jorge Kalil

ABSTRACT: We recently described an association of

serologically defined HLA class II antigens DR7 and DR53 with RF. This study aimed at determining more precisely the class II gene associated with the disease. We studied patients and age- and race-matched controls. Genomic DNA was digested with four different enzymes and hybridized with HLA cDNA probes for DRy, DQ~, DQot, and DP~3 genes. RFLP analysis disclosed a fragment of 23,81 kb on Taq I DR [3 blots, which correlates with HLA-DR53 and HLA-DR16, according to data from the Tenth International Histocompatibility Workshop. Of 24 patients, 20 (83.3%), were positive for the 13.81-kb/Taq I/DR[~ allogenotope, compared with 16 (34%) of 47 healthy individuals (p = 0.000079, Fisher's exact test). Search for specific nucleotide sequences was

performed using polymerase chain reaction technique. Oligonucleotides corresponding either to allele-specific DR7 and DR53 sequences, or shared by DRB1 and DRB3, DRB4, or DRB5 sequences were screened. Differences were tested throughout the second exon up to codon 100. Results were as expected by simple comparison with the published sequences of individual alleles. Although a clear association with DRB loci is shown, a susceptibility associated either with an allele or with a unique sequence was not found. A promiscuous presentation of the putative cross-reacting peptide or a heterogeneity of the causative agent might be the origin of these results. Genetic complementarity may be an additional factor defining inherited susceptibility to this disease. Human Immunology 40, 2 5 3 - 2 5 8 (1994)

ABBREVIATIONS

RF

rheumatic fever

RFLP

restriction fragment-length polymorphism

INTRODUCTION Rheumatic Fever (RF) is a disease of autoimmune nature, relatively common in developing countries. The disease arises as a sequel of streptococcal throat infection in childhood and at the onset is characterized by multiple, usually transient, symptoms involving articular, central nervous system, and cardiac tissues. About 30% of the

From the Heart Institute, Hospital of Clinics, Faculty of Medicine, University of SAo Paulo, S~o Paulo, Brazil. Address reprint requests to Dr. J. Kalil, I_aboratdrio de Imunologia de Transplantes, lnstituto do Cora(Ao--Faculdadede Medicina/USP, Av. Aneas de Carvalho Aguiar 500, 3 ° andar, 05403-000 S~o Paulo, SP, Brazil. Received (U) August 4, 1993; acceptedDecember I, 1993.

Human Immunology40, 253-258 (1994) © AmericanSocietyfor Histocompatibilityand Immunogenetics, 1994

patients develop pancarditis, which in many instances permanently affects myocardium and heart valves. Increased familial incidence of RF was pointed out by Cheadle more than a hundred years ago [1]. The pathogenetic mechanisms leading to the development of RF, however, are still largely unknown. A role for autoimmunity in the genesis of RF is suggested by several factors including the lagtime between streptococcal infection and the onset of myocardium and heart valve damage, the presence of multiple autoantibodies against heart components and neural tissue in a patient's sera [2], and the association of this disease with class II HLAD R molecules which are known to be involved in the 253 0198-8859/94/$7.00

254

regulation of immune responses [3]. We recently showed that streptococcal peptides elicit cross-reactivity with myocardium or valve proteins, suggesting a mechanism leading to autoimmune-mediated cardiac lesions (manuscript in preparation). Cross-reactivity between streptococci and selfantigens may lie at the basis of the tissue damage occurring in the susceptible host. The biochemical homology between bacterial antigens, especially bacterial wall M protein and human myocardial and valve proteins such as myosin, tropomyosin, and vimentin, has been proposed as the cause of postinfection autoimmune reactivity directed against the host's cardiac tissues [4]. Thus, rheumatic heart disease [5] eventually evolves from the destruction of the host tissue. This phenomenon, however, does not happen to all individuals stricken with streptococcal throat infection. Parameters such as age, nutritional status, crowded living conditions, infection by different bacterial strains, as well as genetic susceptibility appear to contribute to the onset of the disease [5, 6]. In a sample of the Brazilian population, RF was recently shown to be significantly associated with an increased frequency of the HLA class II antigen DR7 [3]. In other populations, association with different class II HLA antigens has also been pointed out. Thus, in studies by Ayoub et al. [7], associations with HLA-DR4 in American Caucasians and with HLA-DR2 in American blacks were shown to be present in RF patients. Association with HLA-DR4 was confirmed by AnastasiouNana et al. [8]. The same association with HLA-DR4 was found in Saudi Arabians [9]. On the other hand, in an Indian population, the association was shown to be with HLA-DR3 [10]. Taken together, the data favor a correlation of RF with the antigen group of HLA-DR4, -DR7, and -DR9, indicating that rather than the gene product of the DRB 1 locus, the true origin of this association may be the second DR allele expressed by these individuals, namely the HLA-DR53 antigen coded by the DRB4 gene. In this report, we describe results of restriction fragment-length polymorphism (RFLP) analysis and oligotyping done on Brazilian patients with the purpose of trying to identify the HLA class II locus most closely involved in the susceptibility to RF. MATERIALS AND METHODS RFLP analysis. For this study we chose, at random, 24 patients and 47 controls matched for age and racial background. Patients were diagnosed jointly by a cardiologist and a rheumatologist according to the Jones criteria [ 11] and were most frequently found to have rheumatic heart disease. Six patients had pure or associated chorea. The majority of patients and controls were untyped for HLA, ensuring that blind analysis could be conducted.

W. Weidebach et al.

Genomic DNA was isolated as previously described [12]. Samples were digested with Taq I, Hind III, Eco RI, and Msp I as specified by the manufacturer (Amersham), blotted, and hybridized by established methods [13]. Filters were washed twice for 20 minutes in 2X SSPE at room temperature, once at 65°C for 30 minutes in 2X SSPE and 0.1% SDS, and once more at 65°C for 20-30 minutes in 0.5X SSPE and 0.1% SDS. cDNA probes were employed for the following genes: DRB [14], DQB [15], DQA [16], and DPB [17].

Oligonucleotide analysis. Samples from 43 patients, the majority typed for HLA, and 30 untyped age- and racematched controls, as well as some additional samples from HLA-typed individuals, were analyzed. The samples were chosen in order to represent all possible HLADR combinations, enabling a clear identification of any shared sequence. Amplification of all DRB genes [18] was performed with the following primers: GH46:5

' CCGGATCCTTCGTGTCCCCACAGCACG3

r

GH50:5

tCTCCCCAACCCCGTAGTTGTGTCTGCA3

r

Oligonucleotides for hybridization were chosen from the published DRB allele sequences [ 19] for loci DRB 1, DRB4, and DRB5 (see Table 1). Samples were dotblotted, prehybridized for 2-4 hours, and hybridized with the chosen oligonucleotide for 30 hours in 6 x SSC, 5x Denhardt, 0.1% SDS, and 100 ~g/ml sonicated salmon sperm DNA at 42°C. Blots were washed in 2 x SSC and 0.1% SDS at room temperature followed by washing at Tm (melting temperature) minus 5°C for 20 minutes and radioautography for 30 minutes to 24 hours. Blots were rehybridized with the generic "all" oligonucleotide DR40 to ensure all dots contained amplified DNA (see Fig. 1B). RESULTS DNA samples were digested with different restriction endonucleases: Taq I, Eco RI, Hind III, and Msp I. Serial hybridizations with cDNA probes for DRiS, DQ~, DQo~, and DP[3 genes were carried out in order to search for significant associations of the revealed fragments with the various loci, corresponding to the patients' HLA haplotypes. We found a highly significant association of a 13.81kb fragment upon Taq I digestion and hybridization with the DRy3 probe with the presence of RF (Fig. 2). According to the Tenth International Histocompatibility Workshop, this fragment correlates to the HLA-DR53 and DR16 specificities [20]. The 13.81-kb/Taq I/DR[3 allogenotope was present in 20 (83.3%) of 24 patients but only in 16 (34%) of 47 controls (Fisher's exact test, p = 0.000079) (Table 2). The same Taq I blots hybridized with the DQo~ and

Class II Antigens in RF

TABLE 1

255

Sequences of the oligonucleotides used in this study

DR7-7 a DR7-27 b DR7-54" DR7-71 a DR7-75 e DR53-25 b DR40 a DR53-5Y ''e DR53-93 t DR4-72 a

CCTGTGGCAGGGTAAGTATAA GAAAGACTCTTCTATAAC GGGCGGCCTGTCGCCGAG AGGCGGGGCCAGGTGGAC GTGGACACCGTGTGCAGA TGGAACCTGATCAGATAC TTCGACAGCGACCTGGGG CGGCCTGACGCTGAGTAC CGGCGAGTCCAACCTAAG CGGGCCGAGGTGGACACC

Codon Codon Codon Codon Codon Codon Codon Codon Codon Codon

7-13 27-32 54-59 71-76 75-80 25-30 40~15 55-60 93-98 72-77

DRl2-54 ' h

GGGCGGCCTGTCGCCGAGTCC

Codon 54-60

DRB 1"07 DRBl*07 DRBl*07, DRB3*01 and *03 DRB 1"07, DRB3*02 DRB 1"07, DRB 1"09 DRB4*01 All DRBI*2, DRBS, DRB4 DR2all, DRB4 DRB4, DRBI*09, DRB1*1401 DRBI*04(03, 06, 07) DRB 1" 12, DRB 1"07, DRBI*09, DRB3*01 and 03

Washing temperatures were a57°C, b46°C, "60°C, a6 I°C, ~55°C, and f56°C. g Silent codon change in the sequence. h Oligonucleotides 12-54 and 7-54 are complementary for DRB l sequences, covering the DR53 group of alleles.

DQI3 probes did not show any fragment associated either positively or negatively to the disease. These three probes were also used on Eco RI- and Hind III-digested samples, again disclosing no correlation of a fragment with the disease. Msp I digests analyzed with the DP[3 probe also failed to show any relevant information (data not FIGURE 1 Example of the dot blots obtained after hybridization with oligonucleotides DR53-25 (A) and DR40 (B). The first four columns correspond to control samples, the middle columns to patient samples, and the last two columns to HLAtyped normal individuals form the laboratory cell panel.

•

gO0 • • •

•

• O 0

O O O

O

O

O A

go •

•

•

O O O

• • •

B

•

• • • • •

•

O O

OOOOOOO'OOO00 O gO,gO00','OO O0 O 0 O O O

OO00,OOOoOoo OOO

OOO0oooo

shown). In addition, no association of the 13.81-kb/TaqlDR[3 allogenotope with different forms of clinical presentation of the disease, carditis (rheumatic heart disease), and/or chorea could be discerned (Table 3) in this group of RF patients. Oligonucleotides were hybridized to dot blots of the amplified D N A samples from patients and controls. The results did not disclose any shared sequences in the D N A samples from the 43 patients examined (Table 4). The distribution of positive dots was exactly as predicted by the chosen sequences, with two exceptions. One case was a result of misstyping, and the other was a patient positive for DR7 but which failed to hybridize with oligonucleotide 53-55, which codes for a silent mutation. Thus, the sequences chosen from DR7(DRB 1) and/or DRB4 and DRB5 genes did not have counterparts in the genes from the patients carrying alleles other than those significantly associated with susceptibility to RF.

DISCUSSION The results shown in this paper indicate a strong association between the 13.81-kb/Taq I/DR[~ allogenotope and the presence of RF. These data are in accordance with our previous study [3], in which associations with serologically typed class II HLA-DR7 and DR53 were demonstrated in a Brazilian RF population. In spite of the lower number of patients analyzed in this series (24 patients and 47 controls) the results were similar. The serologic data were obtained from 40 patients and 118 controls and the association was significant at corrected p values of 0.007 for DR7 and 0.0006 for DR53. Due to the high linkage disequilibrium between these two genes, it is quite difficult to distinguish which association is the most relevant. Nevertheless, data from other authors [7-9] point to associations of RF with HLADR4 in Caucasians and suggest that the HLA an-

256

W. Weidebach et al.

K

L

M

N

0

P

Q

R

S

T

~23.1 13.81 kb *9.4

'k6.6

~4.5

tlgen more closely related to the susceptibility may in fact be HLA-DR53. On the other hand, Ayoub et al. [7] showed an increased frequency of HLA-DR2 in black patients with RF. Though not achieving significance, it is interesting to note that we observed that approximately half of the HLA-DR53-negative patients in our population sample are positive for HLA-DR2. We previously showed that the HLA antigen frequencies of an apparently white Brazilian population are indeed situated between published frequencies of Caucasoids and Negroids [21]. The Taq I fragment described in this study correlates with H L A - D R 5 3 and H L A - D R 1 6 (HLA-DR2 split) according to the Tenth International H i s t o c o m p a t i b i l i t y W o r k s h o p data [20]. In HLADR53-positive patients, the associated locus would be DRB4, which is present in the HLA-DR4, -DR7, and -DR9-bearing individuals. In the HLA-DR2-positive patients, the involved locus could be either DRB1 or DRB5, which also exhibits polymorphism [22]. For this reason, we chose to test our RF and control samples using DRB1- and DRB4-specific oligonucleotides as well as sequences shared with DRB5 alleles. Probes were designed to cover the HLA-DR groove where the polymorphic regions of these alleles have been TABLE 2

Presence of the 13.81kb Taq I/DR[3 allogenotope obtained for 24 RF patients and 47 controls

FIGURE 2 Blot of DNA from RF patients digested with Taq I and hybridized with the DR[3 probe. The patient in lane P was excluded from the analysis.

described. However, the data obtained were not able to point out a single relevant HLA sequence shared by the RF patients and not present in the normal counterpart expressing the same alleles, although stringent conditions were used. In addition, no shared sequence between patients positive or negative for the HLA antigens DR7 and/or DR2 was found. The high number of positive RF samples for the 53-93 oligonucleotide reflects our choice of a sequence shared by DR53- and DR2-positive individuals. This probe may be useful in population screening studies for RF. Several explanations for these observations can be forwarded. In first place, one cannot exclude the possibility that the observed correlations might be due to linkage disequilibrium with a still undefined gene in the proximity of the DR locus. This association could be with an HLA gene or even with a regulatory region nearby, but no evidence has been found so far. The presence of several patients negative for the associated HLA-DR antigens in our sample, as well as different associations disclosed in other populations, would be satisfactorily explained by this type of correlation. Second, the susceptibility may be conferred by tridimensional configurations of the class II molecules either by changing the peptide-binding groove directly or by TABLE 3

Lack of association between clinical manifestations and the presence of the 13.81-kb/Taq I/DR[3 allogenotope

l 3.81-kb/Taq I fragment

13.81-kb/Taq I/DR[3 fragment Patients Controls

20 16

Fisher's exact test: p = 7.9 x 10 -5.

4 31

Pure carditis (RHD)a RHD with chorea Pure chorea a RHD, rheumaticheart disease.

Positive

Negative

15 03 02

03 01 00

Class II Antigens in RF

TABLE 4

257

Results of polymerase chain reaction amplified D N A samples hybridized with sequence-specific oligonucleotides Individuals sampled

Oligonucleotide

DR7 -~-

DR9 +

7-7 7-27 7-75

10 (10) 14 (15) 14 (15)

0 0 2 (2)

0 0 0

53-23 53-55 53-93 7-54 12-54 4-72

14 (15) 13 (15) 14 (15) 15 (15) 15 (15) 13 (13)

2 (2) 2 (2) 2 (2) 2 (2)a 2 (2)u 2 (2)

4 (5) 5 (5) 5 (5) 2 (5)a 2 (5)a 4 (4)

a

DR4 +

DR2 + t,

Other'

Total

0 0 0

0 0 0

10/32 14/43 16/43

0 8 (8) 8 (8) 6 (8)~i 3 (8)~/ 7 (8)

C, 2 (13) 8 (13) 8 (13) 7 (13) 8 (13)

20/43 30/43 37/43 33/43 29/43 34/40

a Numbers in parentheses correspond to the total number of individuals carrying the specificity. h Individuals DR2 positive but negative for the DR53 group of alleles. • Two untyped individuals are included in this group. d With one exception, the second antigen of these patients belongs to the DR52 group of alleles.

changing regions nearby. In this case, oligonucleotide mapping could fail to identify the relevant region. W e feel this possibility is less promising, however, as we have looked at practically all variable regions of the second d o m a i n that lead to changes of the p e p t i d e presenting groove in the H L A - D R molecules. A single base pair m i g h t have been overlooked, albeit experimental conditions were set in order to avoid this possibility. That is, base mismatches for the different alleles were always localized in the middle of the sequences chosen. Third, one should consider that susceptibility to RF may result from changes of the class II molecule induced by certain peptides derived from streptococcal antigens or their cross-reactive counterparts in the organism. In this context, a certain degree of "promiscuity" of the "class II + peptide" complex would explain, on one hand, the absence of a clear-cut association of susceptibility to RF with a unique class II molecule or, alternatively, the presence of other HLA class II haplotypes in part of the RF patients. Whatever the mechanisms, the H L A - D R molecule seems to be involved in the pathogenesis of RF. It is possible that the related group of H L A - D R 4, 7, and 9 and the coexpressed H L A - D R 5 3 molecules [23] are highly similar in their ability to present peptides stemming from different streptococcal strains throughout the world, leading to the same autoimmune pathways to produce the different HLA associations disclosed in the majority of the published studies.

ACKNOWLEDGMENTS

This work was supported by grants from FAPESP and PADCT.

REFERENCES 1. Cheadle WB: Harveian lectures on the various manifestations of the rheumatic state as exemplified in childhood and early life. Lancet 1:821, 1889. 2. Zabriskie JB: Rheumatic fever: the interplay between host, genetics and microbe. Circulation 71:1077, 1985. 3. Guilherme L, Weidebach W, Kiss MH, Snitcowski R, Kalil J: Association of human leukocyte class II antigens with rheumatic fever or rheumatic heart disease in a Brazilian population. Circulation 83:. 1995, 1991. 4. Williams RC Jr: Molecular mimicry and rheumatic fever. Clin Rheumatol Dis 11:573, 1985. 5. Stollerman GH: Rheumatic Fever and Streptococcal Infection. New York, Grune and Stratton, 1975. 6. Williams RCJr: Host factors in rheumatic fever and heart disease. Hosp Pract 8: 125, 1982. 7. Ayoub EM, Barrett DJ, Maclaren NK, Krischen JP: Association of class II histocompatibility leukocyte antigens with rheumatic fever. J Clin Invest 77:2019, 1986. 8. Anastasiou-Nana M, Anderson JL, Carlquist JF, Nanas JN: HLA-DR typing and lymphocyte subset evaluation in rheumatic heart disease: a search for immune response factors. Am Heart J 112:992, 1986. 9. Rajapakse CNA, Halim K, A1-Orainey I, AI-Nozha M, AI-Aska AK: A genetic marker for rheumatic heart disease. Br Heart J 58:659, 1987. 10. Jhinghan NG, Mehra NK, Reddy KS, Taneja V, Vaidya MC, Bhatia ML: HLA, blood groups and secretor status in patients with established rheumatic fever and rheumatic heart disease. Tissue Antigens 27:172, 1986. 11. Stollerman GH, Markowitz M, Taranta A, Wannamaker LW, Whittemore R: Jones criteria (revised) for guidance

258

W. Weidebach et al.

in the diagnosis of rheumatic fever. Circulation 32:664, 1964. 12. Maniatis T, Fritsch EF, Sambrook J: Southern transfer. In: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1982, p 1273. 13. Southern E: Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 98:503, 1975. 14. Long EO, Wake CT, Strubin M, Gross N, Acolla RS, Carrel S, Mach B: Isolation of distinct cDNA clones encoding HLA-DRbeta chains by use of an expression assay. Proc Natl Acad Sci USA 79:7465, 1982. 15. Larhammar D, Schenning L, Gustafsson K, Wiman K, Claeson L, Rask L, Peterson PA: Complete amino acid sequence of an HLA-DR antigen-like beta chain as predicted from the nucleotide sequence: similarities with immunoglobulins and HLA-A, -B and -C antigens. Proc Natl Acad Sci USA 79:3687, 1982. 16. Auffray C, Korman AJ, Roux-Dosseto M, Bono R, Strominger JL: cDNA heavy clone for the heavy chain of the human B cell alloantigen DCI: strong sequence homology to HLA-DR heavy chain. Proc Natl Acad Sci USA 79:6337, 1982.

17. Roux-Dosseto M, Auffray C, Lillie JW, Boss JM, Cohen D, Demars R, Mawas C, Seidman JG, Strominger JC: Genetic mapping of a human class II antigen beta-chain cDNA clone to the SB region of the HLA complex in humans. Proc Natl Acad Sci USA 80:6036, 1983. 18. Erlich HA, Bugawan TL (eds): HLA DNA Typing in PCR Protocols. San Diego, Academic, 1990, p 261. 19. Marsh SGE, Bodmer JG: HLA class II nucleotide sequences. Hum Immunol 35: 1, 1992. 20. Dupont B: Histocompatibility Testing 1987. New York, Springer-Verlag, 1989. 21. Rosales T, Guilherme L, Chiarella J, Marin ML, Rosales C, Melo CP, Goldberg AC, Kalil J: Human leukocyte A and B antigen, gene and haplotype frequencies in the population of the city of S~o Paulo in Brazil. Braz J Med Biol Res 25:39, 1992. 22. Moraes ME, Vina MF, Stastny P: DNA typing for class II HLA antigens with allele-specific or group-specific amplification. Hum Immunol 31: 139, 1991. 23. Gregersen PK, Moriuchi T, Karr RW, Obata F, Moriuchi J, Maccari J, Goldberg D, Winchester RJ, Silver J: Polymorphism of HLA-DRbeta chains in DR4, -7 and -9 haplotypes: implications for the mechanisms of allelic variation. Proc Natl Acad Sci USA 83:9149, 1986.