- Email: [email protected]
HLA-DMA allele polymorphism: no impact on kidney allograft outcome
HLA-DMA Allele Polymorphism: No Impact On Kidney Allograft Outcome Elia Saadeh, Michael Szatkowski, Calvin P. H. Vary, Joshua D. Smith, Jonathan Himmelfarb, and Richard J. Mahoney ABSTRACT: The purpose of this study was to analyze the association of HLA-DMA alleles with rejection episodes and early graft loss (EGL) in renal transplant recipients. One hundred and eighty four HLA-DMA alleles were retrospectively analyzed by DNA sequence analysis in 92 kidney transplant recipients. The gene frequencies of HLA-DMA *0101, *0102, *0103 and *0104 were found to be similar in all recipients, regardless of rejection vs non rejection episodes and EGL incidence. In conclu-
ABBREVIATIONS EGL early graft loss MHC major histocompatibility complex Ii invariant chain
INTRODUCTION Major histocompatibility complex (MHC) class I and class II molecules function as foreign targets on allografts but also as immune response communications molecules. MHC class II molecules function as presenters of processed exogenous antigenic peptides. After the biosynthesis of MHC class II molecules, they bind to the invariant chain (Ii) which prevents premature loading of antigenic peptides [1]. In addition, there are genes within the HLA complex, HLA-DMA and HLA-DMB, that encode intracellular accessory molecules that function in the processing of MHC class II molecules [2]. This processing involves the passage of MHC class II proteins through the endoplasmic reticulum as com-
From the Austin Diagnostic Clinic, Austin, TX; NorDx Immunogenetics Laboratory, Portland, ME; Center for Molecular Medicine, Maine Medical Center Research Institute, South Portland, ME; and Division of Nephrology, Maine Medical Center, Portland, ME. Address reprint requests to: Richard J. Mahoney, Ph.D., NorDx Immunogenetics Laboratory, Maine Medical Center-Brighton Campus, 335 Brighton Avenue, Portland, ME 04102-2374. Received August 25, 1999; revised October 14, 1999; accepted November 19, 1999. Human Immunology 61, 345–347 (2000) © American Society for Histocompatibility and Immunogenetics, 2000 Published by Elsevier Science Inc.
sion, HLA-DMA allele polymorphism did not impact renal allograft outcome. Human Immunology 61, 345–347 (2000). © American Society for Histocompatibility and Immunogenetics, 2000. Published by Elsevier Science Inc. KEYWORDS: HLA-DM polymorphism; DNA sequencing; kidney graft outcome
CLIP PCR
class II-associated Ii peptide polymerase chain reaction
plexes with the Ii chain [3]. Ii acts as a chaperon to escort the complex to acidic endocytic-lysosomal compartments [4]. Here, the Ii chain is partially degraded by a proteolytic process which results in the occupation within the HLA class II binding groove by the class II - associated Ii peptide (CLIP) [5]. Next, the intracellular HLA-DMA and DMB proteins enzymatically catalyze the removal of CLIP from the MHC class II groove so as to allow the loading of exogenous peptides [6]. Because HLA-DM proteins play an important role in processing MHC class II molecules, different HLA-DM alleles in kidney allograft recipients may be differentially associated with a more vigorous presentation of foreign donor MHC allopeptides and possibly a state of hyperimmune responsiveness. Chevrier et al. [7] examined this question and found that the polymophisms of HLADMB and LMP2 genes were not associated with kidney graft outcome. However, they did report that the HLADMA *0102 allele was associated with increased rejection episodes reaching statistical significance [7]. In the present study, we attempted to confirm their results by testing for frequency differences in HLA-DMA alleles in 0198-8859/00/$–see front matter PII S0198-8859(99)00178-0
346
E. Saadeh et al.
TABLE 1 HLA-DMA allele frequencies HLA-DMA *0101 *0102 *0103 *0104
German controlsa (n ⫽ 380) 326 30 20 4
85.8%c 7.9%d 5.5%c 1.1%f
French controlsb (n ⫽ 200) 162 24 4 10
French patientsb (n ⫽ 504)
81%c 12%d 2%c 5%f
412 53 32 7
81.8%c 10.5%d 6.3%c 1.4%f
Maine patients (n ⫽ 184) 158 20 4 2
85.9%c 10.9%d 2.2%c 1.1%f
n ⫽ Number of alleles tested. a Data from reference [10]. b Data from reference [7]. c G2 ⫽ 3.34; p ⫽ 0.34 d G2 ⫽ 3.35; p ⫽ 0.34 e G2 ⫽ 7.44; p ⫽ 0.06 f G2 ⫽ 10.8; p ⫽ 0.01
renal allograft recipients experiencing rejection episodes and in recipients who did not experience a rejection event. We also examined HLA-DMA allele frequencies and their association with the incidence of early graft loss. MATERIALS AND METHODS Patients Ninety-two renal allograft recipients (76 primary grafts and 16 regrafts) were typed for the classical HLA class I and class II antigens by serology and for the nonclassical HLA-DMA alleles by automated DNA sequence analysis. Transplants were performed during the period from January 1990 to May 1994 at the Maine Medical Center, Portland, Maine. All recipients were crossmatch negative with donor T cells by the complement dependent antihuman globulin method, and with donor B cells by the 37°C NIH method. Regraft recipients were flow cytometry crossmatch negative with donor T and B cells. Recipients were tested with a standard triple drug immunosuppressive protocol consisting of azathioprine at 2 mg/kg per day, prednisone starting at 1.5–2.0 mg/kg per day, and cyclosporine at 5–12 mg/kg per day. Tapering of drug dosages or withdrawal of a drug was based on clinical indications. HLA-DMA-DNA Sequence Analysis Genomic DNA was extracted and purified from peripheral blood of the 92 renal transplant recipients using a non-phenol/chloroform DNA extraction kit (Isoquick; Orca Research, Inc., Bothell, MA). HLADMA polymorphic sites were amplified by the polymerase chain reaction (PCR) using forward primer 5⬘CTGAAGCCCCTGGAGTTTGG 3⬘ and reverse primer 5⬘GCTGGCATCAAACTCTGGTCT 3⬘ [8].
PCR products were purified by ultrafiltration using a Centricon 30 concentrator (Amicon, Inc., Beverly, MA) and sequenced on an Applied Biosystems, Inc., model 310 DNA capillary based sequencer using the dye– terminator cycle sequencing kit (Perkin Elmer-Applied Biosystems, Foster City, CA). The forward primer, which binds at codon 108 of exon 3 of the HLA-DMA gene was used for sequencing. Alleles were identified by analyzing the sequence data at codons 140,155, and 184. DNA sequence data were queried against Genebank/EMBL–DNA sequence databases for identification using the program BLAST [9]. Statistical Analysis The log-likelihood ratio (G2) test was used for comparison of HLA-DMA alleles in the control and patient groups. Contingency tables and True Epistat software were used; the p ⬍ 0.05 were considered significant. RESULTS AND DISCUSSION Table 1 displays the HLA-DMA allele frequencies found in four different international population groups: German controls [10], French controls [7], French renal transplant recipients [7] and Maine, USA renal transplant patients. No statistically significant differences were found among the 1156 HLA-DMA *0101, *0102, and *0103 alleles tested by three laboratories in the four population groups (n ⫽ 578). A statistically significant difference (p ⫽ 0.01) was found for HLA-DMA allele *0104 (n ⫽ 20 alleles) among the four population groups (n ⫽ 10 individuals). It is likely that the low frequency of this allele (*0104) would be similar in the four population groups had a much larger number of individuals been tested. Chevrier et al. [7] reported that renal transplants recipients who experienced two or more acute
HLA-DMA and Kidney Graft Outcome
347
TABLE 2 HLA-DMA allele frequencies in Maine renal transplant recipients with and without rejection episodes HLA-DMA
Alleles (n ⫽ 184)
*0101 *0102 *0103 *0104
n n n n
⫽ ⫽ ⫽ ⫽
158 20 4 2
Rejectiona (n ⫽ 32) n n n n
⫽ ⫽ ⫽ ⫽
28 3 0 1
87.5% 9.4% 0% 3.1%
No rejectiona (n ⫽ 132a) n n n n
⫽ ⫽ ⫽ ⫽
130 17 4 1
85.5% 11.2% 2.6% 0.6%
n ⫽ Number of alleles tested. a G2 ⫽ 2.73; p ⫽ 0.44
cellular rejection episodes demonstrated a statistically significant increase in allele HLA-DMA *0102 (14.7%) as compared with recipients with no rejection episodes (7.7%); p ⫽ 0.011 and pc ⬍ 0.05 Chi-square test and Yates correction. There were no statistically significant differences for the frequencies of the other three HLADMA alleles. In contrast, we did not find any statistically significant differences in the frequencies of the four HLA-DMA alleles in renal transplant recipients at Maine Medical Center when sorted by acute cellular rejection episodes at 0 –3, 6, and 12 months post-transplantation versus no rejection episodes (Table 2). We also found no DMA allele frequencies differences among 16 transplant recipients in whom early graft loss occurred. (data not shown). Pretransplant identification of a marker for posttransplant hyperimmune responsiveness would be of great value in the selection of HLA matched donorrecipient pairs. Unfortunately, we were not able to confirm that the HLA-DMA *0102 allele is associated with increased rejection episodes, nor did we find DMA allelic difference in patients who experienced early graft loss. ACKNOWLEDGMENTS
The authors wish to thank Louise Letendre for preparing the manuscript, and Glenn E. Palomaki and Louis Neveux for statistical analysis.
REFERENCES 1. Roche PA, Marks MS, Cresswell P: Formation of a ninesubunit complex by HLA class II glycoproteins and the invariant chain. Nature 354:392, 1991. 2. Carrington M, Harding A: Sequence analysis of two novel DMA alleles. Immunogenetics 40:165, 1994. 3. Roche PA, Cresswell P: Invariant chain association with HLA-DR molecules inhibits immunogenic peptide binding. Nature 545:615, 1990. 4. Bakke O, Dobberstein B: MHC Class II-associated invariant chain contains a sorting signal for endosomal compartments. Cell 63:707, 1990. 5. Riberdy JM, Avva RR, Geuze HJ, Cresswell P: Transport and intracellular distribution of MHC class II molecules and associated invariant chain in normal and antigenprocessing mutant cell lines. J Cell Biol 125:1225, 1994. 6. Vogr AB, Knapshofer H, Mololenhauer G, Hammerling GJ: Kinetic analysis of peptide loading onto HLA-DR molecules mediated by HLA-DM. Proc Natl Acad Sci USA 95:9724, 1996. 7. Chevrier D, Giral M, Muller JY, Bignon JD, Soulillou JP: Impact of the MHC-encoded HLA-DMA, DMB and LMP2 gene polymorphism on kidney graft outcome. Hum Immunol 59:650, 1998. 8. Fling SP, Arp B, Pious D: HLA-DMA and DMB genes are both required for MHC class II/peptide complex formation in antigen presenting cells. Nature 368:554, 1994. 9. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local alignment search tool. J Mol Biol 215:403, 1990. 10. Tiesserenc H, Besnault L, Briard I, Busson M, Albert E, Bignon JD, Caraballo L, Charron D, Danze PM, Louie L, Mora B, Semana G, Powis SH: TAP, LMP and HLA-DM polymorphism: 12th International Histocompatibility Workshop study. In Charron D (ed): Proceedings of the Twelfth Histocompatibililty Workshop and Conference. Genetic Diversity of HLA 1996, Vol. I. Souvres, France: Medical and Scientific International Publisher, 1997:159.
ABBREVIATIONS EGL early graft loss MHC major histocompatibility complex Ii invariant chain
INTRODUCTION Major histocompatibility complex (MHC) class I and class II molecules function as foreign targets on allografts but also as immune response communications molecules. MHC class II molecules function as presenters of processed exogenous antigenic peptides. After the biosynthesis of MHC class II molecules, they bind to the invariant chain (Ii) which prevents premature loading of antigenic peptides [1]. In addition, there are genes within the HLA complex, HLA-DMA and HLA-DMB, that encode intracellular accessory molecules that function in the processing of MHC class II molecules [2]. This processing involves the passage of MHC class II proteins through the endoplasmic reticulum as com-
From the Austin Diagnostic Clinic, Austin, TX; NorDx Immunogenetics Laboratory, Portland, ME; Center for Molecular Medicine, Maine Medical Center Research Institute, South Portland, ME; and Division of Nephrology, Maine Medical Center, Portland, ME. Address reprint requests to: Richard J. Mahoney, Ph.D., NorDx Immunogenetics Laboratory, Maine Medical Center-Brighton Campus, 335 Brighton Avenue, Portland, ME 04102-2374. Received August 25, 1999; revised October 14, 1999; accepted November 19, 1999. Human Immunology 61, 345–347 (2000) © American Society for Histocompatibility and Immunogenetics, 2000 Published by Elsevier Science Inc.
sion, HLA-DMA allele polymorphism did not impact renal allograft outcome. Human Immunology 61, 345–347 (2000). © American Society for Histocompatibility and Immunogenetics, 2000. Published by Elsevier Science Inc. KEYWORDS: HLA-DM polymorphism; DNA sequencing; kidney graft outcome
CLIP PCR
class II-associated Ii peptide polymerase chain reaction
plexes with the Ii chain [3]. Ii acts as a chaperon to escort the complex to acidic endocytic-lysosomal compartments [4]. Here, the Ii chain is partially degraded by a proteolytic process which results in the occupation within the HLA class II binding groove by the class II - associated Ii peptide (CLIP) [5]. Next, the intracellular HLA-DMA and DMB proteins enzymatically catalyze the removal of CLIP from the MHC class II groove so as to allow the loading of exogenous peptides [6]. Because HLA-DM proteins play an important role in processing MHC class II molecules, different HLA-DM alleles in kidney allograft recipients may be differentially associated with a more vigorous presentation of foreign donor MHC allopeptides and possibly a state of hyperimmune responsiveness. Chevrier et al. [7] examined this question and found that the polymophisms of HLADMB and LMP2 genes were not associated with kidney graft outcome. However, they did report that the HLADMA *0102 allele was associated with increased rejection episodes reaching statistical significance [7]. In the present study, we attempted to confirm their results by testing for frequency differences in HLA-DMA alleles in 0198-8859/00/$–see front matter PII S0198-8859(99)00178-0
346
E. Saadeh et al.
TABLE 1 HLA-DMA allele frequencies HLA-DMA *0101 *0102 *0103 *0104
German controlsa (n ⫽ 380) 326 30 20 4
85.8%c 7.9%d 5.5%c 1.1%f
French controlsb (n ⫽ 200) 162 24 4 10
French patientsb (n ⫽ 504)
81%c 12%d 2%c 5%f
412 53 32 7
81.8%c 10.5%d 6.3%c 1.4%f
Maine patients (n ⫽ 184) 158 20 4 2
85.9%c 10.9%d 2.2%c 1.1%f
n ⫽ Number of alleles tested. a Data from reference [10]. b Data from reference [7]. c G2 ⫽ 3.34; p ⫽ 0.34 d G2 ⫽ 3.35; p ⫽ 0.34 e G2 ⫽ 7.44; p ⫽ 0.06 f G2 ⫽ 10.8; p ⫽ 0.01
renal allograft recipients experiencing rejection episodes and in recipients who did not experience a rejection event. We also examined HLA-DMA allele frequencies and their association with the incidence of early graft loss. MATERIALS AND METHODS Patients Ninety-two renal allograft recipients (76 primary grafts and 16 regrafts) were typed for the classical HLA class I and class II antigens by serology and for the nonclassical HLA-DMA alleles by automated DNA sequence analysis. Transplants were performed during the period from January 1990 to May 1994 at the Maine Medical Center, Portland, Maine. All recipients were crossmatch negative with donor T cells by the complement dependent antihuman globulin method, and with donor B cells by the 37°C NIH method. Regraft recipients were flow cytometry crossmatch negative with donor T and B cells. Recipients were tested with a standard triple drug immunosuppressive protocol consisting of azathioprine at 2 mg/kg per day, prednisone starting at 1.5–2.0 mg/kg per day, and cyclosporine at 5–12 mg/kg per day. Tapering of drug dosages or withdrawal of a drug was based on clinical indications. HLA-DMA-DNA Sequence Analysis Genomic DNA was extracted and purified from peripheral blood of the 92 renal transplant recipients using a non-phenol/chloroform DNA extraction kit (Isoquick; Orca Research, Inc., Bothell, MA). HLADMA polymorphic sites were amplified by the polymerase chain reaction (PCR) using forward primer 5⬘CTGAAGCCCCTGGAGTTTGG 3⬘ and reverse primer 5⬘GCTGGCATCAAACTCTGGTCT 3⬘ [8].
PCR products were purified by ultrafiltration using a Centricon 30 concentrator (Amicon, Inc., Beverly, MA) and sequenced on an Applied Biosystems, Inc., model 310 DNA capillary based sequencer using the dye– terminator cycle sequencing kit (Perkin Elmer-Applied Biosystems, Foster City, CA). The forward primer, which binds at codon 108 of exon 3 of the HLA-DMA gene was used for sequencing. Alleles were identified by analyzing the sequence data at codons 140,155, and 184. DNA sequence data were queried against Genebank/EMBL–DNA sequence databases for identification using the program BLAST [9]. Statistical Analysis The log-likelihood ratio (G2) test was used for comparison of HLA-DMA alleles in the control and patient groups. Contingency tables and True Epistat software were used; the p ⬍ 0.05 were considered significant. RESULTS AND DISCUSSION Table 1 displays the HLA-DMA allele frequencies found in four different international population groups: German controls [10], French controls [7], French renal transplant recipients [7] and Maine, USA renal transplant patients. No statistically significant differences were found among the 1156 HLA-DMA *0101, *0102, and *0103 alleles tested by three laboratories in the four population groups (n ⫽ 578). A statistically significant difference (p ⫽ 0.01) was found for HLA-DMA allele *0104 (n ⫽ 20 alleles) among the four population groups (n ⫽ 10 individuals). It is likely that the low frequency of this allele (*0104) would be similar in the four population groups had a much larger number of individuals been tested. Chevrier et al. [7] reported that renal transplants recipients who experienced two or more acute
HLA-DMA and Kidney Graft Outcome
347
TABLE 2 HLA-DMA allele frequencies in Maine renal transplant recipients with and without rejection episodes HLA-DMA
Alleles (n ⫽ 184)
*0101 *0102 *0103 *0104
n n n n
⫽ ⫽ ⫽ ⫽
158 20 4 2
Rejectiona (n ⫽ 32) n n n n
⫽ ⫽ ⫽ ⫽
28 3 0 1
87.5% 9.4% 0% 3.1%
No rejectiona (n ⫽ 132a) n n n n
⫽ ⫽ ⫽ ⫽
130 17 4 1
85.5% 11.2% 2.6% 0.6%
n ⫽ Number of alleles tested. a G2 ⫽ 2.73; p ⫽ 0.44
cellular rejection episodes demonstrated a statistically significant increase in allele HLA-DMA *0102 (14.7%) as compared with recipients with no rejection episodes (7.7%); p ⫽ 0.011 and pc ⬍ 0.05 Chi-square test and Yates correction. There were no statistically significant differences for the frequencies of the other three HLADMA alleles. In contrast, we did not find any statistically significant differences in the frequencies of the four HLA-DMA alleles in renal transplant recipients at Maine Medical Center when sorted by acute cellular rejection episodes at 0 –3, 6, and 12 months post-transplantation versus no rejection episodes (Table 2). We also found no DMA allele frequencies differences among 16 transplant recipients in whom early graft loss occurred. (data not shown). Pretransplant identification of a marker for posttransplant hyperimmune responsiveness would be of great value in the selection of HLA matched donorrecipient pairs. Unfortunately, we were not able to confirm that the HLA-DMA *0102 allele is associated with increased rejection episodes, nor did we find DMA allelic difference in patients who experienced early graft loss. ACKNOWLEDGMENTS
The authors wish to thank Louise Letendre for preparing the manuscript, and Glenn E. Palomaki and Louis Neveux for statistical analysis.
REFERENCES 1. Roche PA, Marks MS, Cresswell P: Formation of a ninesubunit complex by HLA class II glycoproteins and the invariant chain. Nature 354:392, 1991. 2. Carrington M, Harding A: Sequence analysis of two novel DMA alleles. Immunogenetics 40:165, 1994. 3. Roche PA, Cresswell P: Invariant chain association with HLA-DR molecules inhibits immunogenic peptide binding. Nature 545:615, 1990. 4. Bakke O, Dobberstein B: MHC Class II-associated invariant chain contains a sorting signal for endosomal compartments. Cell 63:707, 1990. 5. Riberdy JM, Avva RR, Geuze HJ, Cresswell P: Transport and intracellular distribution of MHC class II molecules and associated invariant chain in normal and antigenprocessing mutant cell lines. J Cell Biol 125:1225, 1994. 6. Vogr AB, Knapshofer H, Mololenhauer G, Hammerling GJ: Kinetic analysis of peptide loading onto HLA-DR molecules mediated by HLA-DM. Proc Natl Acad Sci USA 95:9724, 1996. 7. Chevrier D, Giral M, Muller JY, Bignon JD, Soulillou JP: Impact of the MHC-encoded HLA-DMA, DMB and LMP2 gene polymorphism on kidney graft outcome. Hum Immunol 59:650, 1998. 8. Fling SP, Arp B, Pious D: HLA-DMA and DMB genes are both required for MHC class II/peptide complex formation in antigen presenting cells. Nature 368:554, 1994. 9. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local alignment search tool. J Mol Biol 215:403, 1990. 10. Tiesserenc H, Besnault L, Briard I, Busson M, Albert E, Bignon JD, Caraballo L, Charron D, Danze PM, Louie L, Mora B, Semana G, Powis SH: TAP, LMP and HLA-DM polymorphism: 12th International Histocompatibility Workshop study. In Charron D (ed): Proceedings of the Twelfth Histocompatibililty Workshop and Conference. Genetic Diversity of HLA 1996, Vol. I. Souvres, France: Medical and Scientific International Publisher, 1997:159.