Human enhancer of filamentation 1-induced colorectal cancer cell migration: Role of serine phosphorylation and interaction with the breast cancer anti-estrogen resistance 3 protein

The International Journal of Biochemistry & Cell Biology 64 (2015) 45–57

Contents lists available at ScienceDirect

The International Journal of Biochemistry & Cell Biology journal homepage: www.elsevier.com/locate/biocel

Human enhancer of filamentation 1-induced colorectal cancer cell migration: Role of serine phosphorylation and interaction with the breast cancer anti-estrogen resistance 3 protein Rama Ibrahim a,b , Antoinette Lemoine c , Jacques Bertoglio a , Joël Raingeaud a,∗ a

INSERM U749, Institut Gustave Roussy, Université Paris-sud, Villejuif 94800, France Department of Biochemistry and Microbiology, Faculty of Pharmacy, Tichrine University, Latakia, Syria c INSERM U1004, Laboratoire de biochimie, Hopital Paul Brousse, Université Paris-sud, Villejuif 94800, France b

a r t i c l e

i n f o

Article history: Received 9 December 2014 Received in revised form 11 March 2015 Accepted 18 March 2015 Available online 25 March 2015 Keywords: Colorectal cancer Nedd9 Focal adhesion kinase BCAR3 Phosphorylation

a b s t r a c t Human enhancer of filamentation 1 (HEF1) is a member of the p130Cas family of docking proteins involved in integrin-mediated cytoskeleton reorganization associated with cell migration. Elevated expression of HEF1 promotes invasion and metastasis in multiple cancer cell types. To date, little is known on its role in CRC tumor progression. HEF1 is phosphorylated on several Ser/Thr residues but the effects of these post-translational modifications on the functions of HEF1 are poorly understood. In this manuscript, we investigated the role of HEF1 in migration of colorectal adeno-carcinoma cells. First, we showed that overexpression of HEF1 in colo-carcinoma cell line HCT116 increases cell migration. Moreover, in these cells, HEF1 increases Src-mediated phosphorylation of FAK on Tyr-861 and 925. We then showed that HEF1 mutation on Ser-369 enhances HEF1-induced migration and FAK phosphorylation as a result of protein stabilization. We also, for the first time characterized a functional mutation of HEF1 on Arg-367 which mimics the effect of Ser-369 to Ala mutation. Finally through mass spectrometry experiments, we identified BCAR3 as an essential interactor and mediator of HEF1-induced migration. We demonstrated that single amino acid mutations that prevent formation of the HEF1-BCAR3 complex impair HEF1-mediated migration. Therefore, amino-acid substitutions that impede Ser-369 phosphorylation stabilize HEF1 which increases the migration of CRC cells and this latter effect requires the interaction of HEF1 with the NSP family adaptor protein BCAR3. Collectively, these data reveal the importance of HEF1 expression level in cancer cell motility and then support the utilization of HEF1 as a biomarker of tumor progression. © 2015 Elsevier Ltd. All rights reserved.

1. Introduction HEF1, also known as Nedd9 or Cas-L, is one of the proteins that have been associated with tumor progression. Indeed, HEF1 upregulation has been linked to enhanced invasion and metastasis

Abbreviations: BCAR3, breast cancer anti-estrogen resistance 3; Cas, Crk-associated substrate; CHAT-H, Cas/HEF1-associated signal transducerhematopoietic; CHX, cycloheximide; CRC, colorectal cancer; FAK, focal adhesion kinase; GEF, guanine nucleotide-exchange factor; HEF1, human enhancer of filamentation-1; HSC70, heat shock cognate 70; IHC, immunohistochemistry; MMP, matrix metalloproteinase; Nd, nocodazole; Nedd9, neural precursor cell expressed, developmentally down-regulated 9; NSP, novel SH2-containing proteins; OA, okadaic acid; PGE2, prostaglandin E2; PP2A, protein phosphatase 2A; SH2, Src homology domain-2. ∗ Corresponding author. Tel.: +33 1 42114211x3752; fax: +33 1 42115308. E-mail address: [email protected] (J. Raingeaud). http://dx.doi.org/10.1016/j.biocel.2015.03.014 1357-2725/© 2015 Elsevier Ltd. All rights reserved.

in different cancer types including breast, glioblastoma, head and neck squamous cell carcinomas, lung and melanoma (Izumchenko et al., 2009; Ji et al., 2007; Kim et al., 2006; Kong et al., 2011; Lucas et al., 2010; Natarajan et al., 2006). HEF1 involvement in tumor development depends on cancer cell type where its contribution includes tumor growth (Li et al., 2011; Little et al., 2013), metastasis process, epithelial-mesenchymal transition (Kong et al., 2011; Tikhmyanova and Golemis, 2011), mesenchymal movement (SanzMoreno et al., 2008) and invasion (Fashena et al., 2002). Recently, Li et al. reported an increased HEF1 expression in colorectal cancer as a target of Wnt signaling promoting cell migration (Li et al., 2011). Although most studies described a positive effect of HEF1 on motility, HEF1 can negatively regulate MCF10A migration and its down-regulation is part of a signature for breast cancer metastasis (Minn et al., 2005; Simpson et al., 2008). These apparent controversial data highlight the complexity of HEF1 involvement in tumor progression.

46

R. Ibrahim et al. / The International Journal of Biochemistry & Cell Biology 64 (2015) 45–57

HEF1 belongs to the p130Cas family of proteins. It is a multidomain scaffolding protein participating to the integrin dependent signaling in a complex with the tyrosine kinases FAK and Src which in turn, regulate various downstream signaling pathways. FAK constitutes a key component of the migration machinery and is primarily activated through an auto-phosphorylation on Tyr-397 residue then undergoes additional phosphorylations on Tyr-576/Tyr-577, Tyr-861 and Tyr-925 in a Src family kinases dependent manner. This pathway controls downstream cellular processes like adhesion, migration and/or proliferation (AbuGhazaleh et al., 2001; Deramaudt et al., 2011; Mitra and Schlaepfer, 2006). In addition to tyrosine kinases, HEF1 can form a complex with tyrosine phosphatases, adaptors, ubiquitin ligases, or GEF domain proteins. NSP (Novel Sh2 containing Proteins) belong to this latter family of proteins whose GEF activity has not been formally established but their interaction with p130Cas family indirectly regulates GTPases and contributes to cell motility and adhesion remodeling (Wallez et al., 2012). These proteins have been linked to increased cell migration in various cancers (Guerrero et al., 2012; Wallez et al., 2012). Besides the well-documented correlation between tumor progression and increased HEF1 expression, much less is known about the role of HEF1 post-translational modifications, especially phosphorylations, on its properties. HEF1 possesses a substrate domain containing several YXXP motifs and a serine-rich region; both constituting potential phosphorylation sites. As in a vast majority of proteins, these phosphorylations presumably fundamentally modify HEF1 functions. Indeed, HEF1 is a FAK and Src substrate, its interacting properties being regulated in part by tyrosine phosphorylations (O’Neill et al., 2000, Singh et al., 2007). Furthermore, HEF1 undergoes Ser/Thr phosphorylations. As a matter of fact, on Western blot, HEF1 appears as two species of different electrophoretic mobility referred to as p105 and p115 (Zheng and McKeown-Longo, 2002, 2006). To date two Ser/Thr phosphorylation sites have been described. HEF1 interacts with and activates Aurora A kinase which in turn phosphorylates HEF1 on Ser-296 (Pugacheva and Golemis, 2005). In addition, we have previously identified another phosphorylation on Ser-369 and have shown that it accounts for the p115 shift and targets HEF1 to degradation by the proteasome (Hivert et al., 2009). Little data are available on regulation of these phosphorylations. Phosphorylation of HEF1 on Ser/Thr residues and appearance of the p115 isoform have been described as a result of cell adhesion; furthermore, p115 is the species preferentially targeted to proteasomal degradation (Nourry et al., 2004, Zheng and McKeown-Longo, 2006). HEF1 Ser/Thr dephosphorylation seems to depend on PP2A phosphatase (Zheng and McKeownLongo, 2006). Finally, recently, HEF1 mutations were reported in tumor samples in several databases (http://cancer.sanger.ac.uk/; http://www.cbioportal.org/). However, to date the functional significance of these mutations has not been identified. In this study, using cancer cell line models, we investigated the mechanisms by which HEF1 is regulated and increases cell migration.

2. Materials and methods 2.1. Cell culture Human colorectal cancer cell lines (HCT116, Caco-2, SW480, Isreco-1 and Colo-205) were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA). All cell lines except HCT116 were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Fisher Scientific, Illkirch, FR) supplemented with antibiotics (50 ␮g/ml penicillin, 50 ␮g/ml streptomycin), 1 mM sodium pyruvate and 10% fetal calf serum (FCS) at 37 ◦ C with 5% CO2

atmosphere. HCT116 cell line was cultured in McCoy’s 5 A medium (Fisher Scientific, Illkirch, FR) with antibiotics, sodium pyruvate and 10% FCS as mentioned above. 2.2. Reagents and antibodies Okadaic acid and the Src inhibitor (PP2) were purchased from Calbiochem (VWR, Strasbourg, FR) and were added to the culture medium at final concentration of 125 nM and 2 ␮M respectively. Cycloheximide (CHX) and Nocodazole (Nd) were purchased from Sigma–Aldrich (St Louis, MO, USA) and were used at final concentration of 140 ␮M and 300 nM respectively. Anti-HEF1 (2G9) monoclonal antibody was from ImmuQuest (Antibodies-online, Aachen, Germany) Anti-Flag (M2) monoclonal antibody, antiBCAR3, anti-NSP1 and puromycin were from Sigma–Aldrich (St Louis, MO, USA). Anti-V5 antibody was from ABD Serotec (Dusseldorf, Germany). Anti-Phospho-Ser-369-HEF1 polyclonal antibody was generated as previously described (Hivert, Pierre, 2009). AntiHSC70 monoclonal antibody was from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Anti-FAK and anti-Phospho-Tyr FAK antibodies were from Cell Signaling Technology (Ozyme, Saint Quentin en Yvelines, FR). Doxycycline was from Enzo Life sciences (Lyon, FR). 2.3. Expression of exogenous proteins For inducible overexpression of Flag-HEF1, the plasmid pTRIPZ-Flag-HEF1 was generated as follows: the complete coding sequence of HEF1 was cut with XmaI/XhoI restriction enzymes from a pCMV-Flag-HEF1 vector previously constructed (Hivert et al., 2009), and then cloned in the pTRIPZ lentiviral vector (Open BioSystems, Huntsville, Al, USA) downstream of a promoter regulated by a tetracycline responsive element. A stop codon linker was synthesized using following oligonucleotides: 5 -TCGAGTGACCGGTACCGGCGCGCCTACGTATG-3 (sense), 5 (antisense). AATTCATACGTAGGCGCGCCGGTACCGGTCACT-3 When hybridized, these oligonuceotides gave a double stranded fragment with XhoI and EcoRI ends that was inserted into pTRIPZ vector, downstream of HEF1 sequence, between XhoI and EcoRI restriction sites. pTRIPZ-Flag-HEF1 S296A, pTRIPZ-Flag-HEF1 S369A, pTRIPZ-Flag-HEF1 R367Q and pTRIPZ-Flag-HEF1 L751D were generated using oligonucleotide-directed PCR mutagenesis to create a Ser to Ala, an Arg to Gln or a Leu to Asp replacement at amino-acids 296, 369, 367 and 751 respectively. Cells infected with the different Flag-HEF1 containing plasmids or the related empty vector were selected with puromycin at 2 ␮g/ml. To induce Flag-HEF1 expression, cells were treated with 250 ng/ml doxycycline (unless stated differently in the figure legends) for 48 h prior to experiments. For BCAR3 stable overexpression, BCAR3 cDNA was first mutated on the sequence targeted by the BCAR3 shRNA using the oligonucleotides: 5 -GCTATGGGGCAGCAAAGGAGCCCAGGTGAACCAGACAGAGAGATATGAG-3 (sense) and 5 CTCATATCTCTCTGTCTGGTTCACCTGGGCTCCTTTGCTGCCCCATAGC3 (antisense) and inserted, through the Gateway® technology, from pDONR-BCAR3 (Thermo Scientific, Rockford, IL, USA) into pLX-302 lentiviral vector (Addgene, Cambridge, MA, USA). pLX302-BCAR3 R748A vector was generated from pLX-302-BCAR3 wt vector by oligonucleotide-directed PCR mutagenesis. Cells infected with BCAR3 related plasmids were selected with blasticidin at 10 ␮g/ml (Cayla, Toulouse, FR). Correct sequence of all plasmids was confirmed by DNA sequencing. 2.4. shRNA-mediated knockdown of HEF1, BCAR3 and NSP1 To turn off the expression of endogenous HEF1, BCAR3 and NSP1 proteins, lentiviral vectors pLKO-shHEF1, pGIPZ-shBCAR3

R. Ibrahim et al. / The International Journal of Biochemistry & Cell Biology 64 (2015) 45–57

and pGIPZ-shNSP1 (Open BioSystems, Huntsville, Al, USA) and their related empty vectors were used. Lentiviral stocks were prepared as previously described by Naldini (Naldini et al., 1996). For cell transduction, targeted cells were plated at low cell density (30,000 cells/well) in a 24 well dish. After 24 h, lentiviral particles were added onto cells and the culture incubated for another 24 h. Two days later, cells were washed twice and culture medium was changed. Knockdown efficiency was determined by Western blot. 2.5. Quantitative-PCR Total RNA was extracted with Trizol (Life Technologies, Saint Aubin, France) as described by the manufacturer’s instruction and quantified at OD260nm . 2 ␮g of total cellular RNA were reverse-transcribed using an Oligo dT primer and 1.6 unit of AMV reverse transcriptase (Promega, Madison, WI, USA) and then used as template for PCR. Equivalent quantities of cDNA were amplified by real time PCR using the Applied Biosystems SYBR-Select Master Mix (Life Technologies, Saint Aubin, France). The cycling conditions were 94 ◦ C for 15 s, 60 ◦ C for 20 s and 72 ◦ C for 1 min for a total of 35 cycles. The specific pairs of primers were 5 -GAGAGGAGCTGGATGGATGAC-3 and 5 GGCTGAGCTGACACAACTGA-3 for HEF1 and 5 -GTGAAGGTCGGAGTCAACG-3 and 5 -TGAGGTCAATGAAGGGGTC-3 for GAPDH. 2.6. Cell lysis, immunoblotting and immunoprecipitation Cells were washed twice with ice-cold PBS buffer and scraped into lysis buffer as previously described (Hivert, Pierre, 2009). For Western blots, aliquots of cell lysates containing equal amount of protein were subjected to SDS-PAGE under reducing conditions, transferred to a Hybond-C nitrocellulose membrane (Amersham Biosciences, Saclay, FR) and probed with appropriate antibodies. For HEF1 containing samples, a gel of acrylamide/bisacrylamide (ratio 30:0.2) was used to improve separation of Ser/Thr phosphorylation-induced migration shifts. Immunocomplexes were detected using enhanced chemiluminescence (Clinisciences, Montrouge, FR). For immunoprecipitation, 1–2 mg of cell lysates were incubated with 1 ␮g of specific antibodies and 25 ␮l of protein G-sepharose beads (GE Healthcare, Velizy-Villacoublay, FR) for 2 h at 4 ◦ C with continuous shaking. The beads were collected, washed 4 times with lysis buffer and then resuspended in Laemmli buffer. Immunoprecipitates were next analyzed by Western blot procedure as described above.

47

SEARCH: SwissProt database; Homo sapiens; trypsin; 2 missed cleavages; oxidized methionine (M), phosphorylated S, T, Y, masses are monoisotopic; precursor mass tolerance ±2 Da and product mass tolerance ±0.8 Da. 2.8. Cell migration assays Transwell migration assay was performed using 24-well transwell units with 8 ␮m porous polycarbonate membranes from BD Biosciences (Le Pont de Claix, FR). The top chamber was seeded with 5 × 104 cells/well and was filled with McCoy’s 5A medium supplemented with 0.1% FCS, whereas the bottom chamber was filled with 10% FBS/McCoy’s 5A medium. After 40–48 h of incubation, cells on the upper surface were removed by scrubbing with a cotton swab; filters were then stained for 10 min with a Crystal Violet staining solution from Cell Biolabs, Inc. (Mundolsheim, FR). Crystal Violet incorporated in migrating cells was eluted in 10% acetic acid and optic density of the eluate was measured at  = 520 nm. Wound-healing migration assay was performed using the IBIDITM Culture-Inserts system (Biovalley, Marne la Vallee, FR). The Culture-Inserts were placed in a petri dish (35 mm in diameter), and cells were seeded in each well of Culture-Insert at a density of 1 × 105 cells/well. After incubation for one day, the Culture-Insert was removed, and the cell-free gap created was photographed using an inverted microscope (Axiovert 200M; Zeiss, Jena, Germany). Cell culture dishes were then placed in an incubator which provides constant temperature at 37 ◦ C and 5% CO2 . After 24 h, cells were photographed again in three different regions to evaluate cell motility within the cell-free gap. 2.9. Cell proliferation assay Cell proliferation was assessed using the WST-1 reagent (Roche Diagnostics GmbH) according to the manufacturer’s instructions. This test measures the metabolic activity of viable cells, based on the cleavage of the tetrasolium salt (WST-1) to formazan by mitochondrial dehydrogenases in viable cells. Cells were seeded onto 96 well plates (1000 cells/well) and allowed to adhere for 2 h. The first time point (day 0) was then analyzed by adding 10 ␮l of WST1 reagent in each well and incubating the plate for 1 h at 37 ◦ C and 5% CO2 . Absorbance of formed formazan dye was measured at  = 450 nm. The same procedure was repeated on day 1, 2, 3 and 4 to compare cell growth pattern between different cell lines. 2.10. Statistical analysis

2.7. Mass spectrometry Protein immunoprecipitation was performed as described above with minor modifications. Prior to the immunoprecipitation, cell lysates equivalents to 4 mg of proteins were precleared by incubation with 25 ␮l of G-sepharose beads for 1 h. Lysates were then incubated with agarose beads coupled to the anti-Flag (M2) antibody to immunoprecipitate Flag-tagged overexpressed HEF1. After washing steps of the agarose beads, HEF1-protein complex was competitively eluted from the beads with a Flag peptide (Sigma–Aldrich, St Louis, MO, USA) used at a concentration of 100 ␮g/ml. HEF1-immunoprecipitates were subjected to SDS-PAGE separation and the acrylamide gel was next colored with colloidal blue staining to visualize different protein bands. Gel bands were then cut and digested as described by Saade (Saade et al., 2009). The peptides mixtures were analyzed with nano-HPLC (Agilent Technologies 1200) directly coupled to an ion trap mass spectrometer (BRUKER 6300 series) equipped with a nano-electropsray source. The data were analyzed on Spectrum Mill MS Proteomics Workbench Rev A.03.03.084 SR4, with the following settings: DATA EXTRACTOR: MH +200 to 4400 Da; Scan range 0 to 30 min. MS/MS

All error bars on histograms and curves show the standard error of the mean (SEM) of at least three independent experiments performed in duplicates. Statistical significance was determined by two-tailed Student’s t-test. (ns) (statistically not significant): Pvalue ≥0.05. (*): P-value <0.05. (**): P-value <0.01. (***): P-value <0.001. 3. Results 3.1. Increased HEF1 expression in colorectal cancer (CRC) augments cell migration HEF1 expression is up-regulated during tumor progression in different types of cancer (Li, Bavarva, 2011, Xia et al., 2010). In line with published data, we also observed, using immunohistochemistry (IHC) staining of Tissue Micro Array sections, augmented HEF1 signal in the more advanced tumor stages (data not shown). To establish a suitable model to study the function of HEF1 in CRC, we next screened for HEF1 protein expression in various colorectal cancer cell lines. As shown in Fig. 1A, HEF1 is differentially

48

R. Ibrahim et al. / The International Journal of Biochemistry & Cell Biology 64 (2015) 45–57

Fig. 1. HEF1 induces cell migration in CRC. (A) Western blotting analysis of endogenous HEF1 expression in CRC cell lines. HSC70 was used as a loading control. (B) Endogenous expression of HEF1 in the Isreco-1 cell line was silenced by lentiviral pLKO-shHEF1 vectors (A1 and A3) and the empty vector was used as control (pLKO-Ctrl). HEF1 knockdown was assessed by Western blotting analysis (upper panel). Capacity of cells to migrate was analyzed by Transwell migration assay (lower panel). Data shown as relative optic density (OD) of eluted crystal violet used to stain migrating cells. (C) Stable HCT116 cell lines incorporating empty or doxycycline-inducible pTRIPZ-Flag-HEF1 vectors were treated or not for 48 h with doxycycline at a concentration of 250 ng/ml and the corresponding cell lysates were subjected to Western blotting analysis. (D) Cell migration analysis by Transwell migration assay of HCT116 cell line overexpressing HEF1 versus the empty vector cell line after treatment with 250 ng/ml doxycycline for 48 h. Data shown as in (B) (upper panel) and representative images of migrating cells (lower panel). (E) Cell migration analysis by wound healing assay of the same cell lines used in (D). (F) Proliferation rate of HCT116 over-expressing HEF1 versus the empty vector cell line as measured by WST-1 proliferation assay. Error bars of all migration and proliferation experiments were established from results of five independent experiments.

expressed, either as a single band or as a doublet of apparent molecular mass of 105 kDa and 115 kDa resulting from two different Ser/Thr phosphorylation states of the protein as previously described (Hivert et al., 2009; Zheng and McKeown-Longo, 2002).

To assess HEF1 contribution to CRC migration, we first knocked down endogenous HEF1 in Isreco-1 CRC cell line. As observed in Fig. 1B, compared to control cells, HEF1 silencing lowers cell migration capacities in Transwell migration assay. To confirm this

R. Ibrahim et al. / The International Journal of Biochemistry & Cell Biology 64 (2015) 45–57

pro-migratory effect of HEF1 in CRC, we then chose the HCT116 cell line derived from a colorectal primary tumor lacking endogenous HEF1 (Fig. 1A) and established stable HCT116 culture expressing inducible HEF1 protein (Tet On system). As observed in Fig. 1C, treatment of the cells with doxycycline induced HEF1 expression, both p105 and p115 being present, indicating that HEF1 undergoes Ser/Thr phosphorylation. We then examined HEF1 effects on HCT116 migration and proliferation. While HEF1 expression increased cell migration either in a Transwell migration (Fig. 1D) or in a wound healing assay (Fig. 1E), HEF1 seems to have no effect on cell proliferation (Fig. 1F). All together, these results indicate that HEF1 expression positively regulates migration of CRC cells. 3.2. HEF1 phosphorylation on Serine 369 modulates HEF1 pro-migratory capacities Pugacheva et al. demonstrated that HEF1 was phosphorylated on Ser-296 especially during mitosis and we previously showed that HEF1 undergoes a second phosphorylation on Ser-369; both being regulated in a PP2A dependent manner (as revealed with a PP2A inhibitor: OA) and each characterized by a specific migration shift on Western blot (Hivert et al., 2009; Pugacheva and Golemis, 2005) (Fig. 2A, panel OA). First we sought to examine whether these phosphorylations of HEF1 occur during cell culture. To test this, we treated cells with Nocodazole (Nd), an inhibitor of tubulin polymerization that blocks cells in early prometaphase. As shown in Fig. 2A, comparison of HEF1 detection profile on WB after SDS PAGE separation in OA and Nocodazole treated cells, reveals a similar pattern of migration (lane wt). Furthermore, as compared to OA, these Nocodazole-induced phosphorylations (at least for Ser-296) target the same serine residues because mutations of either Ser296, Ser-369 or both to Ala prevent related migration shifts. These data suggest that Ser-296 and Ser-369 phosphorylations actually occur during cell culture independently and each displays a specific migration shift (Fig. 2A, lane S296A, S369A and SSAA). Of note, as observed in Fig. 2B, left panel, lane NS (non synchronized cells), the p115 band is present in wt and S296A mutated HEF1, but not in lysates where HEF1 is mutated on Ser-369 suggesting that p115 band in wt HEF1 corresponds to Ser-369 phosphorylated form. This data is confirmed with an anti-Phospho-Ser-369-HEF1 specific antibody (Fig. 2B lane NS right panel and Fig. 2C). In order to assess the regulation of such phosphorylations on Ser-296 and Ser-369 during cell cycle, cells were arrested in G2/M with Nd and then growth was reinitiated for 4h30 upon Nd release. HEF1 profile was analyzed by WB with both anti-HEF1 and anti-Phospho-Ser369-HEF1 specific antibodies. As observed in Fig. 2B lane S369A, Ser-296 is transiently phosphorylated mainly at prometaphase (as revealed by migration shift); this band then decreased until disappearing about 4h30 later. Strikingly, the Ser-369 phosphorylation signal seems to be relatively stable along mitosis progression (lane S296A, and quantification in Fig. S1). A WB with the anti-PhosphoSer-369-HEF1 antibody confirms the constitutive phosphorylation on Ser-369 of a pool of HEF1 (right panel, marked by an arrow). In summary, using Ser to Ala mutation analyses, we have been able to characterize and discriminate phosphorylation of Ser-296 and Ser-369 of HEF1. These data also support a hypothesis whereby Ser369 phosphorylation could mediate a more constitutive process, e.g. regulating the overall HEF1 expression level through targeting the protein to proteasomal degradation as demonstrated earlier (Nourry, Maksumova, 2004) or cell motility. To study this hypothesis, we established stable HCT116 cell lines expressing inducible mutated forms of HEF1, and then examined cell migration capacities. First, an increase in global HEF1 expression in S369A mutated HEF1 is observed as compared to wt or S296A mutated HEF1 (Fig. 2C). This agrees with our previous results showing that Ser-369 mutation prevents HEF1 degradation (Hivert

49

et al., 2009). Moreover, Fig. 2D shows that, S369A but not S296A mutation, enhances HEF1 pro-migratory effect. This result suggests that S369A mutation enhances cell migration potentially through increasing total HEF level. To address this, we used increasing doxycycline concentrations to examine the dose-response effect of HEF1 expression on cell migration. As depicted in Fig. 2E, indeed, HEF1 increases HCT116 cell migration in a dose-dependent manner. 3.3. R367Q mutation mimics S369A effect on HEF1 To date, no HEF1 mutation linked to pathologies has been described. However, the Sanger Institute/COSMIC and cBioPortal for cancer genomics databases (http://cancer.sanger.ac.uk/; http://www.cbioportal.org/) provide a list of mutations identified from tumor samples. A Ser-369 to Pro mutation was identified in a glioma. Also, a mutation of the Arg-367 to Gln has been characterized in an upper aero-digestive tumor and in a head and neck squamous cell carcinoma (HNSCC) biopsies. In fact, although the kinase phosphorylating Ser-369 has not been identified yet, Arg-367 and Ser-369 are in a motif Arg367 -X-Ser369 that could potentially be part of a recognition site for kinases phosphorylating this serine (Bain et al., 2007). We mutated this Arg-367 to Gln and established HCT116 cell line overexpressing such a HEF1 mutant. In a first set of experiments, we analyzed Ser-369 phosphorylation status of this R367Q mutant. As shown in Fig. 3A, mutation of Arg367 prevents recognition of HEF1 by anti-Phospho-Ser-369-HEF1 antibody suggesting an inhibition of phosphorylation on Ser-369. Concomitantly, in an anti-HEF1 staining, the slow migrating band (p115) disappears. This supports the hypothesis that this amino acid is required for Ser-369 phosphorylation. To evaluate whether Arg-367 mutation has a similar effect as Ser-369 mutation on HEF1 stability, we performed a time course treatment with Cycloheximide (CHX), an inhibitor of de novo protein synthesis. Compared to wt and S296A mutated HEF1, little degradation of the R367Q mutant of HEF1 was observed even after 10 h of CHX treatment (Fig. 3B, upper panel). Results of 4 independent experiments were quantified by densitometric analysis (Fig. 3B, lower panel). In order to check that increased protein level of S369A and R367Q HEF1 is not a result of a stronger transcritpional activity upon doxycycline treatment, we quantified HEF1 mRNA for each established cell line by RT-qPCR. As observed in Fig. 3C, upon doxycycline induction, S369A and R367Q HEF1 mRNA are less expressed as compared to wt HEF1. Taken together, these results suggest that Arg-367 mutation prevents HEF1 Ser-369 phosphorylation and hence delays HEF1 degradation. We next evaluated R367Q mutated HEF1 ability to stimulate HCT116 migration. Fig. 3D shows that, similarly to S369A mutation, R367Q stabilizing mutation enhances HEF1 promigratory effect as compared to wt HEF1. Thus, there is a direct correlation between the level of expression of HEF1, cell migration capacities and the Ser-369/Arg-367 mutations found in tumors. 3.4. HEF1 interacts with FAK and regulates its tyrosine phosphorylations To better understand the contribution of HEF1 to HCT116 migration, we sought to identify HEF1 partners and discriminate for specific S369A mutated HEF1 interactors by precipitating either wt or S369A mutated HEF1 and proceeding to mass spectrometry analysis. Comparison of both profiles revealed no difference. However, from these experiments we were able to characterize several proteins including the non-receptor tyrosine kinase FAK. We confirmed this interaction by co-immunoprecipitation experiment in this CRC model (Fig. 4A). FAK is activated through auto-phosphorylation of Tyr-397 which is a docking site for Src kinase, enabling further tyrosine phosphorylation of FAK on Tyr861 and Tyr-925; phosphorylation of Tyr-861 has been shown to

50

R. Ibrahim et al. / The International Journal of Biochemistry & Cell Biology 64 (2015) 45–57

Fig. 2. HEF1 phosphorylation on Serine 369 modulates its pro-migratory capacities. (A) Western blotting of okadaic acid (OA) or nocodazole (Nd) induced Ser/Thr phosphorylation of HEF1 in HCT116 cells transiently transfected with either wild type HEF1 (HEF1 wt) or its mutated forms on serine 369, 296 or both serines to alanine (BP: Basal Phosphorylation). (B) Same transfected cells used in (A) were either not synchronized (NS) or blocked in prometaphase by nocodazole treatment for 16 h then nocodazole was released during 4h30 to allow cell cycle progression. Corresponding cell lysates were subjected to Western blotting analysis using anti-HEF1 and anti-Phospho-Ser369-HEF1 antibodies (pSer-369 signal is marked by an arrow). (C) Stable cell lines were established by viral infection to overexpress inducible wt HEF1 or its mutated forms on Ser-369 or Ser-296. HEF1 expression was induced by doxycycline treatment for 48 h at a concentration of 250 ng/ml and assessed by Western blotting using anti-HEF1 and anti-Phospho-Ser-369-HEF1 antibodies. HSC70 was used as a loading control. (D) Cell migration analysis by Transwell migration assay of same stable cell lines as in (C). Error bars were established from results of three independent experiments. (E) Treatment with increasing doxycycline concentrations leads to increased cell migration (lower panel) concomitantly with enhanced HEF1 expression in wt HEF1 stable cell line as assessed by Western blotting analysis (upper panel). In lower panel, the curve was established from the results of four independent dose-response experiments.

regulate the migration process (Abu-Ghazaleh et al., 2001; Lim et al., 2004). Although the regulation of HEF1 phosphorylation by FAK and Src has been widely demonstrated, the role of HEF1 on FAK and Src regulation is much less described. Therefore, we

sought to analyze the Tyr phosphorylation status of FAK in HEF1 overexpressing HCT116 cell lines. As shown in Fig. 4B, HEF1 expression promotes Tyr-397, Tyr-861 and Tyr-925 phosphorylation in a dose-dependent manner, although Tyr-397 seems to be less

R. Ibrahim et al. / The International Journal of Biochemistry & Cell Biology 64 (2015) 45–57

51

Fig. 3. R367Q mutation inhibits HEF1 phosphorylation on serine 369, and enhances HEF1 stability and pro-migratory effect. (A) Western blotting analysis comparing the HEF1 expression profiles of the indicated stable cell lines. (B) (Upper panel) Time-course treatment with 140 ␮M of cycloheximide (CHX) was performed in the stable cell lines (HEF1 wt, S369, R367Q, S296A). HEF1 expression was then analyzed by Western blotting using anti-HEF1 antibody. Membranes were reblotted with anti-HSC70 antibody to check for equal protein loading. (Lower panel) Amounts of proteins were quantified by densitometric analysis: the HEF1 signal was normalized to the HSC70 signal and, to facilitate results interpretation, values were relatively compared to the initial amount (set at 1) of each HEF1 form. The curves were established from the results of four independent CHX kinetic experiments. (C) HEF1 mRNA expression level was determined in the same stable cell lines used in (B) by quantitative RT-PCR and was normalized to GADPH. (D) Cell migration analysis by Transwell migration assay of same five stable cell lines used above. All cell lines were treated with doxycycline for 48 h prior to experiments. Error bars were established from results of three independent experiments.

52

R. Ibrahim et al. / The International Journal of Biochemistry & Cell Biology 64 (2015) 45–57

Fig. 4. HEF1 interacts with FAK and promotes its tyrosine phosphorylations in a Src-dependent manner. (A) After treatment with doxycycline for 48 h, lysates (equivalent to 1 mg of proteins) of HCT116 cell line incorporating empty or pTRIPZ-Flag-HEF1 vectors were immunoprecipitated with anti-Flag (M2) antibody, then immunoblotted with anti-HEF1 and anti-FAK antibodies. (B) HEF1 expression was induced by treatment of wt HEF1 cell line with increasing concentrations of doxycycline. Same cell lysates were assessed for FAK Tyr-861, Tyr-925 and Tyr-397 phosphorylations, and for HSC70 expression as a loading control. (C) After treatment with doxycycline for 48 h, lysates from the empty vector cell line and those overexpressing wt HEF1 or its mutated forms (S369A, R367Q, S296A) were subjected to immunoblotting analysis using indicated antibodies. (D) Same cell lines used in (C) were treated with PP2 (a Src inhibitor) at a concentration of 2 ␮M for 16 h. Western blots were then performed using indicated antibodies. All Western blots on panel B, C and D have been performed three times for each antibody tested.

regulated by HEF1 increased expression (Fig. S2). Moreover, HEF1 stabilizing mutants S369A and R367Q enhance FAK Tyr-861 and Tyr-925 phosphorylations as compared to wt HEF1 and to S296A mutant, which correlates with their pro-migratory capacity (Fig. 4C, and quantification in Fig. S3). To confirm the Src-dependence of these phosphorylations, we treated each cell line with the Src inhibitor PP2. As observed in Fig. 4D, the increase of FAK Tyr-861 and Tyr-925 phosphorylations can be inhibited by PP2 while Tyr397 phosphorylation is much less affected (Fig. S4). Collectively, these results suggest that overexpression of HEF1 enhances FAK

phosphorylation especially on Tyr-861 and 925 in a Src-dependent manner which could downstream regulate migration. 3.5. BCAR3 mediates HEF1-induced cell migration Proteins identified from the mass spectrometry analysis also included partners belonging to the NSP family of adaptors: NSP1/SH2D3A and NSP2/AND-34/BCAR3. NSP define a group of docking proteins potentially related to cancer progression (Wallez et al., 2012). Some of them have previously been shown to bind

R. Ibrahim et al. / The International Journal of Biochemistry & Cell Biology 64 (2015) 45–57

53

Fig. 5. BCAR3 and NSP1 interact with HEF1 in CRC and are involved in cell migration. (A) After treatment with doxycycline for 48 h, lysates (equivalent to 1 mg of proteins) of cell lines incorporating empty or pTRIPZ-Flag-HEF1 vectors were immunoprecipitated with anti-Flag (M2) antibody, then immunoblotted with anti-HEF1, anti-BCAR3 and anti-NSP1 antibodies. (B) (Upper panel) Lysates (equivalent to 1 mg of proteins) from HCT116, Isreco-1 and SW480 CRC cell lines were immunoprecipitated with anti-HEF1 antibody, then immunoblotted for HEF1, BCAR3 and NSP1. (Lower panel) Same cell lysates were immunoprecipitated with anti-BCAR3 antibody, then immunoblotted for BCAR3 and HEF1. (C) Empty-vector or wt HEF1 cell lines were infected with two different shRNA targeting NSP1 (216, 307), two different shRNA targeting BCAR3 (110, 111) or the empty lentiviral vector (Ctrl). NSP1 and BCAR3 knockdown was assessed by Western blotting analysis (left panel). Capacity of cells to migrate was analyzed by Transwell migration assay (right panel). Co-immuno-precipitation experiments on panels A and B and knockdown of NSP proteins on panel C have been performed three times. Error bars on panel C were established from results of three independent experiments.

p130Cas family of proteins (Regelmann et al., 2006; Wallez et al., 2012, 2014). To confirm HEF1 interaction with these two partners, we immunoprecipitated ectopic wt HEF1 from HCT116 and tested for endogenous NSP1 and BCAR3 binding. As shown in Fig. 5A, these proteins are expressed in HCT116 and indeed interact with HEF1. Similar experiments showed that R367Q and S369A mutations do not regulate HEF1 association with BCAR3 (data not shown). In two other CRC cell lines, Isreco-1 and SW480, which express endogenously all three proteins, we were able to detect and then confirm that BCAR3 and NSP1 co-immunoprecipitate with HEF1 and that BCAR3 can pull down HEF1 (Fig. 5B). We next sought to determine whether BCAR3 and NSP1 were required for HEF1-induced HCT116 migration. As depicted in Fig. 5C (left panel), BCAR3 and NSP1 expression were efficiently silenced using shRNA lentiviral constructs. These cells were then assessed for migration capacities. Fig. 5C (right panel) showed that knocking down BCAR3

and to a lesser extent NSP1, decreases HCT116 cells migration properties. Moreover, BCAR3 depletion more efficiently inhibited HEF1-induced migration. Overall, these data suggest that BCAR3 rather than NSP1 mediates both basal and HEF1-induced HCT116 cell migration which prompted us to pursue experiments with BCAR3. 3.6. HEF1-BCAR3 interaction is required for HEF1-induced migration HEF1 and BCAR3 physically interact. Garron et al. demonstrated that HEF1 Leu-751 is needed in order to bind to BCAR3 (Garron et al., 2009). First, we checked whether in our cells, Leu-751 mutation prevents the formation of the HEF1-BCAR3 complex. As shown in Fig. 6A, while wt HEF1 interacts with BCAR3, Leu-751 to Asp mutated HEF1 (L751D) does not. Moreover, endogenous BCAR3

54

R. Ibrahim et al. / The International Journal of Biochemistry & Cell Biology 64 (2015) 45–57

Fig. 6. BCAR3 is crucial for HEF1 pro-migratory effect. (A) After treatment with doxycycline for 48 h, lysates (equivalent to 1 mg of proteins) from cell lines overexpressing inducible wt or L751D mutated HEF1 forms were immunoprecipitated with either anti-Flag (M2) or anti-BCAR3 antibodies, then immunoblotted for HEF1 and BCAR3. (B) Cell migration analysis by Transwell migration assay of same stable cell lines as in (A). (C) wt HEF1 cell line, in which endogenous expression of BCAR3 was silenced by shRNA, was re-infected with pLX-302-V5-Control (Mock), pLX-302-V5-BCAR3 wt or pLX-302-V5-BCAR3 R748A lentiviral vectors. After treatment with doxycycline for 48 h, cell lysates were immunoprecipitated with either anti-Flag (M2) or anti-V5 antibodies, then immunoblotted with same antibodies. (D) Empty vector or wt HEF1 cell lines were infected with either pGIPZ-shControl (Ctrl) or pGIPZ-shBCAR3. Cells, in which endogenous expression of BCAR3 was attenuated, were re-infected with pLX-302-V5-Control (Mock), pLX-302-V5-BCAR3 wt or pLX-302-V5-BCAR3 R748A lentiviral vectors. After treatment with doxycycline for 48 h, HEF1 and BCAR3 expression was assessed by Western blotting analysis (upper panel). Capacity of cells to migrate was analyzed by Transwell migration assay (lower panel). (E) Same BCAR3 knocking down and re-expression experiments were carried-out as in (D) in Isreco-1 cell line expressing both HEF1 and BCAR3 endogenously. HEF1 and BCAR3 expression was assessed by Western blotting analysis (upper panel). Capacity of cells to migrate was analyzed by Transwell migration assay (lower panel). Co-immuno-precipitation experiments on panels A and C and knockdown/rescue of BCAR3 protein on panels D and E have been performed three times. Error bars on panels B, D and E were established from results of three independent experiments.

R. Ibrahim et al. / The International Journal of Biochemistry & Cell Biology 64 (2015) 45–57

can immunoprecipitate wt HEF1 but does not interact with L751D mutated HEF1 (Fig. 6A). We then performed a migration assay and we observed that L751D HEF1 mutant induced a much smaller increase in HCT116 migration than wt HEF1 (Fig. 6B). This result suggests that Leu-751 integrity is required for HEF1 migration properties. To formally confirm the requirement of a HEF1-BCAR3 interaction in the HEF1-induced migration, we performed the reciprocal experiment where the BCAR3 residue involved in HEF1 binding was modified. The main BCAR3 residue mediating the HEF1 interaction (Arg-748) (Garron et al., 2009) has been mutated to Ala (R748A). Thus, the BCAR3 depleted HCT116 cell line was rescued with an ectopic BCAR3 construct resistant to shRNA-mediated down-regulation, either wt or harboring the R748A mutation. We first verified the ability of R748A mutation to prevent HEF1-BCAR3 interaction. Fig. 6C shows that HEF1 can immunoprecipitate exogenous wt BCAR3 but is unable to bind R748A BCAR3. Furthermore, wt but not R748A mutated BCAR3 can form a complex with HEF1, thus confirming the requirement for Arg-748 integrity in HEF1 interaction. In a last set of experiments, we sought to determine whether BCAR3 integrity was required for HEF1-mediated HCT116 migration. For this, we performed the same BCAR3 silencing/reexpression experiment as above before proceeding to a migration test. As depicted in Fig. 6D, a WB confirmed the silencing of endogenous and re-expression of ectopic BCAR3 constructs in parental versus HEF1 overexpressing HCT116 cell lines. While wt BCAR3 re-expression rescues HEF1-induced migration in BCAR3-depleted HCT116 cells to a level even higher than endogenous BCAR3, R748A BCAR3 only partially restores HEF1-induced HCT116 migration as compared to wt BCAR3 (Fig. 6D). Finally, to validate this hypothesis we chose another cell model, the Isreco-1 cell line, which expresses endogenous HEF1 and BCAR3 proteins, and performed the BCAR3 rescue experiment. As observed in HCT116 parental cells, BCAR3 silencing decreased Isreco-1 migration indicating a role of BCAR3 (Fig. 6E) as well as HEF1 (Fig. 1B) in Isreco-1 migration. Moreover, in these cells, only rescue with wt BCAR3 but not R748A mutated form fully restores cell migration (Fig. 6E). These results corroborate those obtained in HCT116 cells which suggested that Arg-748 mediated BCAR3-HEF1 interaction is required for HEF1 induced cell migration. Overall, these results indicate that HEF1-induced CRC cell migration requires HEF1-BCAR3 interaction.

4. Discussion Recent studies have reported a link between overexpression of HEF1 and tumor progression thus contributing to cancer metastasis in various cancer types (Izumchenko et al., 2009; Kim et al., 2006; Kondo et al., 2012; Little et al., 2013; Natarajan et al., 2006). In the work presented above, we investigated the contribution of HEF1 to CRC progression. We showed that either HEF1 ectopic expression or endogenous HEF1 silencing stimulates or decreases cell migration in the HCT116 and Isreco-1 CRC cell line respectively. Little data are available on HEF1 role in CRC. Reports established HEF1 as a mediator of PGE2-induced CRC proliferation and HIF1␣-mediated CRC migration (Kim et al., 2010; Xia et al., 2010). Recently, Li et al. described an increase of HEF1 expression during colon cancer progression as a consequence of Wnt/␤-Catenin signaling and correlated HEF1 expression to the differentiation status of CRC biopsies (Li et al., 2011). Our results from migration assay and IHC also corroborate observations from other studies in other cancer types (Izumchenko et al., 2009; Kim et al., 2006). However, in contrast to Li study where HEF1 extinction in SW480 cell line, decreased cell proliferation, HEF1 overexpression in HCT116 is not associated with augmented cell proliferation highlighting a cell type specific effect.

55

HEF1 is present as at least 3 molecular species of different electrophoretic mobility in SDS-PAGE (due to different Ser/Thr phosphorylation states of the protein). We previously characterized two phosphorylations associated with these migration shifts upon OA treatment (Hivert et al., 2009). In the present work, we have been able to discriminate these two phosphorylations detected during cell culture. Our present data demonstrate that, in HCT116, Ser-296 phosphorylation occurs transiently during mitosis. This result agrees with Pugacheva study describing phosphorylation of this residue by the mitotic kinase Aurora A in the breast cancer cell line MCF7 (Pugacheva and Golemis, 2005). However, the role of this phosphorylation has not been fully elucidated yet. A second phosphorylation on Ser-369 occurs in a more constitutive way and our results suggest that it accounts for the p115 HEF1 phospho-form. Of note, in non-synchronized cells lysate, where less than 20% of cells are in G2/M phase, the overall amount of HEF1 phosphorylated on Ser-296 is low but still visualized on WB (faint band above p105 band on Figs. 2C and 3A). On the other hand, the amount of HEF1 phosphorylated on both serines (Ser-296/Ser-369) is very low and becomes undetectable on Western blot. It can only be detected from a lysate prepared from G2/M phase synchronized cells as observed on Fig. 2B, panel HEF1wt, but can clearly be discriminated from the Ser-369 phosphorylated form (compare lane NS with lanes Nd release 0 h/1.5 h). This supports the hypothesis that the band referred to as p115 reveals a HEF1 form phosphorylated on Ser-369 but not on Ser-296 or S296/S369. However, we cannot exclude that phosphorylation on other residue(s) would be part of the p115 band. Earlier studies including ours have shown that phosphorylation on Ser-369 positively regulates HEF1 proteasomal degradation (Feng et al., 2004, Hivert et al., 2009; Liu et al., 2000). Alternatively, Bradbury et al. reported that this phosphorylation increased HEF1-mediated cell spreading (Bradbury et al., 2012). Part of our work also clearly showed that mutation of Ser-369 to Ala enhances HEF1 pro-migratory properties as a result of protein stabilization and established a correlation between HEF1 level and cell motility. The higher protein expression level of S369A and R367Q mutated HEF1 as compared to wt or S296A HEF1 (Fig. 3A) appears to be solely the result of protein stabilization since mRNA quantification by Q-RT-PCR did not reveal any increase of the corresponding messenger as compared to S296A and wt HEF1 (Fig. 3C). Numerous Ser/Thr protein kinases are Arg/Lys directed (Bain et al., 2007). We made the hypothesis that the integrity of Arg-367, could be a prerequisite for Ser-369 phosphorylation located in the Arg367 X-Ser369 motif. So we, for the first time, characterized functional mutations of HEF1 on Arg-367 and Ser-369 which make the protein unable to undergo Ser-369 phopshorylation hence enhancing pro-migratory capacities of the protein. Although we have linked enhanced HEF1 pro-migratory abilities as a consequence of S369A and R367Q HEF1 stabilization, we cannot exclude that somehow such mutations may alter intrinsic HEF1 properties leading to increased cell migration. In an attempt to identify potential S369A mutated HEF1 specific interactors we performed co-immunoprecipitation experiments followed by mass spectrometry. Data analysis revealed no difference between wt and S369A mutated HEF1 (data not shown). However, we identified several HEF1 interactors including the tyrosine kinase FAK. In HEF1 overexpressing cells, FAK phosphorylation on Tyr-397, 861 and 925 increases, and in the case of Tyr-861 and 925, are mediated by Src (Fig. 4D). The interaction of FAK with HEF1, as well as the regulation and the role of Tyr-861/Tyr-925 phosphorylation of FAK in the migration process have been largely documented (Abu-Ghazaleh et al., 2001; Deramaudt et al., 2011; Jin et al., 2014; Law et al., 1996; Lim et al., 2004; Manie et al., 1997; Tomkiewicz et al., 2013). Moreover, in mouse mammary tumor models and cervical cancer, knock down

56

R. Ibrahim et al. / The International Journal of Biochemistry & Cell Biology 64 (2015) 45–57

of HEF1 decreases FAK Tyr-397 and Src Tyr-418 phosphorylation (Izumchenko et al., 2009; Sima et al., 2013; Singh et al., 2010). Our results together with these data support a model where HEF1 forms a complex with FAK leading to enhanced phosphorylation of this oncoprotein which could downstream stimulate cell migration. Moreover, from our data, we also observed that, depending on HEF1 mutant, the extent of Tyr-397 phosphorylation differs from that of Tyr-861 and Tyr-925 (Fig. 4C and Fig. S3). The fact that Tyr-397 is a FAK auto-phosphorylation site while the two others are straight or indirect Src target residues may account for these dissimilar tyrosine phosphorylations (Abu-Ghazaleh et al., 2001; Brunton et al., 2005; Schlaepfer and Hunter, 1996). Interestingly, in NMuMG mammary epithelial cells, distinct levels of Tyr-397 and Tyr-861 phosphorylation of FAK are described, however, only Tyr-861 phosphorylation was further augmented during migration (Nakamura et al., 2001). Thus, although obtained in a different cell model and conditions background, these results coincide with our data indicating differentially regulated tyrosine residues phosphorylations. Of note, basal FAK auto-phosphorylation on Tyr397 seems to be reduced upon PP2 treatment, suggesting that it is mediated, for a part by Src (Fig. 4D and Fig. S4). Indeed, FAK autophosphorylation on Tyr-397 has been shown to vary depending on other Tyr phosphorylated residues such as Tyr-576/577 and Tyr-861 (Leu and Maa, 2002). Therefore reduced Tyr-397 phosphorylation following PP2 treatment may be the result of other down-regulated phosphorylations. In such a context, although it seems paradoxical that inhibition of phosphorylations of these Tyr397 and Tyr-861/925 by PP2 do not correlate, it may then reflect an unequal contribution of the Src pathway to these respective phosphorylations. We also identified BCAR3 whose binding to HEF1 is required for HEF1-induced HCT116 migration. BCAR3 (Breast Cancer Antiestrogen resistance 3) is an adaptor molecule belonging to the NSP family of proteins. In breast cancer, BCAR3 protein levels are elevated, promoting cell migration and invasion (Schrecengost et al., 2007). Several combinations of NSP/Cas protein complexes have been described in coordination with Src and FAK tyrosines kinases and emerged as important signaling modules in normal and cancer cell migration (Abu-Ghazaleh et al., 2001; Deramaudt et al., 2011; Wallez et al., 2012). For instance, BCAR3 has been shown to bind p130Cas enhancing Cas-Src interaction, leading to Src activation and promoting cell adhesion/migration and spreading (Makkinje, 2012; Riggins et al., 2003; Schrecengost et al., 2007; Schuh et al., 2010). Furthermore, two studies reported that the hematopoietic isoform of NSP3/CHAT/SHEP1 protein (CHAT-H) binding to HEF1 enhances its Ser/Thr phosphorylation and mediates B/T lymphocytes motility (Browne et al., 2010; Regelmann et al., 2006). Our results show that, in the empty vector infected HCT116 cell line, BCAR3 is required for basal HCT116 cell migration but does not seem to be a limiting component because overexpression of wt BCAR3 does not further enhance basal cell motility (Fig. 6D). Furthermore, rescue by R748A mutated BCAR3 restores basal HCT116 migration as well as wt BCAR3 which agrees with the absence of HEF1 in this cell line. Comparatively, in the CRC cell line Isreco-1, expressing endogenous HEF1, BCAR3 knock down decreases cell migration but only wt BCAR3 restores migration which corroborates data obtained in HEF1 expressing HCT116 and would suggest that BCAR3 ability to bind to HEF1 is required to mediate HEF1induced migration. HEF1 has been proposed as an EMT inducer in breast nontumorigenic (MCF10A) and tumorigenic (MCF7) cell lines through down-regulation of E-Cadherin (Kong et al., 2011; Tikhmyanova and Golemis, 2011). In our model, we have not observed any decrease in E-cadherin expression in HEF1 infected HCT116 (data not shown). Moreover, several reports pointed out an increase of serine phosphorylation of Cas proteins when co-transfected

Fig. 7. Schematic summarizing a proposed mechanism of HEF1-induced enhanced HCT116 cell migration. HEF1 promotes HCT116 cell migration through interacting with BCAR3 and FAK and increasing FAK tyrosine phosphorylation. Moreover mutations preventing HEF1 Ser369 phosphorylation stabilizes HEF1, hence enhances FAK tyrosine phosphorylation and pro-migratory effect.

with the NSP proteins CHAT-H or BCAR3 (Makkinje et al., 2009; Regelmann et al., 2006; Vanden Borre et al., 2011; Wallez et al., 2012). In our experiments we only detected a slight increase of HEF1 serine phosphorylation following BCAR3 overexpression (Fig. 6C and D). All together, these data suggest a cell type specific process. From updated records available on Cas proteins, no mutation has been shown to have any relevance to cancer development. Thus, this report is the first to identify a functional mutation of HEF1 linking stabilization of the protein to enhanced cell motility. Moreover, this work highlights the critical role of HEF1 protein abundance in cancer cell motility potentiality and also the importance of its interaction with BCAR3 in acquisition of this property. HEF1 could in this sense be considered as a biomarker of cancer progression. Fig. 7 presents a schematic summarizing a proposed mechanism of HEF1-induced enhanced HCT116 cell migration. While it remains challenging to target adaptor/scaffold proteins in cancer treatment, this work demonstrates that besides siRNA-based strategies, developing approaches aimed at interfering with interaction domains warrants additional investigation. Acknowledgements We thank the proteomic core facility for mass spectrometry experiments. This work was funded in part by INSERM and the Ligue Nationale Contre le Cancer (Equipe labellisée). R.I. was supported by fellowships from the Syrian ministry of Research and the Ligue Nationale Contre le Cancer. J.R. is a CNRS investigator. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.biocel.2015.03.014. References Abu-Ghazaleh R, Kabir J, Jia H, Lobo M, Zachary I. Src mediates stimulation by vascular endothelial growth factor of the phosphorylation of focal adhesion kinase at tyrosine 861, and migration and anti-apoptosis in endothelial cells. Biochem J 2001;360:255–64. Bain J, Plater L, Elliott M, Shpiro N, Hastie CJ, McLauchlan H, et al. The selectivity of protein kinase inhibitors: a further update. Biochem J 2007;408:297–315.

R. Ibrahim et al. / The International Journal of Biochemistry & Cell Biology 64 (2015) 45–57 Bradbury P, Mahmassani M, Zhong J, Turner K, Paul A, Verrills NM, et al. PP2A phosphatase suppresses function of the mesenchymal invasion regulator NEDD9. Biochim Biophys Acta 2012;1823:290–7. Browne CD, Hoefer MM, Chintalapati SK, Cato MH, Wallez Y, Ostertag DV, et al. SHEP1 partners with CasL to promote marginal zone B-cell maturation. Proc Natl Acad Sci U S A 2010;107:18944–9. Brunton VG, Avizienyte E, Fincham VJ, Serrels B, Metcalf CA 3rd, Sawyer TK, et al. Identification of Src-specific phosphorylation site on focal adhesion kinase: dissection of the role of Src SH2 and catalytic functions and their consequences for tumor cell behavior. Cancer Res 2005;65:1335–42. Deramaudt TB, Dujardin D, Hamadi A, Noulet F, Kolli K, De Mey J, et al. FAK phosphorylation at Tyr-925 regulates cross-talk between focal adhesion turnover and cell protrusion. Mol Biol Cell 2011;22:964–75. Fashena SJ, Einarson MB, O’Neill GM, Patriotis C, Golemis EA. Dissection of HEF1dependent functions in motility and transcriptional regulation. J Cell Sci 2002;115:99–111. Feng L, Guedes S, Wang T. Atrophin-1-interacting protein 4/human Itch is a ubiquitin E3 ligase for human enhancer of filamentation 1 in transforming growth factorbeta signaling pathways. J Biol Chem 2004;279:29681–90. Garron ML, Arsenieva D, Zhong J, Bloom AB, Lerner A, O’Neill GM, et al. Structural insights into the association between BCAR3 and Cas family members, an atypical complex implicated in anti-oestrogen resistance. J Mol Biol 2009;386:190–203. Guerrero MS, Parsons JT, Bouton AH. Cas and NEDD9 contribute to tumor progression through dynamic regulation of the cytoskeleton. Genes Cancer 2012;3:371–81. Hivert V, Pierre J, Raingeaud J. Phosphorylation of human enhancer of filamentation (HEF1) on serine 369 induces its proteasomal degradation. Biochem Pharmacol 2009;78:1017–25. Izumchenko E, Singh MK, Plotnikova OV, Tikhmyanova N, Little JL, Serebriiskii IG, et al. NEDD9 promotes oncogenic signaling in mammary tumor development. Cancer Res 2009;69:7198–206. Ji H, Ramsey MR, Hayes DN, Fan C, McNamara K, Kozlowski P, et al. LKB1 modulates lung cancer differentiation and metastasis. Nature 2007;448:807–10. Jin Y, Li F, Zheng C, Wang Y, Fang Z, Guo C, et al. NEDD9 promotes lung cancer metastasis through epithelial-mesenchymal transition. Int J Cancer 2014;134:2294–304. Kim M, Gans JD, Nogueira C, Wang A, Paik JH, Feng B, et al. Comparative oncogenomics identifies NEDD9 as a melanoma metastasis gene. Cell 2006;125:1269–81. Kim SH, Xia D, Kim SW, Holla V, Menter DG, Dubois RN. Human enhancer of filamentation 1 Is a mediator of hypoxia-inducible factor-1alpha-mediated migration in colorectal carcinoma cells. Cancer Res 2010;70:4054–63. Kondo S, Iwata S, Yamada T, Inoue Y, Ichihara H, Kichikawa Y, et al. Impact of the integrin signaling adaptor protein NEDD9 on prognosis and metastatic behavior of human lung cancer. Clin Cancer Res 2012;18:6326–38. Kong C, Wang C, Wang L, Ma M, Niu C, Sun X, et al. NEDD9 is a positive regulator of epithelial-mesenchymal transition and promotes invasion in aggressive breast cancer. PLoS ONE 2011;6:e22666. Law SF, Estojak J, Wang B, Mysliwiec T, Kruh G, Golemis EA. Human enhancer of filamentation 1, a novel p130cas-like docking protein, associates with focal adhesion kinase and induces pseudohyphal growth in Saccharomyces cerevisiae. Mol Cell Biol 1996;16:3327–37. Leu TH, Maa MC. Tyr-863 phosphorylation enhances focal adhesion kinase autophosphorylation at Tyr-397. Oncogene 2002;21:6992–7000. Li Y, Bavarva JH, Wang Z, Guo J, Qian C, Thibodeau SN, et al. HEF1, a novel target of Wnt signaling, promotes colonic cell migration and cancer progression. Oncogene 2011;30:2633–43. Lim Y, Han I, Jeon J, Park H, Bahk YY, Oh ES. Phosphorylation of focal adhesion kinase at tyrosine 861 is crucial for Ras transformation of fibroblasts. J Biol Chem 2004;279:29060–5. Little JL, Serzhanova V, Izumchenko E, Egleston BL, Parise E, Klein-Szanto AJ, et al. A requirement for Nedd9 in luminal progenitor cells prior to mammary tumorigenesis in MMTV-HER2/ErbB2 mice. Oncogene 2013. Liu X, Elia AE, Law SF, Golemis EA, Farley J, Wang T. A novel ability of Smad3 to regulate proteasomal degradation of a Cas family member HEF1. EMBO J 2000;19:6759–69. Lucas JT Jr, Salimath BP, Slomiany MG, Rosenzweig SA. Regulation of invasive behavior by vascular endothelial growth factor is HEF1-dependent. Oncogene 2010;29:4449–59. Makkinje A, Near RI, Infusini G, Vanden Borre P, Bloom A, Cai D, et al. AND-34/BCAR3 regulates adhesion-dependent p130Cas serine phosphorylation and breast cancer cell growth pattern. Cell Signal 2009;21:1423–35. Makkinje A, Vanden Borre P, Near RI, Patel PS, Lerner A. Breast cancer anti-estrogen resistance 3 (BCAR3) protein augments binding of the c-Src SH3 domain to Crk-associated substrate (p130cas). J Biol Chem 2012;287: 27703–14. Manie SN, Beck AR, Astier A, Law SF, Canty T, Hirai H, et al. Involvement of p130(Cas) and p105(HEF1), a novel Cas-like docking protein, in a cytoskeleton-dependent

57

signaling pathway initiated by ligation of integrin or antigen receptor on human B cells. J Biol Chem 1997;272:4230–6. Minn AJ, Gupta GP, Siegel PM, Bos PD, Shu W, Giri DD, et al. Genes that mediate breast cancer metastasis to lung. Nature 2005;436:518–24. Mitra SK, Schlaepfer DD. Integrin-regulated FAK-Src signaling in normal and cancer cells. Curr Opin Cell Biol 2006;18:516–23. Nakamura K, Yano H, Schaefer E, Sabe H. Different modes and qualities of tyrosine phosphorylation of Fak and Pyk2 during epithelial–mesenchymal transdifferentiation and cell migration: analysis of specific phosphorylation events using site-directed antibodies. Oncogene 2001;20:2626–35. Naldini L, Blomer U, Gallay P, Ory D, Mulligan R, Gage FH, et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 1996;272:263–7. Natarajan M, Stewart JE, Golemis EA, Pugacheva EN, Alexandropoulos K, Cox BD, et al. HEF1 is a necessary and specific downstream effector of FAK that promotes the migration of glioblastoma cells. Oncogene 2006;25:1721–32. Nourry C, Maksumova L, Pang M, Liu X, Wang T. Direct interaction between Smad3, APC10, CDH1 and HEF1 in proteasomal degradation of HEF1. BMC Cell Biol 2004;5:20. O’Neill GM, Fashena SJ, Golemis EA. Integrin signalling: a new Cas(t) of characters enters the stage. Trends Cell Biol 2000;10:111–9. Pugacheva EN, Golemis EA. The focal adhesion scaffolding protein HEF1 regulates activation of the Aurora-A and Nek2 kinases at the centrosome. Nat Cell Biol 2005;7:937–46. Regelmann AG, Danzl NM, Wanjalla C, Alexandropoulos K. The hematopoietic isoform of Cas-Hef1-associated signal transducer regulates chemokine-induced inside-out signaling and T cell trafficking. Immunity 2006;25:907–18. Riggins RB, Quilliam LA, Bouton AH. Synergistic promotion of c-Src activation and cell migration by Cas and AND-34/BCAR3. J Biol Chem 2003;278: 28264–73. Saade E, Mechold U, Kulyyassov A, Vertut D, Lipinski M, Ogryzko V. Analysis of interaction partners of H4 histone by a new proteomics approach. Proteomics 2009;9:4934–43. Sanz-Moreno V, Gadea G, Ahn J, Paterson H, Marra P, Pinner S, et al. Rac activation and inactivation control plasticity of tumor cell movement. Cell 2008;135:510–23. Schlaepfer DD, Hunter T. Evidence for in vivo phosphorylation of the Grb2 SH2domain binding site on focal adhesion kinase by Src-family protein-tyrosine kinases. Mol Cell Biol 1996;16:5623–33. Schrecengost RS, Riggins RB, Thomas KS, Guerrero MS, Bouton AH. Breast cancer antiestrogen resistance-3 expression regulates breast cancer cell migration through promotion of p130Cas membrane localization and membrane ruffling. Cancer Res 2007;67:6174–82. Schuh NR, Guerrero MS, Schrecengost RS, Bouton AH. BCAR3 regulates Src/p130 Cas association, Src kinase activity, and breast cancer adhesion signaling. J Biol Chem 2010;285:2309–17. Sima N, Cheng X, Ye F, Ma D, Xie X, Lu W. The overexpression of scaffolding protein NEDD9 promotes migration and invasion in cervical cancer via tyrosine phosphorylated FAK and SRC. PLoS ONE 2013;8:e74594. Simpson KJ, Selfors LM, Bui J, Reynolds A, Leake D, Khvorova A, et al. Identification of genes that regulate epithelial cell migration using an siRNA screening approach. Nat Cell Biol 2008;10:1027–38. Singh M, Cowell L, Seo S, O’Neill G, Golemis E. Molecular basis for HEF1/NEDD9/CasL action as a multifunctional co-ordinator of invasion, apoptosis and cell cycle. Cell Biochem Biophys 2007;48:54–72. Singh MK, Izumchenko E, Klein-Szanto AJ, Egleston BL, Wolfson M, Golemis EA. Enhanced genetic instability and dasatinib sensitivity in mammary tumor cells lacking NEDD9. Cancer Res 2010;70:8907–16. Tikhmyanova N, Golemis EA. NEDD9 and BCAR1 negatively regulate E-cadherin membrane localization, and promote E-cadherin degradation. PLoS ONE 2011;6:e22102. Tomkiewicz C, Herry L, Bui LC, Metayer C, Bourdeloux M, Barouki R, et al. The aryl hydrocarbon receptor regulates focal adhesion sites through a non-genomic FAK/Src pathway. Oncogene 2013;32:1811–20. Vanden Borre P, Near RI, Makkinje A, Mostoslavsky G, Lerner A. BCAR3/AND-34 can signal independent of complex formation with CAS family members or the presence of p130Cas. Cell Signal 2011;23:1030–40. Wallez Y, Mace PD, Pasquale EB, Riedl SJ. NSP-CAS protein complexes: emerging signaling modules in cancer. Genes Cancer 2012;3:382–93. Wallez Y, Riedl SJ, Pasquale EB. Association of the breast cancer antiestrogen resistance protein 1 (BCAR1) and BCAR3 scaffolding proteins in cell signaling and antiestrogen resistance. J Biol Chem 2014;289:10431–44. Xia D, Holla VR, Wang D, Menter DG, DuBois RN. HEF1 is a crucial mediator of the proliferative effects of prostaglandin E(2) on colon cancer cells. Cancer Res 2010;70:824–31. Zheng M, McKeown-Longo PJ. Regulation of HEF1 expression and phosphorylation by TGF-beta 1 and cell adhesion. J Biol Chem 2002;277:39599–608. Zheng M, McKeown-Longo PJ. Cell adhesion regulates Ser/Thr phosphorylation and proteasomal degradation of HEF1. J Cell Sci 2006;119:96–103.