- Email: [email protected]
Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer
Oral Oncology xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Oral Oncology journal homepage: www.elsevier.com/locate/oraloncology
Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer Cecilia Nordfors a, Andrea Vlastos a,b, Juan Du a, Andreas Ährlund-Richter a,c, Nikolaos Tertipis a, Nathalie Grün a, Mircea Romanitan a,d, Linnea Haeggblom a, Ann Roosaar c, Göran Dahllöf c, Maria Gabriella Donà e, Maria Benevolo f, Torbjörn Ramqvist a, Eva Munck-Wikland b, Tina Dalianis a,⇑ a
Department of Oncology-Pathology, Karolinska Institutet, Stockholm, Sweden Department of Oto-Rhino-Laryngology, Head and Neck Surgery, CLINTEC, Karolinska Institutet, Karolinska University Hospital, Sweden Department of Dental Medicine, Karolinska Institutet, Stockholm, Sweden d Department of Audiology and Neurotology CLINTEC, Karolinska Institutet, Karolinska University Hospital, Sweden e STI Unit, San Gallicano, Dermatological Institute, Rome, Italy f Pathology Department, Regina Elena National Cancer Institute, Rome, Italy b c
a r t i c l e
i n f o
Article history: Received 26 November 2013 Received in revised form 24 January 2014 Accepted 5 February 2014 Available online xxxx Keywords: Human papillomavirus (HPV) Oral HPV infection Mouthwash samples, tonsillar swabs Oropharyngeal squamous cell carcinoma Tonsillar cancer base of tongue cancer
s u m m a r y Material and methods: Presence of HPV DNA was analyzed in mouthwash and tonsillar swab samples, if indicative of HPV-positive tonsillar or base of tongue cancer in 76 patients, with suspected head neck cancer, undergoing diagnostic endoscopy at Karolinska University Hospital. The diagnosis and tumor HPV status was later obtained from patients’ records. As controls, 37 tumor-free dental visitors were included. Results: Of the 76 patients, 22/29 (76%) and 16/18 (89%) had an HPV-positive tonsillar and base of tongue cancer respectively, with 18/22 (82%) and 8/16 (50%) respectively having tumor concordant HPV-type positive oral samples. Two other HPV-positive oral samples in the base of tongue cancer group did not correlate to the tumor HPV status. Among the remaining patients, 19 with other head neck cancer and 10 with benign conditions, 4/29 (14%) had HPV-positive oral samples. Consequently, of the HPV-positive oral samples, dominated by HPV16 and high signals, 27/32 (84%) were derived from 26 patients with concordant HPV-type positive tonsillar or base of tongue cancer and one patient with an unknown primary head and neck cancer. The other five HPV-positive oral samples, with mainly low signals were derived from two patients with non-concordant HPV-type positive tumor biopsies, two patients with HPV-negative tumor biopsies and a patient with a benign condition. Of the dental patients, 3/37 (8%) had HPV-positive tonsillar swabs with weak signals. Conclusion: In patients with suspected head neck cancer, HPV-positive oral samples, especially HPV16 with high signals, could be indicative of HPV-positive tonsillar or base of tongue cancer. Ó 2014 Elsevier Ltd. All rights reserved.
Introduction In 2007 the International Agency for Research on Cancer (IARC) acknowledged human papillomavirus (HPV) as a risk factor, besides smoking and alcohol for oropharyngeal squamous cell carcinoma (OSCC), where tonsillar and base of tongue cancer dominate [1]. Recently an increase in the incidence of OSCC has been observed in several countries [2–8]. This increase has been shown to be dependent on an increased proportion of HPV-positive ⇑ Corresponding author. Address: Dept. of Oncology-Pathology, Karolinska Institutet, Cancer Center Karolinska R8:01, Karolinska University Hospital, 171 76 Stockholm, Sweden. Tel.: +46 8 51776583; fax: +46 8 517 76630. E-mail address: [email protected] (T. Dalianis).
OSSC in Sweden and in the US, and suggested to partly be attributed to changes in sexual behavior [6–8]. Notably, patients with HPV-positive OSCC, where HPV16 accounts for >90% of the cases, have a better clinical outcome compared to those with HPV-negative tumors (80% vs. 40% 5-year disease free survival) even with less treatment than is given at most centers today [9–12]. Nevertheless, treatment for head neck cancer, including HPV-positive OSCC, has gradually become intensified with accelerated radiotherapy, and concomitant or induction chemotherapy and sometimes with the addition of epidermal growth factor receptor blockers, resulting in more side effects [13]. Intensified therapy is likely unnecessary for many patients with HPV-positive OSCC and it would be of great value to, upfront, identify patients with HPV-positive OSCC among other patients. Furthermore, since the
http://dx.doi.org/10.1016/j.oraloncology.2014.02.012 1368-8375/Ó 2014 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Nordfors C et al. Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer. Oral Oncol (2014), http://dx.doi.org/10.1016/j.oraloncology.2014.02.012
2
C. Nordfors et al. / Oral Oncology xxx (2014) xxx–xxx
incidence of HPV-positive OSCC is increasing rapidly, it would be desirable if possible to identify individuals at risk for HPV-positive OSCC, in analogy to cervical cancer. Although oral HPV infection has been shown to confer an increased risk for HPV-positive OSCC, other pre-stages or hallmarks of HPV-positive OSCC are rarely encountered and have not been investigated extensively [14,15]. More knowledge within this field could thus be useful. The study was designed to investigate whether patients with HPV-positive tonsillar and base of tongue cancer could be distinguished from those with other head neck cancer and benign ear nose and throat (ENT) conditions by testing HPV prevalence in their oral samples. Oral HPV prevalence was therefore examined in consecutive mouthwash and tonsillar swab samples, in patients admitted to the Karolinska University Hospital for a diagnostic endoscopy. Furthermore, when possible, tonsillar swab samples were also examined by cytology. For comparison, similar samples obtained from dental patients at the Department of Dental Medicine, Karolinska Institutet were also investigated for the presence of HPV DNA. Material and methods The study and its participants The study included 76 patients aged 33–86 years undergoing a diagnostic endoscopy and diagnostic workup between September 2011 and June 2013 at the Department of Otorhino-laryngology, Head and Neck Surgery at the Karolinska University Hospital, Stockholm. Reasons for admission were suspicion of tonsillar or base of tongue cancer, other head neck cancer, or other ENT conditions. After the HPV testing of mouthwashes and tonsillar swabs and the cytology was completed, the diagnosis was retrieved from patients records as was HPV status analyzed by real time Taqman HPV PCR, for HPV types 16, 18, 31, 33, 45, and 56, and p16 status by immunohistochemistry (clone JC8) at the Department of Pathology, Karolinska University Hospital [13]. The 76 patients were divided into three groups, patients with tonsillar cancer; patients with base of tongue cancer; and patients with other head neck cancer or benign ENT conditions. The data are summarized for each group in Tables 1–3, respectively. For comparison, 37 mouthwash samples and 24 tonsillar swabs were collected from patients 3–74 years of age visiting for check ups during a 6 month period in 2011 at the Department of Dental Medicine, Karolinska Institutet. The study was performed according to permissions 2009/1278-31/4 and 2010/ 4:10 from the Stockholm Regional Ethical Committee. Collection of oral samples, DNA extraction, and HPV analysis Oral sample collection Two nurses collected oral samples consecutively, but during periods with heavy workload, sampling was not possible. Mouthwash samples were collected before the tonsillar swabs from both tonsils. Mouthwash samples were collected after 30 s. mouthwash in 15 ml 50% Listerine (Johnson and Johnson, New Brunswick, NJ, USA), kept at +4 °C maximum 1 day, then centrifuged at 6000g, 10 min and the pellet stored at 20 °C as described previously [16]. Tonsillar swabs were collected by massaging the tonsils for 30 s. with a swab stick, then placed in a tube with 5 ml SurePath preservation solution or PerservCyt solution (Cytyc Corporation, Marlborough, Mass, USA) and divided into two aliquots. The first was stored at +4 °C for DNA extraction and the second sent for cytology. DNA extraction DNA was extracted from mouthwash samples with the Gentra Puregene Buccal Cell Kit (Qiagen, QIAGEN AB, Stockholm, Sweden)
and dissolved in 100 ll DNA Hydration Solution (provided by the kit) according to the manufacturer. DNA was extracted from tonsillar swabs with the High pure PCR template preparation kit (Roche diagnostics, GmbH Mannhein Germany) according to the manufacturer, but omitting the DNase step, and diluted in 50 ll elution buffer. Determination of HPV status and p16 expression After DNA extraction of oral samples or diagnostic biopsies (in some rare cases) [2], 10 ll aliquots/sample were tested for 27 mucosal HPV types (HPV6, 11, 16, 18, 26, 30, 31, 33, 35, 39, 42, 43, 44, 45, 51, 52, 53, 56, 58, 59, 66, 67, 68, 69, 70, 73 and 82) and b-globin as control for DNA quality, by a bead-based multiplex assay on a MagPix instrument (Luminex Corporation, Austin, TX, USA) as described previously [17,18]. In addition to the BSGP5+/6+ primers targeting the L1 region, the following primers and probe targeting the HPV16 E6 region were included; primers; HPV16E6-1.F (TCAAAAGCCACTGTGTCCTGA), HPV16E6-3.R (GCTGGG TTTCTCTACGTGTTC), probe; HPV16 E6p (GTCTTGTTGCA GATCATCAAG) HPV-types were classified as previously described [19]. Samples with a median fluorescent intensity (MFI) < 30 for b-globin were excluded. An MFI value above 1.5 background + 8 was considered as HPV-positive and all samples positive for HPV16 E6 and/or L1 were regarded as HPV16 positive. MFI values of HPV16 in mouthwashes of patients with tonsillar and base of tongue cancer were compared to those of 15 youth with HPV16 positive mouthwashes from a previous study [16], since none of the dental patients had HPV16 positive mouthwash samples. Liquid-based cytology preparation and thin layer slides interpretation All 1.8 ml aliquots of the samples collected in SurePath medium were centrifuged and washed twice in PBS. The final pellet was resuspended in 20 ml of PreservCyt medium. All 1.8 ml aliquots of the samples collected in PreservCyt were directly diluted up to 20 ml using the same medium. Thin layer slides were prepared using the Thin Prep 2000 Processor following the manufacturer’s instructions (Hologic Corp), and stained according to the Papanicolaou protocol. Cytology was examined, blinded for all other findings, by two experienced cytopathologists and an adjudicated final report was established. Interpretation of the morphology was based on the criteria described by Silverman [20] and mainly in agreement with previous reports [15]. Cytological findings were classified into 4 categories: positive, negative, Atypical Squamous Cells of Undetermined Significance (ASCUS), or inadequate. Slides were considered inadequate when the cellularity was too scanty to be representative, or when obscuring materials, such as blood or inflammatory cells, were present. Whenever abnormalities were found that did not clearly fulfill the malignant criteria, the morphology was classified as ASCUS. For purpose of analysis, the worst cytological report was considered between the two tonsillar swabs. Results Patient characteristics and HPV status of their biopsies Of the 76 patients, 29 presented tonsillar cancer and 18 presented base of tongue cancer. Age and gender of the patients; TNM classification of the tumors; and HPV status of the biopsies; with 22/29 (76%) and 16/18 (89%) of the tonsillar and base of tongue cancer biopsies respectively being HPV-positive, are summarized in Tables 1 and 2, respectively. The corresponding data for the remaining 29 patients are demonstrated in Table 3. In this group, 19 patients presented other head and neck cancer and 10 had benign conditions e.g. tonsillitis, fungal infections and benign
Please cite this article in press as: Nordfors C et al. Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer. Oral Oncol (2014), http://dx.doi.org/10.1016/j.oraloncology.2014.02.012
3
C. Nordfors et al. / Oral Oncology xxx (2014) xxx–xxx Table 1 Characteristics of the patients with tonsillar cancer, their tumors, tonsillar swabs and mouthwashes. Patient nr. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29
Age
Gender f
64 M 54 M 80 Fg 59 M 47 M 57 M 59 M 67 M 63 M 58 M 43 M 53 M 63 F 68 M 44 M 54 M 60 M 50 M 80 F 69 M 64 M 65 M 74 M 67 M 58 M 57 M 73 M 61 F 75 F Total no of positive
T/N/Ma 3/0/0 2/2b/0 4a/2c/0 2/2b/0 3/2a/0 2/2b/0 2/2b/0 2/2c/0 2/2b/0 2/2b/0 3/2b/0 2/0/0 2/2c/0 2/2b/0 2/2b/0 2/2a/0 2/2b/0 1/2a/0 2/2b/0 3/2a/0 2/2b/0 3/3/0 4a/2b/0 3/2b/0 3/2b/0 1/2b/0 2/0/0 2/0/0 3/2/0
p16b + + + + + + + + + + + n.dh n.d n.d n.d n.d + + + + + + – – – – – – n.d 16/22 (72%)
Total no of HPV16 positive a b c d e f g h i
HPV statusc HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV33 HPV33 HPV33 – – – – – – – 22/29 (76%)
TT/NTd
MWe
Cytology
++ + ++ ++ ++ + + ++ ++,42,59 ++ ++ + ++ + ++ ++ + – – 16,+ – – – – – – – – – 18/29 (62%)
++ + ++ ++ ++ ++ ++ + ++ ++, 18 ++ + + ++ ++ ++ – – – – – – – – – – – – – 16/29 (55%)
ASCUS ASCUS + ASCUS n.d – – ASCUS – Inadequate n.d ASCUS + – n.d n.d Inadequate ASCUS – n.d – – + ASCUS – – – n.d n.d 10/20 (50%)
19/29 (65%)
17/29 (58%)
16/29 (55%)
i
TNM staging. p16 data. HPV obtained from patients records. TT/NT tumor/normal tonsil swab. MW mouthwash sample. M = male. F = female. n.d = not done. + with an MFI < 200 and ++ with an MFI P 200 indicate HPV type concordance with the tumor, in case of a different HPV-type, the specific type is indicated.
cysts (data not shown). HPV DNA was detected in 3/19 (16%) of the tested head and neck cancer samples from this group; one a gingival cancer; and two unknown primary cancers (Table 3). Expression of p16 (often correlated with biologically active high-risk HPV infection) [21] was examined in most of tonsillar and base of tongue cancer biopsies and in many other head neck cancers. There was a close correlation between HPV-positivity and p16 overexpression with p16 overexpressed in 30/32 (94%) of the HPV-positive cancers or tumor metastases (Tables 1–3). Presence of HPV in oral samples from patients with tonsillar cancer HPV-positive oral samples (from the tumor tonsil, normal tonsil, or mouthwashes) were obtained from 18/22 (82%) of the patients with HPV-positive tonsillar cancer and they all contained HPV types concordant with the patient tumor biopsy (Table 1). In addition, among the HPV16 positive oral samples of patients with HPV16 positive tumors 14/17 (82%) had MFI values >200 in at least one of the oral samples (Table 1). There was concordance with regard to HPV-type between the tumor biopsy and the tonsillar swab and mouthwash samples (one and/or more oral samples with or without the specific HPV type) in 25/29 (86%) and 23/29 (79%) respectively, of the cases (Table 1). Furthermore, when analyzing for HPV16 specifically (HPV16 positive or not), the corresponding figures were 27/29 (93%) and 26/29 (90%) respectively. Actually only 2/19 patients with HPV16 positive tumor biopsies (from stage T1 and T2 tumors) did not have HPV-positive oral samples, while
2/3 patients with HPV33 positive tumors (stage T2 and T3) had HPV-negative oral samples, possibly due to lower signal strength for HPV33 (Table 1 and data not shown). Presence of HPV in oral samples from patients with base of tongue cancer HPV-positive oral samples (from either tonsil, or mouth washes) were detected in 10/16 (62%) of the patients with HPV-positive base of tongue cancer, and of these 8/16 (50%), contained HPV-types concordant with the HPV-type of the patient tumors (Table 2). Among the 7 HPV16 positive oral samples of patients with HPV16 positive tumors all had MFI values >200 in at least one of the oral samples (Table 2). HPV-type concordance between tumor biopsies and tonsillar swabs and mouthwash samples was 10/18 (56%) and 7/18 (39%) respectively for the 18 patients with base of tongue cancer (Table 2) and lower compared to that of patients with tonsillar cancer (Table 1). When analyzing HPV16 specifically (HPV16 positive or not), the corresponding figures were 12/18 (67%) and 9/18 (50%), respectively (Table 2). Furthermore, 6/13 (46%) base of tongue cancer patients with HPV16 positive tumor biopsies (where 5/6 were stage T1) and 2/3 patients with other HPV-type positive tumor biopsies (tumor stages T3 and T4a) did not have HPV type concordant oral samples (Table 2). HPV concordance with the respective tumors was more frequently observed in tonsillar swabs and oral swabs of patients with
Please cite this article in press as: Nordfors C et al. Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer. Oral Oncol (2014), http://dx.doi.org/10.1016/j.oraloncology.2014.02.012
4
C. Nordfors et al. / Oral Oncology xxx (2014) xxx–xxx
Table 2 Characteristics of the patients with base of tongue cancer, their tumors, their tonsillar swabs and mouthwashes. Patient nr. 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47
Age
Gender f
60 F 68 Mg 65 M 64 F 58 M 63 F 66 M 70 M 44 M 71 M 53 F 66 M 66 M 59 M 57 M 67 F 69 M 74 M Total no of positive
T/N/Ma 3/2b/0 4a/2b/0 4a/2b/0 3/2b/0 4a/2b/0 3/2b/0 2/1/0 1/2b/0 1/2a/0 1/2b/0 1/1/0 2/0/0 1/1/0 4a/2b/0 2/2b/0 3/2c/0 2/1/0 3/0/0
p16b + + + + n.dh n.d n.d + + + + + n.d + + – + – 12/14 (86%)
Total no of HPV16 positive a b c d e f g h i j k
HPV statusc
TSd i
MWe
Cytology ASCUS – – n.d ASCUS – – – – – – ASCUS n.d n.d – ASCUS ASCUS ASCUS 6/15 (40%)
HPV16 HPV16 HPV16 HPV16k HPV16 HPV16 HPV16k HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV18 HPV35 HPV33 – – 16/18 (89%)
++ ++ ++ ++ ++ ++ ++ – – – –j – – – + – – – 8/18 (44%)
++ ++ ++ 6,++,51++ ++ ++ – – – – – – – – 16 16 67 – 9/18 (50%)
12/18 (67%)
7/18 (39%)
8/18 (44%)
TNM staging. p16 data. HPV status obtained from patients records. TS tonsillar swabs samples from both tonsils. MW mouthwash sample. F = female. M = male. n.d = not done. + with an MFI < 200, and ++ with an MFI P 200 indicate HPV-type concordance with the tumor, in case of a different HPV-type the specific type is indicated. Inadequate material for one tonsil. Biopsy tested by us.
tonsillar as compared to those with base of tongue cancer (25/29 vs. 10/18, p = 0.04 and 23/29 vs. 7/19 p = 0.01 Fischer’s exact test) respectively. Presence of HPV in oral samples from patients with other conditions than tonsillar and base of tongue cancer HPV-positive oral samples (from either tonsil, or mouthwashes) were detected in 4/29 (14%) of the remaining patients, more specifically in oral samples of 3/19 (16%) patients with other head and neck cancer, and 1/10 (10%) patients with benign conditions (Table 3). HPV status data was available for all 19 biopsies from patients with other head neck cancer, and of these 3/19 (16%) were HPV-positive, with two of them having HPV-positive oral samples, with one being HPV16 with an MFI > 200 (Table 3). This latter patient had an HPV16 positive metastasis of a head and neck unknown primary cancer as well as a hyperplasia of the base of tongue, i.e. possibly a tumor of the base of tongue that had escaped the biopsy sampling at endoscopy. The other was a patient with an HPV31 positive gingival cancer who had oral samples that were HPV52 positive with MFI signals also >200. The remaining two HPV-positive oral samples with MFI signals <200 came from a patient with an HPV-negative laryngeal cancer and a patient with a benign condition (Table 3). HPV-type concordance between tumor biopsies and oral samples was thus 16/19 (84%) and was only estimated for the 19 patients where HPV status was examined both in the biopsies and oral samples (Table 3). The concordance for HPV16 specifically (HPV16 positive or not) was 16/19 (84%). Presence of HPV in oral samples in children and adults from the department of dental medicine Of the 37 individuals tested, aged between 3 and 74 years median age 15, 22 males and 15 females, all 37 provided mouthwash
and 24 donated tonsillar swab samples. Only 3 tonsillar swab samples from three young males aged 12–17, were HPV positive, with weak signals for HPV types 42, 51, 56, 82. Thus only 3/37 (8%) individuals had HPV-positive oral samples. HPV16 MFI values in mouthwashes of tonsillar and base of tongue cancer patients and healthy youth The MFI values of HPV16 positive mouthwash samples from patients with tonsillar and base of tongue cancer were compared to 15 HPV16 positive mouthwash samples from youth aged 15– 23 visiting a youth clinic in the center of Stockholm [16], since HPV16 was not present in the dental patients. The median HPV16 MFI values of patients with tonsillar and base of tongue cancer were much higher than those of the youth (around 250 and 20 respectively), (Fig. 1). Cytopathological findings Additionally, 62 out of the 76 patients had both the tonsillar swabs also analyzed by liquid based cytology: 22 from tonsillar cancer patients, 15 from base of tongue cancer patients, and 25 from patients with other head and neck cancer or benign conditions (Tables 1–3). Overall, two samples (3%) were inadequate because of scant cellular material. Considering the 60 patients with a valid cytological report, clearly malignant cells (positive reports) were found in 4/60 (7%) samples, while 20/60 (33%) of the samples were classified as ASCUS. Notably, 3/4 positive samples came from patients with tonsillar cancer. The remaining positive sample came from a patient with a tumor of the mobile tongue, also infiltrating the base of tongue. Regarding the 20 ASCUS, 7 came from the tonsillar cancer patients, 6 from the patients with base of tongue cancer, and 7 from the patients with other conditions.
Please cite this article in press as: Nordfors C et al. Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer. Oral Oncol (2014), http://dx.doi.org/10.1016/j.oraloncology.2014.02.012
5
C. Nordfors et al. / Oral Oncology xxx (2014) xxx–xxx Table 3 Characteristics of patients with benign conditions or with head and neck cancer other than tonsillar and base of tongue cancer, their tumors, and oral samples. Patient nr. 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76
Age 49 59 70 70 65 80 58 74 69 59 50 64 47 61 75 62 75 70 76 45 65 71 70 63 51 33 86 74 35
Gender g
M Fh M M F M F M M M M M F M F M F F F F F M F F F M M F M
T/N/Ma 0/2b/0 n.di 1/0/9 1/1/0 3/0/0 2/0/0 3/2b/0 4a/2b/0 3/2c/0 3/0/0 1/1/0 1/1/1 1/0/0 2/x/0 2/0/0 3/2c/0 2/0/0 4a/1/0 n.di n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d
Site codeb Unknown primary Unknown primary Gingival cancer Larynx Larynx Mobile tongue Mobile tongue Hypopharynx Other head neck Larynx Other head neck Other head neck Mobile tongue Other head neck Mobile tongue Hypopharynx Larynx Other head neck B-cell lymphoma Benign condition Benign condition Benign condition Benign condition Benign condition Benign condition Benign condition Benign condition Benign condition Benign condition
Total nr. of positive a b c d e f g h i j k
p16c
HPV statusd k
TSe
MWf
Cytology
+ – + n.d – – – – – – – – n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d
HPV16 HPV16 HPV31 negk negk negk – – – – – – – – – – – – – – – n.d n.d n.d n.d n.d n.d n.d n.d
– – 52 33 – – – – – – – – – – – – – – – – – 16 – – – – – – –
– ++j 52++ – – – – – – – – – – – – – – – – – – – – – – – – – –
ASCUS – ASCUS – ASCUS + n.d ASCUS n.d – – – – Inadequate ASCUS ASCUS n.d – – – n.d – ASCUS – – – – – –
2/11 (18%)
3/21 (14.2%)
3/29 (10%)
2/29 (7%)
8/25 (32%)
TNM staging. Site of tumor. p16 data. HPV status obtained from patients records. TS tumor swab samples from both tonsils. MW mouthwash sample. M = male. F = female. n.d = not done. ++ with an MFI P 200 indicate HPV type concordance with the tumor, in case of a different HPV type the specific type is indicated. Biopsy tested by us.
an ASCUS/positive cytological report, 12/24 (50%) were HPV-positive in one or more of the oral samples, and in particular 10/24 (42%) were HPV-positive on the tonsillar swab.
Discussion
Figure 1. Box plot representing MFI values of mouthwashes of patients with head and neck cancer and youth from a youth clinic.
In summary, atypical/malignant cells were found in the tonsillar swabs of 10/20 (50%) patients with a tonsillar cancer, 6/15 (40%) patients with base of tongue cancer, and 8/25 (32%) patients with other conditions (Tables 1–3). Moreover, of the patients with
In total, 32/76 (42%) patients with initially suspected head and neck cancer had HPV-positive oral samples, with the majority 26/ 32 (81%) found in patients later diagnosed with an HPV-positive type concordant tonsillar or base of tongue cancer. However, when only the 29 HPV16 positive oral samples, and especially the 22 with MFIs >200 were considered, then 89% and 100%, respectively, were from patients with HPV16 positive tonsillar or base of tongue cancer, or tumor metastasis. Of the 10 patients later diagnosed with benign conditions, only one (10%) had an HPV-positive oral sample, which was similar to that (8%) of the dental patients, and to that reported (9%) among youth at a youth clinic in Stockholm, and that found by others [16,21–27]. Positive cytology was obtained in 30–50% of the patients irrespective of tumor diagnosis. Our data thus suggest that HPV-positive oral samples indicate with a high probability that patients admitted for diagnostic work up due to suspicion of head neck cancer, harbor an HPV-positive cancer of the tonsils or base of tongue. Moreover, if the oral sample is HPV16 positive with a strong signal, then the probability for an HPV16 positive cancer is even higher.
Please cite this article in press as: Nordfors C et al. Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer. Oral Oncol (2014), http://dx.doi.org/10.1016/j.oraloncology.2014.02.012
6
C. Nordfors et al. / Oral Oncology xxx (2014) xxx–xxx
To our knowledge the design of this study is unique in that we examined a cohort with suspected head neck cancer with the aim to identify specific indicative markers for tonsillar and base of tongue cancer. Similar to Fakhry et al. [15], abnormal cytology did not surely represent an OSCC. However, HPV16 positive oral samples with high MFI values were indicative of the presence of an HPV16 positive tonsillar or base of tongue cancer, and the latter was in line to that previously reported by others with regard to viral load [14]. The better concordance between HPV16 in oral samples and presence of HPV16 positive tumors as compared to that observed for other HPV types could be due the sensitivity of the assay, which readily detects HPV16, or to that HPV16 possibly induces a higher viral load. However, definite analysis about the other HPV types cannot be made with only four patients with HPV33 positive tumors and only one each with HPV18, 31 and 35 positive tumors. Furthermore, similar to that observed for type concordance, the prevalence of HPV16 was higher in oral samples (17/19, 89%) of patients with HPV16 positive tonsillar cancer compared to (7/13, 54%) for patients with HPV16 positive base of tongue cancer (p < 0.038, Fischer’s exact test). The most obvious reason for this could be that for tonsillar cancer, the tonsillar swabs were collected at, or in the vicinity of the tumor site, which was not the case for patients with base of tongue cancer. Moreover, the surface exposed to the oral cavity is more often limited for the base of tongue cancer cases compared to the tonsillar cancer cases. Notably, 5/ 6 HPV16 positive base of tongue cancer cases with HPV-negative oral samples, were stage T1, while the two HPV16 positive tonsillar cancer cases with HPV16 negative oral samples were of stage T1 and T2. Tumor size may therefore also influence the reliable assessment of HPV infection. Notably, as indicated above HPV DNA was not detected in oral samples of some stage T1–T2 base of tongue and tonsillar cancer cases suggesting that HPV testing in oral samples of HNSCC patients is suboptimal in the initial diagnostic evaluation and possibly also during follow up. Obviously, small primary tumors and small sized recurrences could be missed this way. For the initial diagnostic evaluation HPV testing of the fine needle aspirate (FNA) may be better. For follow up, one could still consider investigating whether it is worthwhile to examine oral samples, of patients with HPV-positive tonsillar and base of tongue cancer, for presence of HPV DNA after treatment. It is however not clear yet whether added information could be gained this way. Regarding the cytology, it is worth noting that the rate of ASCUS/positive reports was higher among patients with tonsillar cancer (50%) than among patients who did not have cancer of the tonsils (40% for base of tongue cancer patients and 32% for patients with other conditions). Furthermore, of the four tonsillar swabs with a positive cytological report, three came from patients with tonsillar cancer. This is not surprising, since it can be expected that cytological abnormalities would be more frequently found when the sampling is specifically aimed at the cancer site. However, abnormal cells were also found among the tonsillar swabs of patients without tonsillar cancer and this may be only partially explained by HPV infection since only few ASCUS/positive cases were HPV-positive on the tonsillar swab. Atypical cells may also be due to inflammation or minor infections (fungi, bacteria). It is worth noting that, except in one case, tonsillar cytological alterations were only detected in cancer patients, irrespective of the tumor site. Therefore, it can be hypothesized that the tumor is responsible for nonspecific changes in the surrounding tissues. In conclusion, cytology samples collected from tonsillar swabs showed only a limited diagnostic value for tonsillar cancer, and were of no use for SCC at other sites. Cytological sampling may be worth further investigation only when specifically targeting
the specific lesion and improving sample collection by using alternative sampling devices. There are limitations in our study. The number of patients could have been larger, but we are grateful that so many patients agreed to participate just before their endoscopy. Furthermore, since HPV16 is so dominant there were few oral samples positive for other HPV types. More importantly however, some patients with HPV-positive tumors, especially those with base of tongue cancer, had HPV-negative oral samples. In these cases the sampling technique could most likely be improved. Taking a swab from the base of tongue more rigorously, e.g. with a special device and by an experienced surgeon, would likely increase the probability of achieving HPV-positive oral samples from both patients with base of tongue cancer and from those with tonsillar cancer. The presence of relatively strong HPV16 signals in oral samples of patients with tonsillar and base of tongue cancer as compared to healthy controls could be of future potential use, but needs to be studied further. Worth mentioning is e.g. the patient with a high HPV16 MFI oral sample and a hyperplasia of the base of tongue with an unknown primary head neck cancer with an HPV 16 positive metastasis who may have had an undetected base of tongue cancer. Furthermore, individuals with an oral sample with a high HPV16 MFI value or other corresponding high signals could also be of interest to follow up. Markedly, among the healthy youth, the majority of HPV16 positive samples had only weak signals with only 1/15 with an MFI > 200. Hypothesizing that not more than 10% of the healthy population have HPV positive oral samples, and that not more than 50% are HPV16 positive, then if 100,0000 mouthwash samples were examined, roughly 333 would have an MFI > 200. This would be speculating broadly, but would indicate that the follow up situation, e.g. by serology or reference to an ENT specialist should not be too extensive. Nevertheless, before even approaching the idea of screening, more studies on oral HPV prevalence are necessary. In summary, we conclude that in patients, with suspected head neck cancer, HPV-positive oral samples, especially with high signals of HPV16 could be indicative of an HPV-positive tonsillar or base of tongue cancer. However, further studies are warranted to conclude whether individuals with high signals of HPV16 in oral samples should be followed up for a potential OSCC or risk of the development of an OSCC.
Conflict of interest statement None declared.
Acknowledgements This work was supported by The Swedish Cancer Society; The Swedish Medical Research Council; The Stockholm Cancer Society; Henning and Ida Perssons Foundation; The Stockholm Cancer Foundation, The Allergy and Cancer Foundation, Karolinska Institutet; the Stockholm City Council; the King Gustaf V Jubilee Fund and the Stockholm County ALF.
References [1] Human Papillomaviruses. In: IARC monographs on the evaluation of carcinogenic risks to humans, vol. 90; 2007. p. 1–636. [2] Hammarstedt L, Lindquist D, Dahlstrand H, Romanitan M, Dahlgren LO, Joneberg J, et al. Human papillomavirus as a risk factor for the increase in incidence of tonsillar cancer. Int J Cancer 2006;119(12):2620–3. [3] Nasman A, Attner P, Hammarstedt L, Du J, Eriksson M, Giraud G, et al. Incidence of human papillomavirus (HPV) positive tonsillar carcinoma in Stockholm, Sweden: an epidemic of viral-induced carcinoma? Int J Cancer 2009;125(2):362–6.
Please cite this article in press as: Nordfors C et al. Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer. Oral Oncol (2014), http://dx.doi.org/10.1016/j.oraloncology.2014.02.012
C. Nordfors et al. / Oral Oncology xxx (2014) xxx–xxx [4] Attner P, Du J, Näsman A, Hammarstedt L, Ramqvist T, Lindholm J, et al. The role of human papillomavirus in the increased incidence of base of tongue cancer. Int J Cancer 2010;126(12):2879–84. [5] Ramqvist T, Dalianis T. Oropharyngeal cancer epidemic and human papillomavirus. Emerg Infect Dis 2010;16(11):1671–7. [6] Chaturvedi AK, Engels EA, Pfeiffer RM, Hernandez BY, Xiao W, Kim E, et al. Human papillomavirus and rising oropharyngeal cancer incidence in the United States. J Clin Oncol 2011;29(32):4294–301. [7] Blomberg M, Nielsen A, Munk C, Kjaer SK. Trends in head and neck cancer incidence in Denmark, 1978–2007: focus on human papillomavirus associated sites. Int J Cancer 2001;129(3):733–41. [8] Ramqvist T, Dalianis T. An epidemic of oropharyngeal squamous cell carcinoma (OSCC) due to human papillomavirus (HPV) infection and aspects of treatment and prevention. Anticancer Res 2011;31(5):1515–9. [9] Gillison ML, Koch WM, Capone RB, Spafford M, Westra WH, Wu L, et al. Evidence for a causal association between human papillomavirus and a subset of head and neck cancers. J Natl Cancer Inst 2000;92(9):709–20. [10] Mellin H, Friesland S, Lewensohn R, Dalianis T, Munck-Wikland E. Human papillomavirus (HPV) DNA in tonsillar cancer: clinical correlates, risk of relapse, and survival. Int J Cancer 2000;89(3):300–4. [11] Mellin H, Dahlgren L, Munck-Wikland E, Lindholm J, Rabbani H, Kalantari M, et al. Human papillomavirus type 16 is episomal and a high viral load may be correlated to better prognosis in tonsillar cancer. Int J Cancer 2002;102(2):152–8. [12] Lindquist D, Romanitan M, Hammarstedt L, Nasman A, Dahlstrand H, Lindholm J, et al. Human papillomavirus is a favourable prognostic factor in tonsillar cancer and its oncogenic role is supported by the expression of E6 and E7. Mol Oncol 2007;1(3):350–5. [13] Attner P, Näsman A, Du J, Hammarstedt L, Ramqvist T, Lindholm J, et al. Survival in patients with human papillomavirus positive tonsillar cancer in relation to treatment. Int J Cancer 2012;131(5):1124–30. [14] D´Souza G, Kreimer AR, Viscidi R, Pawlita M, Fakhry C, Koch WM, et al. Casecontrol study of human papillomavirus and oropharyngeal cancer. New Engl J Med 2007;356(19):1944–56. [15] Fakhry C, Rosenthal BT, Clark DP, Gillison ML. Associations between oral HPV16 infection and cytopathology: evaluation of an ‘‘pap test equivalent’’ in high-risk populations. Cancer Prev Res 2011;4(9):1378–84.
7
[16] Du J, Nordfors C, Ahrlund-Richter A, Sobkowiak M, Romanitan M, Näsman A, et al. Prevalence of oral human papillomavirus infection among youth, Sweden. Emerg Infect Dis 2012;18(9):1468–71. [17] Schmitt M, Bravo IG, Snijders PJ, Gissmann L, Pawlita M, Waterboer T. Beadbased multiplex genotyping of human papillomaviruses. J Clin Microbiol 2006;44(2):504–12. [18] Schmitt M, Dondog B, Waterboer T, Pawlita M. Homogeneous amplification of genital human alpha papillomaviruses by PCR using novel broad-spectrum GP5+ and GP6+ primers. J Clin Microbiol 2008;46(3):1050–9. [19] Muñoz N, Bosch FX, de Sanjose S, Herrero R, Castellsague X, Shah KV. Epidemiologic classification of human papillomavirus types associated with cervical cancer. New Engl J Med 2003;348(6):518–27. [20] Silverman Jr S. Oral cavity. In: Bibbo M, editor. Comprehensive cytopathology. WB Saunders Company; 1991. cap. 15, p. 399–408. [21] Hoffmann M, Ihloff AS, Gorogh T, Weise JB, Fazel A, Krams M, et al. P16(INK4a) overexpression predicts translational active human papillomavirus infection in tonsillar cancer. Int J Cancer 2010;127(7):1595–602. [22] Kreimer AR, Bhatia RK, Messeguer AL, Gonzalez P, Herrero R, Giuliano AR. Oral human papillomavirus in healthy individuals: a systematic review of the literature. Sex Transm Dis 2010;37. 6. [23] Rautava J, Syrjanen S. Human papillomavirus infections in the oral mucosa. J Am Dent Assoc 2011;142(8):905–14. [24] Giraldo P, Goncalves AK, Pereira SA, Barros-Mazon S, Gondo ML, Witkin SS. Human papillomavirus in the oral mucosa of women with genital human papillomavirus lesions. Eur J Obstet Gynecol Reprod Biol 2006;126(1):104–6. [25] Termine N, Giovannelli L, Matranga D, Caleca MP, Bellavia C, Perino A, et al. Oral human papillomavirus infection in women with cervical HPV infection: new data from an Italian cohort and a metanalysis of the literature. Oral Oncol 2011;47(4):244–50. [26] Canadas MP, Bosch FX, Junquera ML, Ejarque M, Font R, Ordonez E, et al. Concordance of prevalence of human papillomavirus DNA in anogenital and oral infections in a high-risk population. J Clin Microbiol 2004;42(3):1330–2. [27] D’Souza G, Fakhry C, Sugar EA, Seaberg EC, Weber K, Minkoff HL, et al. Sixmonth natural history of oral versus cervical human papillomavirus infection. Int J Cancer 2007;121(1):143–50.
Please cite this article in press as: Nordfors C et al. Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer. Oral Oncol (2014), http://dx.doi.org/10.1016/j.oraloncology.2014.02.012
Contents lists available at ScienceDirect
Oral Oncology journal homepage: www.elsevier.com/locate/oraloncology
Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer Cecilia Nordfors a, Andrea Vlastos a,b, Juan Du a, Andreas Ährlund-Richter a,c, Nikolaos Tertipis a, Nathalie Grün a, Mircea Romanitan a,d, Linnea Haeggblom a, Ann Roosaar c, Göran Dahllöf c, Maria Gabriella Donà e, Maria Benevolo f, Torbjörn Ramqvist a, Eva Munck-Wikland b, Tina Dalianis a,⇑ a
Department of Oncology-Pathology, Karolinska Institutet, Stockholm, Sweden Department of Oto-Rhino-Laryngology, Head and Neck Surgery, CLINTEC, Karolinska Institutet, Karolinska University Hospital, Sweden Department of Dental Medicine, Karolinska Institutet, Stockholm, Sweden d Department of Audiology and Neurotology CLINTEC, Karolinska Institutet, Karolinska University Hospital, Sweden e STI Unit, San Gallicano, Dermatological Institute, Rome, Italy f Pathology Department, Regina Elena National Cancer Institute, Rome, Italy b c
a r t i c l e
i n f o
Article history: Received 26 November 2013 Received in revised form 24 January 2014 Accepted 5 February 2014 Available online xxxx Keywords: Human papillomavirus (HPV) Oral HPV infection Mouthwash samples, tonsillar swabs Oropharyngeal squamous cell carcinoma Tonsillar cancer base of tongue cancer
s u m m a r y Material and methods: Presence of HPV DNA was analyzed in mouthwash and tonsillar swab samples, if indicative of HPV-positive tonsillar or base of tongue cancer in 76 patients, with suspected head neck cancer, undergoing diagnostic endoscopy at Karolinska University Hospital. The diagnosis and tumor HPV status was later obtained from patients’ records. As controls, 37 tumor-free dental visitors were included. Results: Of the 76 patients, 22/29 (76%) and 16/18 (89%) had an HPV-positive tonsillar and base of tongue cancer respectively, with 18/22 (82%) and 8/16 (50%) respectively having tumor concordant HPV-type positive oral samples. Two other HPV-positive oral samples in the base of tongue cancer group did not correlate to the tumor HPV status. Among the remaining patients, 19 with other head neck cancer and 10 with benign conditions, 4/29 (14%) had HPV-positive oral samples. Consequently, of the HPV-positive oral samples, dominated by HPV16 and high signals, 27/32 (84%) were derived from 26 patients with concordant HPV-type positive tonsillar or base of tongue cancer and one patient with an unknown primary head and neck cancer. The other five HPV-positive oral samples, with mainly low signals were derived from two patients with non-concordant HPV-type positive tumor biopsies, two patients with HPV-negative tumor biopsies and a patient with a benign condition. Of the dental patients, 3/37 (8%) had HPV-positive tonsillar swabs with weak signals. Conclusion: In patients with suspected head neck cancer, HPV-positive oral samples, especially HPV16 with high signals, could be indicative of HPV-positive tonsillar or base of tongue cancer. Ó 2014 Elsevier Ltd. All rights reserved.
Introduction In 2007 the International Agency for Research on Cancer (IARC) acknowledged human papillomavirus (HPV) as a risk factor, besides smoking and alcohol for oropharyngeal squamous cell carcinoma (OSCC), where tonsillar and base of tongue cancer dominate [1]. Recently an increase in the incidence of OSCC has been observed in several countries [2–8]. This increase has been shown to be dependent on an increased proportion of HPV-positive ⇑ Corresponding author. Address: Dept. of Oncology-Pathology, Karolinska Institutet, Cancer Center Karolinska R8:01, Karolinska University Hospital, 171 76 Stockholm, Sweden. Tel.: +46 8 51776583; fax: +46 8 517 76630. E-mail address: [email protected] (T. Dalianis).
OSSC in Sweden and in the US, and suggested to partly be attributed to changes in sexual behavior [6–8]. Notably, patients with HPV-positive OSCC, where HPV16 accounts for >90% of the cases, have a better clinical outcome compared to those with HPV-negative tumors (80% vs. 40% 5-year disease free survival) even with less treatment than is given at most centers today [9–12]. Nevertheless, treatment for head neck cancer, including HPV-positive OSCC, has gradually become intensified with accelerated radiotherapy, and concomitant or induction chemotherapy and sometimes with the addition of epidermal growth factor receptor blockers, resulting in more side effects [13]. Intensified therapy is likely unnecessary for many patients with HPV-positive OSCC and it would be of great value to, upfront, identify patients with HPV-positive OSCC among other patients. Furthermore, since the
http://dx.doi.org/10.1016/j.oraloncology.2014.02.012 1368-8375/Ó 2014 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Nordfors C et al. Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer. Oral Oncol (2014), http://dx.doi.org/10.1016/j.oraloncology.2014.02.012
2
C. Nordfors et al. / Oral Oncology xxx (2014) xxx–xxx
incidence of HPV-positive OSCC is increasing rapidly, it would be desirable if possible to identify individuals at risk for HPV-positive OSCC, in analogy to cervical cancer. Although oral HPV infection has been shown to confer an increased risk for HPV-positive OSCC, other pre-stages or hallmarks of HPV-positive OSCC are rarely encountered and have not been investigated extensively [14,15]. More knowledge within this field could thus be useful. The study was designed to investigate whether patients with HPV-positive tonsillar and base of tongue cancer could be distinguished from those with other head neck cancer and benign ear nose and throat (ENT) conditions by testing HPV prevalence in their oral samples. Oral HPV prevalence was therefore examined in consecutive mouthwash and tonsillar swab samples, in patients admitted to the Karolinska University Hospital for a diagnostic endoscopy. Furthermore, when possible, tonsillar swab samples were also examined by cytology. For comparison, similar samples obtained from dental patients at the Department of Dental Medicine, Karolinska Institutet were also investigated for the presence of HPV DNA. Material and methods The study and its participants The study included 76 patients aged 33–86 years undergoing a diagnostic endoscopy and diagnostic workup between September 2011 and June 2013 at the Department of Otorhino-laryngology, Head and Neck Surgery at the Karolinska University Hospital, Stockholm. Reasons for admission were suspicion of tonsillar or base of tongue cancer, other head neck cancer, or other ENT conditions. After the HPV testing of mouthwashes and tonsillar swabs and the cytology was completed, the diagnosis was retrieved from patients records as was HPV status analyzed by real time Taqman HPV PCR, for HPV types 16, 18, 31, 33, 45, and 56, and p16 status by immunohistochemistry (clone JC8) at the Department of Pathology, Karolinska University Hospital [13]. The 76 patients were divided into three groups, patients with tonsillar cancer; patients with base of tongue cancer; and patients with other head neck cancer or benign ENT conditions. The data are summarized for each group in Tables 1–3, respectively. For comparison, 37 mouthwash samples and 24 tonsillar swabs were collected from patients 3–74 years of age visiting for check ups during a 6 month period in 2011 at the Department of Dental Medicine, Karolinska Institutet. The study was performed according to permissions 2009/1278-31/4 and 2010/ 4:10 from the Stockholm Regional Ethical Committee. Collection of oral samples, DNA extraction, and HPV analysis Oral sample collection Two nurses collected oral samples consecutively, but during periods with heavy workload, sampling was not possible. Mouthwash samples were collected before the tonsillar swabs from both tonsils. Mouthwash samples were collected after 30 s. mouthwash in 15 ml 50% Listerine (Johnson and Johnson, New Brunswick, NJ, USA), kept at +4 °C maximum 1 day, then centrifuged at 6000g, 10 min and the pellet stored at 20 °C as described previously [16]. Tonsillar swabs were collected by massaging the tonsils for 30 s. with a swab stick, then placed in a tube with 5 ml SurePath preservation solution or PerservCyt solution (Cytyc Corporation, Marlborough, Mass, USA) and divided into two aliquots. The first was stored at +4 °C for DNA extraction and the second sent for cytology. DNA extraction DNA was extracted from mouthwash samples with the Gentra Puregene Buccal Cell Kit (Qiagen, QIAGEN AB, Stockholm, Sweden)
and dissolved in 100 ll DNA Hydration Solution (provided by the kit) according to the manufacturer. DNA was extracted from tonsillar swabs with the High pure PCR template preparation kit (Roche diagnostics, GmbH Mannhein Germany) according to the manufacturer, but omitting the DNase step, and diluted in 50 ll elution buffer. Determination of HPV status and p16 expression After DNA extraction of oral samples or diagnostic biopsies (in some rare cases) [2], 10 ll aliquots/sample were tested for 27 mucosal HPV types (HPV6, 11, 16, 18, 26, 30, 31, 33, 35, 39, 42, 43, 44, 45, 51, 52, 53, 56, 58, 59, 66, 67, 68, 69, 70, 73 and 82) and b-globin as control for DNA quality, by a bead-based multiplex assay on a MagPix instrument (Luminex Corporation, Austin, TX, USA) as described previously [17,18]. In addition to the BSGP5+/6+ primers targeting the L1 region, the following primers and probe targeting the HPV16 E6 region were included; primers; HPV16E6-1.F (TCAAAAGCCACTGTGTCCTGA), HPV16E6-3.R (GCTGGG TTTCTCTACGTGTTC), probe; HPV16 E6p (GTCTTGTTGCA GATCATCAAG) HPV-types were classified as previously described [19]. Samples with a median fluorescent intensity (MFI) < 30 for b-globin were excluded. An MFI value above 1.5 background + 8 was considered as HPV-positive and all samples positive for HPV16 E6 and/or L1 were regarded as HPV16 positive. MFI values of HPV16 in mouthwashes of patients with tonsillar and base of tongue cancer were compared to those of 15 youth with HPV16 positive mouthwashes from a previous study [16], since none of the dental patients had HPV16 positive mouthwash samples. Liquid-based cytology preparation and thin layer slides interpretation All 1.8 ml aliquots of the samples collected in SurePath medium were centrifuged and washed twice in PBS. The final pellet was resuspended in 20 ml of PreservCyt medium. All 1.8 ml aliquots of the samples collected in PreservCyt were directly diluted up to 20 ml using the same medium. Thin layer slides were prepared using the Thin Prep 2000 Processor following the manufacturer’s instructions (Hologic Corp), and stained according to the Papanicolaou protocol. Cytology was examined, blinded for all other findings, by two experienced cytopathologists and an adjudicated final report was established. Interpretation of the morphology was based on the criteria described by Silverman [20] and mainly in agreement with previous reports [15]. Cytological findings were classified into 4 categories: positive, negative, Atypical Squamous Cells of Undetermined Significance (ASCUS), or inadequate. Slides were considered inadequate when the cellularity was too scanty to be representative, or when obscuring materials, such as blood or inflammatory cells, were present. Whenever abnormalities were found that did not clearly fulfill the malignant criteria, the morphology was classified as ASCUS. For purpose of analysis, the worst cytological report was considered between the two tonsillar swabs. Results Patient characteristics and HPV status of their biopsies Of the 76 patients, 29 presented tonsillar cancer and 18 presented base of tongue cancer. Age and gender of the patients; TNM classification of the tumors; and HPV status of the biopsies; with 22/29 (76%) and 16/18 (89%) of the tonsillar and base of tongue cancer biopsies respectively being HPV-positive, are summarized in Tables 1 and 2, respectively. The corresponding data for the remaining 29 patients are demonstrated in Table 3. In this group, 19 patients presented other head and neck cancer and 10 had benign conditions e.g. tonsillitis, fungal infections and benign
Please cite this article in press as: Nordfors C et al. Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer. Oral Oncol (2014), http://dx.doi.org/10.1016/j.oraloncology.2014.02.012
3
C. Nordfors et al. / Oral Oncology xxx (2014) xxx–xxx Table 1 Characteristics of the patients with tonsillar cancer, their tumors, tonsillar swabs and mouthwashes. Patient nr. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29
Age
Gender f
64 M 54 M 80 Fg 59 M 47 M 57 M 59 M 67 M 63 M 58 M 43 M 53 M 63 F 68 M 44 M 54 M 60 M 50 M 80 F 69 M 64 M 65 M 74 M 67 M 58 M 57 M 73 M 61 F 75 F Total no of positive
T/N/Ma 3/0/0 2/2b/0 4a/2c/0 2/2b/0 3/2a/0 2/2b/0 2/2b/0 2/2c/0 2/2b/0 2/2b/0 3/2b/0 2/0/0 2/2c/0 2/2b/0 2/2b/0 2/2a/0 2/2b/0 1/2a/0 2/2b/0 3/2a/0 2/2b/0 3/3/0 4a/2b/0 3/2b/0 3/2b/0 1/2b/0 2/0/0 2/0/0 3/2/0
p16b + + + + + + + + + + + n.dh n.d n.d n.d n.d + + + + + + – – – – – – n.d 16/22 (72%)
Total no of HPV16 positive a b c d e f g h i
HPV statusc HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV33 HPV33 HPV33 – – – – – – – 22/29 (76%)
TT/NTd
MWe
Cytology
++ + ++ ++ ++ + + ++ ++,42,59 ++ ++ + ++ + ++ ++ + – – 16,+ – – – – – – – – – 18/29 (62%)
++ + ++ ++ ++ ++ ++ + ++ ++, 18 ++ + + ++ ++ ++ – – – – – – – – – – – – – 16/29 (55%)
ASCUS ASCUS + ASCUS n.d – – ASCUS – Inadequate n.d ASCUS + – n.d n.d Inadequate ASCUS – n.d – – + ASCUS – – – n.d n.d 10/20 (50%)
19/29 (65%)
17/29 (58%)
16/29 (55%)
i
TNM staging. p16 data. HPV obtained from patients records. TT/NT tumor/normal tonsil swab. MW mouthwash sample. M = male. F = female. n.d = not done. + with an MFI < 200 and ++ with an MFI P 200 indicate HPV type concordance with the tumor, in case of a different HPV-type, the specific type is indicated.
cysts (data not shown). HPV DNA was detected in 3/19 (16%) of the tested head and neck cancer samples from this group; one a gingival cancer; and two unknown primary cancers (Table 3). Expression of p16 (often correlated with biologically active high-risk HPV infection) [21] was examined in most of tonsillar and base of tongue cancer biopsies and in many other head neck cancers. There was a close correlation between HPV-positivity and p16 overexpression with p16 overexpressed in 30/32 (94%) of the HPV-positive cancers or tumor metastases (Tables 1–3). Presence of HPV in oral samples from patients with tonsillar cancer HPV-positive oral samples (from the tumor tonsil, normal tonsil, or mouthwashes) were obtained from 18/22 (82%) of the patients with HPV-positive tonsillar cancer and they all contained HPV types concordant with the patient tumor biopsy (Table 1). In addition, among the HPV16 positive oral samples of patients with HPV16 positive tumors 14/17 (82%) had MFI values >200 in at least one of the oral samples (Table 1). There was concordance with regard to HPV-type between the tumor biopsy and the tonsillar swab and mouthwash samples (one and/or more oral samples with or without the specific HPV type) in 25/29 (86%) and 23/29 (79%) respectively, of the cases (Table 1). Furthermore, when analyzing for HPV16 specifically (HPV16 positive or not), the corresponding figures were 27/29 (93%) and 26/29 (90%) respectively. Actually only 2/19 patients with HPV16 positive tumor biopsies (from stage T1 and T2 tumors) did not have HPV-positive oral samples, while
2/3 patients with HPV33 positive tumors (stage T2 and T3) had HPV-negative oral samples, possibly due to lower signal strength for HPV33 (Table 1 and data not shown). Presence of HPV in oral samples from patients with base of tongue cancer HPV-positive oral samples (from either tonsil, or mouth washes) were detected in 10/16 (62%) of the patients with HPV-positive base of tongue cancer, and of these 8/16 (50%), contained HPV-types concordant with the HPV-type of the patient tumors (Table 2). Among the 7 HPV16 positive oral samples of patients with HPV16 positive tumors all had MFI values >200 in at least one of the oral samples (Table 2). HPV-type concordance between tumor biopsies and tonsillar swabs and mouthwash samples was 10/18 (56%) and 7/18 (39%) respectively for the 18 patients with base of tongue cancer (Table 2) and lower compared to that of patients with tonsillar cancer (Table 1). When analyzing HPV16 specifically (HPV16 positive or not), the corresponding figures were 12/18 (67%) and 9/18 (50%), respectively (Table 2). Furthermore, 6/13 (46%) base of tongue cancer patients with HPV16 positive tumor biopsies (where 5/6 were stage T1) and 2/3 patients with other HPV-type positive tumor biopsies (tumor stages T3 and T4a) did not have HPV type concordant oral samples (Table 2). HPV concordance with the respective tumors was more frequently observed in tonsillar swabs and oral swabs of patients with
Please cite this article in press as: Nordfors C et al. Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer. Oral Oncol (2014), http://dx.doi.org/10.1016/j.oraloncology.2014.02.012
4
C. Nordfors et al. / Oral Oncology xxx (2014) xxx–xxx
Table 2 Characteristics of the patients with base of tongue cancer, their tumors, their tonsillar swabs and mouthwashes. Patient nr. 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47
Age
Gender f
60 F 68 Mg 65 M 64 F 58 M 63 F 66 M 70 M 44 M 71 M 53 F 66 M 66 M 59 M 57 M 67 F 69 M 74 M Total no of positive
T/N/Ma 3/2b/0 4a/2b/0 4a/2b/0 3/2b/0 4a/2b/0 3/2b/0 2/1/0 1/2b/0 1/2a/0 1/2b/0 1/1/0 2/0/0 1/1/0 4a/2b/0 2/2b/0 3/2c/0 2/1/0 3/0/0
p16b + + + + n.dh n.d n.d + + + + + n.d + + – + – 12/14 (86%)
Total no of HPV16 positive a b c d e f g h i j k
HPV statusc
TSd i
MWe
Cytology ASCUS – – n.d ASCUS – – – – – – ASCUS n.d n.d – ASCUS ASCUS ASCUS 6/15 (40%)
HPV16 HPV16 HPV16 HPV16k HPV16 HPV16 HPV16k HPV16 HPV16 HPV16 HPV16 HPV16 HPV16 HPV18 HPV35 HPV33 – – 16/18 (89%)
++ ++ ++ ++ ++ ++ ++ – – – –j – – – + – – – 8/18 (44%)
++ ++ ++ 6,++,51++ ++ ++ – – – – – – – – 16 16 67 – 9/18 (50%)
12/18 (67%)
7/18 (39%)
8/18 (44%)
TNM staging. p16 data. HPV status obtained from patients records. TS tonsillar swabs samples from both tonsils. MW mouthwash sample. F = female. M = male. n.d = not done. + with an MFI < 200, and ++ with an MFI P 200 indicate HPV-type concordance with the tumor, in case of a different HPV-type the specific type is indicated. Inadequate material for one tonsil. Biopsy tested by us.
tonsillar as compared to those with base of tongue cancer (25/29 vs. 10/18, p = 0.04 and 23/29 vs. 7/19 p = 0.01 Fischer’s exact test) respectively. Presence of HPV in oral samples from patients with other conditions than tonsillar and base of tongue cancer HPV-positive oral samples (from either tonsil, or mouthwashes) were detected in 4/29 (14%) of the remaining patients, more specifically in oral samples of 3/19 (16%) patients with other head and neck cancer, and 1/10 (10%) patients with benign conditions (Table 3). HPV status data was available for all 19 biopsies from patients with other head neck cancer, and of these 3/19 (16%) were HPV-positive, with two of them having HPV-positive oral samples, with one being HPV16 with an MFI > 200 (Table 3). This latter patient had an HPV16 positive metastasis of a head and neck unknown primary cancer as well as a hyperplasia of the base of tongue, i.e. possibly a tumor of the base of tongue that had escaped the biopsy sampling at endoscopy. The other was a patient with an HPV31 positive gingival cancer who had oral samples that were HPV52 positive with MFI signals also >200. The remaining two HPV-positive oral samples with MFI signals <200 came from a patient with an HPV-negative laryngeal cancer and a patient with a benign condition (Table 3). HPV-type concordance between tumor biopsies and oral samples was thus 16/19 (84%) and was only estimated for the 19 patients where HPV status was examined both in the biopsies and oral samples (Table 3). The concordance for HPV16 specifically (HPV16 positive or not) was 16/19 (84%). Presence of HPV in oral samples in children and adults from the department of dental medicine Of the 37 individuals tested, aged between 3 and 74 years median age 15, 22 males and 15 females, all 37 provided mouthwash
and 24 donated tonsillar swab samples. Only 3 tonsillar swab samples from three young males aged 12–17, were HPV positive, with weak signals for HPV types 42, 51, 56, 82. Thus only 3/37 (8%) individuals had HPV-positive oral samples. HPV16 MFI values in mouthwashes of tonsillar and base of tongue cancer patients and healthy youth The MFI values of HPV16 positive mouthwash samples from patients with tonsillar and base of tongue cancer were compared to 15 HPV16 positive mouthwash samples from youth aged 15– 23 visiting a youth clinic in the center of Stockholm [16], since HPV16 was not present in the dental patients. The median HPV16 MFI values of patients with tonsillar and base of tongue cancer were much higher than those of the youth (around 250 and 20 respectively), (Fig. 1). Cytopathological findings Additionally, 62 out of the 76 patients had both the tonsillar swabs also analyzed by liquid based cytology: 22 from tonsillar cancer patients, 15 from base of tongue cancer patients, and 25 from patients with other head and neck cancer or benign conditions (Tables 1–3). Overall, two samples (3%) were inadequate because of scant cellular material. Considering the 60 patients with a valid cytological report, clearly malignant cells (positive reports) were found in 4/60 (7%) samples, while 20/60 (33%) of the samples were classified as ASCUS. Notably, 3/4 positive samples came from patients with tonsillar cancer. The remaining positive sample came from a patient with a tumor of the mobile tongue, also infiltrating the base of tongue. Regarding the 20 ASCUS, 7 came from the tonsillar cancer patients, 6 from the patients with base of tongue cancer, and 7 from the patients with other conditions.
Please cite this article in press as: Nordfors C et al. Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer. Oral Oncol (2014), http://dx.doi.org/10.1016/j.oraloncology.2014.02.012
5
C. Nordfors et al. / Oral Oncology xxx (2014) xxx–xxx Table 3 Characteristics of patients with benign conditions or with head and neck cancer other than tonsillar and base of tongue cancer, their tumors, and oral samples. Patient nr. 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76
Age 49 59 70 70 65 80 58 74 69 59 50 64 47 61 75 62 75 70 76 45 65 71 70 63 51 33 86 74 35
Gender g
M Fh M M F M F M M M M M F M F M F F F F F M F F F M M F M
T/N/Ma 0/2b/0 n.di 1/0/9 1/1/0 3/0/0 2/0/0 3/2b/0 4a/2b/0 3/2c/0 3/0/0 1/1/0 1/1/1 1/0/0 2/x/0 2/0/0 3/2c/0 2/0/0 4a/1/0 n.di n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d
Site codeb Unknown primary Unknown primary Gingival cancer Larynx Larynx Mobile tongue Mobile tongue Hypopharynx Other head neck Larynx Other head neck Other head neck Mobile tongue Other head neck Mobile tongue Hypopharynx Larynx Other head neck B-cell lymphoma Benign condition Benign condition Benign condition Benign condition Benign condition Benign condition Benign condition Benign condition Benign condition Benign condition
Total nr. of positive a b c d e f g h i j k
p16c
HPV statusd k
TSe
MWf
Cytology
+ – + n.d – – – – – – – – n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d n.d
HPV16 HPV16 HPV31 negk negk negk – – – – – – – – – – – – – – – n.d n.d n.d n.d n.d n.d n.d n.d
– – 52 33 – – – – – – – – – – – – – – – – – 16 – – – – – – –
– ++j 52++ – – – – – – – – – – – – – – – – – – – – – – – – – –
ASCUS – ASCUS – ASCUS + n.d ASCUS n.d – – – – Inadequate ASCUS ASCUS n.d – – – n.d – ASCUS – – – – – –
2/11 (18%)
3/21 (14.2%)
3/29 (10%)
2/29 (7%)
8/25 (32%)
TNM staging. Site of tumor. p16 data. HPV status obtained from patients records. TS tumor swab samples from both tonsils. MW mouthwash sample. M = male. F = female. n.d = not done. ++ with an MFI P 200 indicate HPV type concordance with the tumor, in case of a different HPV type the specific type is indicated. Biopsy tested by us.
an ASCUS/positive cytological report, 12/24 (50%) were HPV-positive in one or more of the oral samples, and in particular 10/24 (42%) were HPV-positive on the tonsillar swab.
Discussion
Figure 1. Box plot representing MFI values of mouthwashes of patients with head and neck cancer and youth from a youth clinic.
In summary, atypical/malignant cells were found in the tonsillar swabs of 10/20 (50%) patients with a tonsillar cancer, 6/15 (40%) patients with base of tongue cancer, and 8/25 (32%) patients with other conditions (Tables 1–3). Moreover, of the patients with
In total, 32/76 (42%) patients with initially suspected head and neck cancer had HPV-positive oral samples, with the majority 26/ 32 (81%) found in patients later diagnosed with an HPV-positive type concordant tonsillar or base of tongue cancer. However, when only the 29 HPV16 positive oral samples, and especially the 22 with MFIs >200 were considered, then 89% and 100%, respectively, were from patients with HPV16 positive tonsillar or base of tongue cancer, or tumor metastasis. Of the 10 patients later diagnosed with benign conditions, only one (10%) had an HPV-positive oral sample, which was similar to that (8%) of the dental patients, and to that reported (9%) among youth at a youth clinic in Stockholm, and that found by others [16,21–27]. Positive cytology was obtained in 30–50% of the patients irrespective of tumor diagnosis. Our data thus suggest that HPV-positive oral samples indicate with a high probability that patients admitted for diagnostic work up due to suspicion of head neck cancer, harbor an HPV-positive cancer of the tonsils or base of tongue. Moreover, if the oral sample is HPV16 positive with a strong signal, then the probability for an HPV16 positive cancer is even higher.
Please cite this article in press as: Nordfors C et al. Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer. Oral Oncol (2014), http://dx.doi.org/10.1016/j.oraloncology.2014.02.012
6
C. Nordfors et al. / Oral Oncology xxx (2014) xxx–xxx
To our knowledge the design of this study is unique in that we examined a cohort with suspected head neck cancer with the aim to identify specific indicative markers for tonsillar and base of tongue cancer. Similar to Fakhry et al. [15], abnormal cytology did not surely represent an OSCC. However, HPV16 positive oral samples with high MFI values were indicative of the presence of an HPV16 positive tonsillar or base of tongue cancer, and the latter was in line to that previously reported by others with regard to viral load [14]. The better concordance between HPV16 in oral samples and presence of HPV16 positive tumors as compared to that observed for other HPV types could be due the sensitivity of the assay, which readily detects HPV16, or to that HPV16 possibly induces a higher viral load. However, definite analysis about the other HPV types cannot be made with only four patients with HPV33 positive tumors and only one each with HPV18, 31 and 35 positive tumors. Furthermore, similar to that observed for type concordance, the prevalence of HPV16 was higher in oral samples (17/19, 89%) of patients with HPV16 positive tonsillar cancer compared to (7/13, 54%) for patients with HPV16 positive base of tongue cancer (p < 0.038, Fischer’s exact test). The most obvious reason for this could be that for tonsillar cancer, the tonsillar swabs were collected at, or in the vicinity of the tumor site, which was not the case for patients with base of tongue cancer. Moreover, the surface exposed to the oral cavity is more often limited for the base of tongue cancer cases compared to the tonsillar cancer cases. Notably, 5/ 6 HPV16 positive base of tongue cancer cases with HPV-negative oral samples, were stage T1, while the two HPV16 positive tonsillar cancer cases with HPV16 negative oral samples were of stage T1 and T2. Tumor size may therefore also influence the reliable assessment of HPV infection. Notably, as indicated above HPV DNA was not detected in oral samples of some stage T1–T2 base of tongue and tonsillar cancer cases suggesting that HPV testing in oral samples of HNSCC patients is suboptimal in the initial diagnostic evaluation and possibly also during follow up. Obviously, small primary tumors and small sized recurrences could be missed this way. For the initial diagnostic evaluation HPV testing of the fine needle aspirate (FNA) may be better. For follow up, one could still consider investigating whether it is worthwhile to examine oral samples, of patients with HPV-positive tonsillar and base of tongue cancer, for presence of HPV DNA after treatment. It is however not clear yet whether added information could be gained this way. Regarding the cytology, it is worth noting that the rate of ASCUS/positive reports was higher among patients with tonsillar cancer (50%) than among patients who did not have cancer of the tonsils (40% for base of tongue cancer patients and 32% for patients with other conditions). Furthermore, of the four tonsillar swabs with a positive cytological report, three came from patients with tonsillar cancer. This is not surprising, since it can be expected that cytological abnormalities would be more frequently found when the sampling is specifically aimed at the cancer site. However, abnormal cells were also found among the tonsillar swabs of patients without tonsillar cancer and this may be only partially explained by HPV infection since only few ASCUS/positive cases were HPV-positive on the tonsillar swab. Atypical cells may also be due to inflammation or minor infections (fungi, bacteria). It is worth noting that, except in one case, tonsillar cytological alterations were only detected in cancer patients, irrespective of the tumor site. Therefore, it can be hypothesized that the tumor is responsible for nonspecific changes in the surrounding tissues. In conclusion, cytology samples collected from tonsillar swabs showed only a limited diagnostic value for tonsillar cancer, and were of no use for SCC at other sites. Cytological sampling may be worth further investigation only when specifically targeting
the specific lesion and improving sample collection by using alternative sampling devices. There are limitations in our study. The number of patients could have been larger, but we are grateful that so many patients agreed to participate just before their endoscopy. Furthermore, since HPV16 is so dominant there were few oral samples positive for other HPV types. More importantly however, some patients with HPV-positive tumors, especially those with base of tongue cancer, had HPV-negative oral samples. In these cases the sampling technique could most likely be improved. Taking a swab from the base of tongue more rigorously, e.g. with a special device and by an experienced surgeon, would likely increase the probability of achieving HPV-positive oral samples from both patients with base of tongue cancer and from those with tonsillar cancer. The presence of relatively strong HPV16 signals in oral samples of patients with tonsillar and base of tongue cancer as compared to healthy controls could be of future potential use, but needs to be studied further. Worth mentioning is e.g. the patient with a high HPV16 MFI oral sample and a hyperplasia of the base of tongue with an unknown primary head neck cancer with an HPV 16 positive metastasis who may have had an undetected base of tongue cancer. Furthermore, individuals with an oral sample with a high HPV16 MFI value or other corresponding high signals could also be of interest to follow up. Markedly, among the healthy youth, the majority of HPV16 positive samples had only weak signals with only 1/15 with an MFI > 200. Hypothesizing that not more than 10% of the healthy population have HPV positive oral samples, and that not more than 50% are HPV16 positive, then if 100,0000 mouthwash samples were examined, roughly 333 would have an MFI > 200. This would be speculating broadly, but would indicate that the follow up situation, e.g. by serology or reference to an ENT specialist should not be too extensive. Nevertheless, before even approaching the idea of screening, more studies on oral HPV prevalence are necessary. In summary, we conclude that in patients, with suspected head neck cancer, HPV-positive oral samples, especially with high signals of HPV16 could be indicative of an HPV-positive tonsillar or base of tongue cancer. However, further studies are warranted to conclude whether individuals with high signals of HPV16 in oral samples should be followed up for a potential OSCC or risk of the development of an OSCC.
Conflict of interest statement None declared.
Acknowledgements This work was supported by The Swedish Cancer Society; The Swedish Medical Research Council; The Stockholm Cancer Society; Henning and Ida Perssons Foundation; The Stockholm Cancer Foundation, The Allergy and Cancer Foundation, Karolinska Institutet; the Stockholm City Council; the King Gustaf V Jubilee Fund and the Stockholm County ALF.
References [1] Human Papillomaviruses. In: IARC monographs on the evaluation of carcinogenic risks to humans, vol. 90; 2007. p. 1–636. [2] Hammarstedt L, Lindquist D, Dahlstrand H, Romanitan M, Dahlgren LO, Joneberg J, et al. Human papillomavirus as a risk factor for the increase in incidence of tonsillar cancer. Int J Cancer 2006;119(12):2620–3. [3] Nasman A, Attner P, Hammarstedt L, Du J, Eriksson M, Giraud G, et al. Incidence of human papillomavirus (HPV) positive tonsillar carcinoma in Stockholm, Sweden: an epidemic of viral-induced carcinoma? Int J Cancer 2009;125(2):362–6.
Please cite this article in press as: Nordfors C et al. Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer. Oral Oncol (2014), http://dx.doi.org/10.1016/j.oraloncology.2014.02.012
C. Nordfors et al. / Oral Oncology xxx (2014) xxx–xxx [4] Attner P, Du J, Näsman A, Hammarstedt L, Ramqvist T, Lindholm J, et al. The role of human papillomavirus in the increased incidence of base of tongue cancer. Int J Cancer 2010;126(12):2879–84. [5] Ramqvist T, Dalianis T. Oropharyngeal cancer epidemic and human papillomavirus. Emerg Infect Dis 2010;16(11):1671–7. [6] Chaturvedi AK, Engels EA, Pfeiffer RM, Hernandez BY, Xiao W, Kim E, et al. Human papillomavirus and rising oropharyngeal cancer incidence in the United States. J Clin Oncol 2011;29(32):4294–301. [7] Blomberg M, Nielsen A, Munk C, Kjaer SK. Trends in head and neck cancer incidence in Denmark, 1978–2007: focus on human papillomavirus associated sites. Int J Cancer 2001;129(3):733–41. [8] Ramqvist T, Dalianis T. An epidemic of oropharyngeal squamous cell carcinoma (OSCC) due to human papillomavirus (HPV) infection and aspects of treatment and prevention. Anticancer Res 2011;31(5):1515–9. [9] Gillison ML, Koch WM, Capone RB, Spafford M, Westra WH, Wu L, et al. Evidence for a causal association between human papillomavirus and a subset of head and neck cancers. J Natl Cancer Inst 2000;92(9):709–20. [10] Mellin H, Friesland S, Lewensohn R, Dalianis T, Munck-Wikland E. Human papillomavirus (HPV) DNA in tonsillar cancer: clinical correlates, risk of relapse, and survival. Int J Cancer 2000;89(3):300–4. [11] Mellin H, Dahlgren L, Munck-Wikland E, Lindholm J, Rabbani H, Kalantari M, et al. Human papillomavirus type 16 is episomal and a high viral load may be correlated to better prognosis in tonsillar cancer. Int J Cancer 2002;102(2):152–8. [12] Lindquist D, Romanitan M, Hammarstedt L, Nasman A, Dahlstrand H, Lindholm J, et al. Human papillomavirus is a favourable prognostic factor in tonsillar cancer and its oncogenic role is supported by the expression of E6 and E7. Mol Oncol 2007;1(3):350–5. [13] Attner P, Näsman A, Du J, Hammarstedt L, Ramqvist T, Lindholm J, et al. Survival in patients with human papillomavirus positive tonsillar cancer in relation to treatment. Int J Cancer 2012;131(5):1124–30. [14] D´Souza G, Kreimer AR, Viscidi R, Pawlita M, Fakhry C, Koch WM, et al. Casecontrol study of human papillomavirus and oropharyngeal cancer. New Engl J Med 2007;356(19):1944–56. [15] Fakhry C, Rosenthal BT, Clark DP, Gillison ML. Associations between oral HPV16 infection and cytopathology: evaluation of an ‘‘pap test equivalent’’ in high-risk populations. Cancer Prev Res 2011;4(9):1378–84.
7
[16] Du J, Nordfors C, Ahrlund-Richter A, Sobkowiak M, Romanitan M, Näsman A, et al. Prevalence of oral human papillomavirus infection among youth, Sweden. Emerg Infect Dis 2012;18(9):1468–71. [17] Schmitt M, Bravo IG, Snijders PJ, Gissmann L, Pawlita M, Waterboer T. Beadbased multiplex genotyping of human papillomaviruses. J Clin Microbiol 2006;44(2):504–12. [18] Schmitt M, Dondog B, Waterboer T, Pawlita M. Homogeneous amplification of genital human alpha papillomaviruses by PCR using novel broad-spectrum GP5+ and GP6+ primers. J Clin Microbiol 2008;46(3):1050–9. [19] Muñoz N, Bosch FX, de Sanjose S, Herrero R, Castellsague X, Shah KV. Epidemiologic classification of human papillomavirus types associated with cervical cancer. New Engl J Med 2003;348(6):518–27. [20] Silverman Jr S. Oral cavity. In: Bibbo M, editor. Comprehensive cytopathology. WB Saunders Company; 1991. cap. 15, p. 399–408. [21] Hoffmann M, Ihloff AS, Gorogh T, Weise JB, Fazel A, Krams M, et al. P16(INK4a) overexpression predicts translational active human papillomavirus infection in tonsillar cancer. Int J Cancer 2010;127(7):1595–602. [22] Kreimer AR, Bhatia RK, Messeguer AL, Gonzalez P, Herrero R, Giuliano AR. Oral human papillomavirus in healthy individuals: a systematic review of the literature. Sex Transm Dis 2010;37. 6. [23] Rautava J, Syrjanen S. Human papillomavirus infections in the oral mucosa. J Am Dent Assoc 2011;142(8):905–14. [24] Giraldo P, Goncalves AK, Pereira SA, Barros-Mazon S, Gondo ML, Witkin SS. Human papillomavirus in the oral mucosa of women with genital human papillomavirus lesions. Eur J Obstet Gynecol Reprod Biol 2006;126(1):104–6. [25] Termine N, Giovannelli L, Matranga D, Caleca MP, Bellavia C, Perino A, et al. Oral human papillomavirus infection in women with cervical HPV infection: new data from an Italian cohort and a metanalysis of the literature. Oral Oncol 2011;47(4):244–50. [26] Canadas MP, Bosch FX, Junquera ML, Ejarque M, Font R, Ordonez E, et al. Concordance of prevalence of human papillomavirus DNA in anogenital and oral infections in a high-risk population. J Clin Microbiol 2004;42(3):1330–2. [27] D’Souza G, Fakhry C, Sugar EA, Seaberg EC, Weber K, Minkoff HL, et al. Sixmonth natural history of oral versus cervical human papillomavirus infection. Int J Cancer 2007;121(1):143–50.
Please cite this article in press as: Nordfors C et al. Human papillomavirus prevalence is high in oral samples of patients with tonsillar and base of tongue cancer. Oral Oncol (2014), http://dx.doi.org/10.1016/j.oraloncology.2014.02.012