- Email: [email protected]
Identification and characterisation of a cytochrome P450 gene and processed pseudogene from an arachnid: the cattle tick, Boophilus microplus
Insect Biochemistry and Molecular Biology 29 (1999) 377–384
Identification and characterisation of a cytochrome P450 gene and processed pseudogene from an arachnid: the cattle tick, Boophilus microplus夽 Andrea L. Crampton b
a,*
, Glenn D. Baxter a, Stephen C. Barker
a, b
a Department of Parasitology, The University of Queensland, Brisbane, 4072, Australia Centre for Molecular and Cellular Biology, The University of Queensland, Brisbane, 4072, Australia
Received 15 September 1998; received in revised form 15 January 1999; accepted 20 January 1999
Abstract We isolated and sequenced the first known cytochrome P450 gene and pseudogene from an arachnid, the cattle tick, Boophilus microplus. Both the gene and pseudogene belong to the family CYP4, but a new subfamily, CYP4W, had to be created for these genes because they are substantially different to other CYP4 genes. The gene, CYP4W1, has greatest homology with CYP4C1 from a cockroach, Blaberus discoidalis. The predicted molecular weight of the protein encoded by CYP4W1 (63 KDa) is greater than that of the other CYP4 genes. The pseudogene, CYP4W1P, is probably a processed pseudogene derived from the functional gene CYP4W1. This is only the third CYP processed pseudogene to be identified. The pseudogene is 98% identical to the functional gene, CYP4W1, therefore we hypothesise that this pseudogene evolved recently from the functional gene. The CYP4 genes from arthropods have diverged from each other more than those of mammals; consequently the phylogeny of the arthropod genes could not be resolved. 1999 Elsevier Science Ltd. All rights reserved. Keywords: Arachnid; Cytochrome P450; CYP4; Processed pseudogene; Boophilus microplus; Ixodida
. 1. Introduction The super-family CYP, the cytochrome P450s, is ancient and diverse. More than 481 CYP genes have been identified from prokaryotes and eukaryotes (Nelson et al., 1996). Members of a family of CYP genes have ⱖ40% amino acid identity whereas those placed in the same subfamily have ⱖ46% identity (Nebert et al., 1991). CYP enzymes metabolise a range of endogenous and exogenous substrates (Nelson et al., 1996). Many CYP enzymes are involved in endogenous metabolic pathways that are common to most organisms e.g., fatty acid metabolism (Kusunose, 1993). Other CYP enzymes 夽 Sequence accession: The sequences reported in this paper have been deposited in Genbank; accession numbers: AF081807 (CYP4W1) and AF081808 (CYP4W1P). * Corresponding author. Present address: Department of Biochemistry, 124 Engel Hall, Mail Stop 0308, Virginia Tech, Blacksburg, VA 24061, USA. Fax: +1-515-540-231-9070. E-mail address: [email protected] (A.L. Crampton)
metabolise and/or detoxify exogenous substances like drugs and pesticides (Nelson et al., 1996). Members of the families CYP6 and CYP9 contribute to resistance to insecticides in the house fly Musca domestica (Tomita and Scott, 1995) and tobacco budworm, Heliothis virescens (Rose et al., 1997). Both vertebrates and invertebrates have CYP4 genes; thus this is one of the most ancient families of cytochrome P450s (Bradfield et al., 1991; Gandhi et al., 1992). CYP4 enzymes primarily metabolise endogenous compounds e.g., CYP4A metabolises fatty acids and CYP4B metabolises steroids (Bradfield et al., 1991). To date, only 5 CYP4 genes from invertebrates have been fully sequenced; all are from insects, 3 from Drosophila melanogaster (fruit fly) CYP4D2, CYP4D1 (Gandhi et al., 1992) and CYP4E2 (Pittendrigh et al., 1996), the others are from, Blaberus discoidalis (cockroach), CYP4C1 (Bradfield et al., 1991) and Manduca sexta (tobacco hornworm), CYP4M2 (Snyder et al., 1995). Boophilus microplus, the cattle tick, is a haematophagous arachnid (suborder Ixodida, family Ixodidae). B. microplus is the most economically important tick of
0965-1748/99/$ - see front matter. 1999 Elsevier Science Ltd. All rights reserved. PII: S 0 9 6 5 - 1 7 4 8 ( 9 9 ) 0 0 0 1 3 - 2
378
A.L. Crampton et al. / Insect Biochemistry and Molecular Biology 29 (1999) 377–384
cattle in the world (Angus, 1996). Crampton et al. (1998) found an expressed sequenced tag (EST 118) from B. microplus, that was significantly similar to CYP6C2 from the house fly M. domestica. Here we report on a gene and pseudogene that were isolated by the polymerase chain reaction (PCR) on the basis of this EST.
ical clones was compared to protein sequences in Genbank (Benson et al., 1998) with BLASTX (Altschul et al., 1990) through ANGIS (Australian National Genomic Information Service) and found to be part of a CYP gene. 2.3. 5⬘ and 3⬘ RACE
2. Materials and methods 2.1. RNA extraction and “Marathon” cDNA construction Live B. microplus larvae were snap frozen in liquid nitrogen and ground to powder using a mortar and pestle. RNA was then extracted by the method of Chomczynski and Sacchi (1987). Poly A+ RNA was purified by oligo (dT) cellulose affinity chromatography (New England Bio-Labs) (Sambrook et al., 1989). cDNA was made with the Marathon cDNA Amplification Kit (Clontech). Adaptor sequences attached to the ends of the cDNA enabled it to be used in 5⬘ and 3⬘ RACE (Random Amplification of cDNA Ends). 2.2. Degenerate primer design and application Degenerate oligonucleotide primers were designed from the alignment of amino acid sequences of B. microplus EST 118 (Crampton et al., 1998), and 4 CYP4 sequences of insects, retrieved from GenPept: CYP4C1 (B. discoidalis), CYP4D1 (D. melanogaster), CYP4D2 (D. melanogaster) and CYP4E2 (D. melanogaster). Reverse primers 450CTR1 (5⬘ CCHATRCARTTYCTNGG 3⬘) and 450CTR2 (5⬘ CCHATRCARTTNCGNGG 3⬘) were designed to anneal to the heme binding region that is conserved among cytochrome P450 genes. A forward degenerate primer 450NT4F (5⬘ GARGTNGAYACNTTRAUGTT 3⬘) was designed to anneal to the CYP4 specific sequence motif EVDTFMF. These primers were used in PCR of cDNA to amplify fragments of any CYP4 genes present. Each 25 µl PCR reaction contained 0.2 µM of each primer, 200 µM each dNTP and 0.5 U of Expand Long Distance Enzyme Mix (Boehringer Mannheim); the cycling conditions were, 94°C for 10 mins followed by 30 cycles of 94°C for 1 min, 55°C for 1 min, 68°C for 2 mins, then a final extension step, one cycle of 68°C for 10 mins. Amplified products were cloned into pGEM T-easy vector (Promega); plasmids were purified with the High Pure Plasmid Isolation Kit (Boehringer Mannheim). The ends of the inserts from eight clones were sequenced by doublestrand dideoxy terminator cycle sequencing (Applied Biosystems) with the universal M13 forward and reverse primers (M13F and M13R). Labelled fragments were resolved with an ABI373 sequencer; six of the eight clones were identical. The sequence from the six ident-
Four gene specific primers were designed from the nucleotide sequence of the CYP fragment generated by degenerate PCR (above): two nested forward primers SP4N1 (5⬘ GAGGGTCATGACACTACGGCA 3⬘), SP4N2 (5⬘ GGGGATGAGCTGGGCCATCTA 3⬘) and two nested reverse primers SP4CA (5⬘ GTCTGGCCTGAATTCATCCGG 3⬘), SP4CB (GCTCGTCATGATGTAGGTTGT 3⬘). These primers were used in conjunction with the “anchor primer” API (Clontech), in 5⬘ and 3⬘ RACE, to amplify the 5⬘ and 3⬘ ends of the gene from cDNA. PCR reagents were as above, the cycling conditions were, 94°C for 5 mins, then 20 cycles of 94°C for 20 secs, 60°C for 10 secs and 68°C for 3 mins, followed by 15 cycles of 95°C for 20 secs, 60°C for 10 secs and 68°C for 5 mins, this was followed by a final extension cycle of 68°C for 10 mins. PCR products were cloned into pGEM T-easy vector (Promega) and full length sequences obtained by primer walking along three clones. Primers used to sequence the clones of the products amplified by 3⬘ RACE were SP4CB, SP4N4 (forward primer 5⬘ ACAACCTACATCATGACGAGC 3⬘) and M13R. Clones of the products amplified by 5⬘ RACE were sequenced with SP4CB, SP4N2, SP4CC (reverse primer 5⬘ AGATGGCCCAGCTCATCCCC 3⬘), SP4CD (reverse primer 5⬘ CGTCACTCTCACTGGCTG 3⬘) and M13F. 2.4. Whole gene amplifications from cDNA Nucleotide sequences from the 5⬘ and 3⬘ clones were combined to make a contig of the entire gene. A forward primer TKCYP4F (5⬘ GCGGTGAGCAGCACGATG 3⬘) and a reverse primer TKCYP4R (5⬘ CGGTACACGATGAGTCCC 3⬘) were then designed to anneal to the 5⬘ and 3⬘ ends. These primers were used to amplify the whole gene from cDNA in one fragment. PCR reagents were as above. The cycling conditions were 95°C for 5 mins followed by 30 cycles of 95°C for 20 secs, 62°C for 10 secs and 68°C for 3 mins, followed by a final extension of 68°C for 10 mins. PCR products were cloned into pGEM T-easy vector (Promega) and sequenced (as described above). Primers used in sequencing were, TKCYP4F, TKCYP4R, SP4CD, SP4CC, SP4N1, SP4CB, SP4N4 plus FIDOF2 (forward primer 5⬘ CCAACGAGGCGCACCGTTTG 3⬘) and FIDOR (reverse primer 5⬘ GCCTCAGGACGAGTTCCG 3⬘). See Fig. 1 for priming sites.
A.L. Crampton et al. / Insect Biochemistry and Molecular Biology 29 (1999) 377–384
379
Fig. 1. Primers used to sequence the functional gene, CYP4W1 and the pseudogene, CYP4W1P. Note that the primer FIDOF2 is immediately upstream of the 191 bases that are absent in the pseudogene, CYP4W1P.
2.5. PCR of genomic DNA DNA was extracted from larval ticks by a modified phenol chloroform extraction and purification (Crampton et al., 1996). We then attempted to use the primers TKCYP4F and TKCYP4R to amplify by PCR the gene from genomic DNA. The cycling conditions were: 95°C for 5 mins then 30 cycles of 95°C for 20 secs, 62°C for 20 secs and 68°C for 20 mins followed by a final extension cycle of 68°C for 20 mins. The amplified products were cloned and 10 of the clones sequenced (as described above) with the primer FIDOF2. 2.6. Gene characterisation and phylogenetic analysis The deduced amino acid sequence of our cDNA clone was aligned against other full length CYP4 amino acid sequences using EClustalW (Thompson et al., 1994) on ANGIS. Sequences used in the alignment and their Genbank accession numbers are: CYP4A4 from Oryctolagus cuniculus (rabbit), L04758; CYP4A6 from O. cuniculus, M28656; CYP4A11 from Homo sapiens (human), L04751; CYP4B1 from Mus musculus (mouse), D50834; CYP4C1 from B. discoidalis (cockroach), M63798; CYP4D1 from D. melanogaster (fruit fly), X67645; CYP4D2 from D. melanogaster, Z23005; CYP4E2 from D. melanogaster, U56957; CYP4F1 from Rattus norvegicus (rat), M94548; CYP4M2 from M. sexta (tobacco hornworm), L38671 and CYP3A1 from R. norvegicus, M10161. We used Pepwindow (a GCG program) on ANGIS to generate a Kyte–Doolittle hydrophobicity plot (Kyte and Doolittle, 1982) of our translated cDNA sequence. We used Pepstats (a GCG program) on ANGIS to determine the putative molecular weight of our translated cDNA sequence and the sequences used in the alignment above. Gap (a GCG program) on ANGIS was used to determine the percentage similarity and percentage identity of our sequence to the sequences retrieved from Genbank (above). Phylogenetic trees were constructed with PAUP* (beta test version, 4.06, written by D. Swafford). We used CYP3A1 for outgroup reference because CYP3 is thought to be a sister-family to CYP4 (Bradfield et al., 1991). We did maximum parsimony analysis with the branch and bound algorithm which is guaranteed to find the shortest tree (Hendy and Penny, 1989). Neighbour joining was used to construct genetic distance trees. Bootstrap resampling (200
replicates) was then used to test the support for branches in the parsimony and distance analyses.
3. Results and discussion 3.1. CYP4W1, the functional gene CYP4W1 is the first CYP4 gene to have been isolated from an arachnid (mites, ticks, spiders, scorpions and their kin); it was named by the P450 nomenclature committe (D. Nelson pers comm ). CYP4W1 has 549 residues and a hydrophobic N terminus which is characteristic of membrane-bound CYP proteins (Feyereisen et al., 1990). The protein predicted from CYP4W1 has a molecular weight of 63 KDa; this is larger than the predicted molecular weights of the other fully sequenced CYP4 genes which are 55–60 KDa. The CYP signature motif FxxGxxxCxG (Feyereisen et al., 1990) is present at residues 483–492 (Fig. 2); the cysteine residue is vital for binding the heme iron present in mature CYP enzymes (Gotoh et al., 1983). Residues 344–356 (EVDTFMFEGHDTT) are a sequence motif characteristic of all CYP4 genes (Bradfield et al., 1991); it is the presence of this motif rather than level of sequence similarity which best diagnoses members of this family (Bradfield et al., 1991). Other important motifs include residues ExxR (410–413) which form a salt-bridge in the mature protein (Graham-Lorence and Peterson, 1996), and threonine 356, which has been found in all CYP proteins so far and binds oxygen to the protein (Feyereisen et al., 1990). The presence of PxxFxP (residues 464–469) indicates that the protein is microsomal (i.e., binds to the membrane of the endoplasmic reticulum) rather than mitochondrial (Graham-Lorence and Peterson, 1996). CYP4W1 is most similar to CYP4C1 from a cockroach: 41.5% identical, 62.3% similar. 3.2. CYP4W1P, processed pseudogene While trying to amplify CYP4W1 from cDNA we amplified and subsequently isolated a smaller, related gene. This cDNA was identical to CYP4W1 except for three base substitutions, three insertions and a large (191 bp) putative deletion. The deletion not only shortened the gene but also caused a shift in the reading frame
380
A.L. Crampton et al. / Insect Biochemistry and Molecular Biology 29 (1999) 377–384
Fig. 2. Nucleotide sequence and deduced amino acids of the putative functional gene, CYP4W1. The double underlined residues (nucleotide positions 459–679) show the 191 bp that have been deleted from the pseudogene, CYP4W1P. Nucleotides in boxes show the six sites at which the pseudogene CYP4W1P differs from the functional gene CYP4W1. Threonine 356 is in bold, it is the last residue of the single underlined CYP4 signature-motif, EVDTFMFEGHDTT. ExxR which is conserved among CYP genes and forms a salt bridge in the mature protein is in a shaded box (residues 410–413) whereas the microsomal indicators, PxxFxP, that are conserved among CYP genes that code for microsomal proteins, are in bold (residues 464–469). The bold underlined area is the heme binding region, that contains the CYP signature motif, FxxGxxxCxG (residues 483–492) which is found in all CYP genes.
A.L. Crampton et al. / Insect Biochemistry and Molecular Biology 29 (1999) 377–384
381
Fig. 2. (continued)
which introduced 15 stop codons, therefore the transcript cannot produce a functional CYP protein and is thus a pseudogene. We also isolated this putative pseudogene from genomic DNA. The sequence of the genomic form
of the pseudogene was identicle to the cDNA form, thus the pesudogene lacks introns. We then attempted to amplify part of the functional gene, CYP4W1, from genomic DNA with primers on either side of the area that
382
A.L. Crampton et al. / Insect Biochemistry and Molecular Biology 29 (1999) 377–384
contains the region (191 bp) that has been deleted from the pseudogene. The only product isolated with this experiment was from the pseudogene CYP4W1P. A likely explanation for our result is that the genomic form of CYP4W1 is too large to be amplified by PCR due to the presence of large intron/s. Note that introns have been found in CYP4 genes from other arthropods (Frolov and Alatortsev, 1994; Scott et al., 1994) and CYP4 genes of mammals (Palmer et. al., 1993). Therefore the apparent lack of introns in the pseudogene and the mutations that led to a change in reading frame indicate to us that the gene is a processed pseudogene. Since the pseudogene is highly homologous to
CYP4W1 it probably arose from the retroposition of a processed CYP4W1 mRNA i.e., the mRNA was reverse transcribed, then the DNA product was incorporated into the genome. We named the pesudogene CYP4W1P in accordance with cytochrome P450 nomenclature (Nelson et al., 1996). When CYP4W1 and CYP4W1P were aligned and the alignment adjusted for the 191 bp deletion, the following differences in nucleotide and translated amino acid sequences were evident: (i) at base 235 the pseudogene has a “A” rather then “G” which results in a alanine rather than a threonine; (ii) at position 367 there is a synonymous substitution, the pseudogene has a “G” rather than “T”; and (iii) at position 1631 the
Fig. 3. Genetic distance (GD) tree produced by a neighbour joining analysis of the amino acid sequences. Numbers on internodes show bootstrap support (200 replicates) for the clade to the right of the internode. Numbers above the lines are from distance analyses whereas numbers below the line are from maximum parsimony analyses (MP). Absence of a number shows that the branch was not present in that particular analysis. CYP3A1 from a rat was used for outgroups reference (see text).
A.L. Crampton et al. / Insect Biochemistry and Molecular Biology 29 (1999) 377–384
pseudogene has a “A” rather than “T” which, when both genes are read in the correct frame results in a isoleucine instead of a lysine. The two remaining differences were in the 3⬘ untranslated region, there was, an additional “GT” at base position 1764, this extended an existing GT repeat; and a “G” has been inserted at position 1986. Pseudogenes are not constrained by the same selective forces as functional genes, thus, nonsynonymous nucleotide substitutions and substitutions that change the reading frame are more common in pseudogenes. Consequently the nucleotide sequence of pseudogenes tend to evolve more rapidly than the sequences of functional genes. Therefore pseudogenes such as CYP4W1P that are highly homologous (98% identity when the 191 bp deletion is ignored) to their “parent” gene, probably diverged recently (Wilde, 1986). Processed pseudogenes are derived from genes expressed in germ cells (Wilde, 1986), therefore the existence of the pseudogene, CYP4W1P, indicates that the functional gene, CYP4W1, is expressed in germ cells. Until now, the expression of CYP genes in germ cells was thought to be restricted to the CYP51 genes of mammals; CYP51 is the only other CYP family in which processed pseudogenes have been discovered (Rozman et al., 1996; Noshiro et al., 1997). Like CYP4W1P the CYP51 pseudogenes appear to have arisen relatively recently (Rozman et al., 1996; Noshiro et al., 1997). 3.3. Phylogeny Parsimony and distance analyses produced similar trees. The CYP4 subfamilies from mammals CYP4A11, CYP4A4, CYP4A6, CYP4B1 and CYP4F1, formed a well-supported clade (100% bootstrap support) but relationships among the subfamilies of CYP4s from arthropods (the remaining sequences) were poorly resolved (Fig. 3). However the genes from arthropods did form a clade with reasonable bootstrap support (73) in the genetic distance tree, but neither this branch nor the two internal branches were present in the maximum parsimony tree. The sequences from the arthropods have diverged much more than those from the mammals as might be expected since mammals only evolved about 100 million years ago (Gilbert et al., 1986) whereas arthropods are thought to have evolved 600–700 million years ago (Ayala et al., 1998). We cannot conclude anything about the phylogenetic relationships of CYP4W1, from the cattle tick, from our trees. The phylogenetic position of CYPW1 from B. microplus may be better resolved when more CYP genes have been isolated from other ticks and other arachnids. Acknowledgements We sincerely thank Peter Green, Queensland Department of Primary Industries, Animal Research Institute
383
Yeerongpilly, Brisbane Australia, for gifts of B. microplus. We also thank Dr David Nelson for his assistance with the naming of CYP4W1 and CYP4W1P. This work was supported in part by ACIAR project 9047.
References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.L., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Angus, B.A., 1996. The history of the cattle tick Boophilus microplus in Australia and achievements in its control. Int. J. Parasitol. 26, 1341–1355. Ayala, F.J., Rzhetsky, A., Ayala, F., 1998. Origin of the metazoan phyla: molecular clocks confirm paleontological estimates. Proc. Natl. Acad. Sci. USA 95, 606–611. Benson, D.A., Boguski, M.S., Lipman, D.J., Ostell, J., Francis, B.F., 1998. Genbank. Nucl. Acids Res. 26, 1–7. Bradfield, J.Y., Lee, Y., Keeley, L.L., 1991. Cytochrome P450 family 4 in a cockroach: Molecular cloning and regulation by hypertrehalosemic hormone. Proc. Natl. Acad. Sci. USA 88, 4558–4562. Chomczynski, P., Sacchi, N., 1987. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analyt. Biochem. 162, 156–159. Crampton, A., McKay, I., Barker, S.C., 1996. Phylogeny of Ticks (Ixodida) Inferred from nuclear ribosomal DNA. Int. J. Parasitol. 52, 511–517. Crampton, A.L., Miller, C., Baxter, G.D., Barker, S.C., 1998. Expressed sequenced tags and new genes from the cattle tick, Boophilus microplus. Expt. Appl. Acarol. 22, 177–186. Feyereisen, R., Koener, J.F., Carino, F.A., Daggett, A.S., 1990. Biochemistry and molecular biology of insect cytochrome P450. In: Hagedon, H.H. et al. (Eds.), Molecular Insect Science. Plenum Press, New York, pp. 263–272. Frolov, M.V., Alatortsev, V.E., 1994. Cluster of cytochrome P450 genes on the X chromosome of Drosophila melanogaster. DNA Cell Biol. 13, 663–668. Gandhi, R., Varak, E., Goldberg, M.L., 1992. Molecular analysis of a cytochrome P450 gene of family 4 on the Drosophila X Chromosome. DNA Cell Biol. 11, 397–404. Gilbert, W., Marchionni, M., McKnight, G., 1986. On the antiquity of introns. Cell 46, 151–154. Gotoh, O., Tagashira, Y., Iizuza, T., Fuji-Kuriyama, Y., 1983. Structural characteristics of cytochrome P-450. Possible location of the heme-binding cystein in determined amino-acid sequences. J. Biochem. 93, 807–817. Graham-Lorence, S.E., Peterson, J.A., 1996. Structural alignments of P450s and extrapolations to the unknown. Meths. Enzymol. 272, 315–326. Hendy, M.D., Penny, D., 1989. A framework for the quantitative study of evolutionary trees. Syst. Zool. 38, 297–309. Kusunose, M., 1993. Fatty acid omega-oxidation and eicosanoid metabolism. In: Omura, T. et al. (Eds.), Cytochrome P450. VCH, Tokyo, pp. 127–139. Kyte, J., Doolittle, R.F., 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157, 105–132. Nebert, D.W., Nelson, D.R., Coon, M.J., Estabrook, R.W., Feyereisen, R., Fujii-Kuriyama, Y., Gonzalez, F.J., Guengerich, F.P., Gunsalus, I.C., Johnson, E.F., Loper, J.C., Sato, R., Waterman, M.R., Waxman, D.J., 1991. The P450 superfamily: update on new sequences, gene mapping, and recommended nomenclature. DNA Cell Biol. 10, 1–14. Nelson, D.R., Koymans, L., Kamataki, T., Stegeman, J.J., Feyereisen, R., Waxman, D.J., Waterman, M.R., Gotoh, O., Coon, M.J., Estabrook, R.W., Gunsalus, I.C., Nebert, D.W., 1996. P450 superfamily:
384
A.L. Crampton et al. / Insect Biochemistry and Molecular Biology 29 (1999) 377–384
update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 6, 1–42. Noshiro, M., Aoyama, Y., Kawamoto, T., Gotoh, O., Horiuchi, T., Yoshida, Y., 1997. Structural and evolutionary studies on sterol 14-demethylase P450 (CYP51), the most conserved P450 monooxygenase: I. structural analyses of the gene and multiple sizes of mRNA. J. Biochem. 122, 1114–1121. Palmer, C.N., Griffin, K.J., Johnson, E.F., 1993. Rabbit prostaglandin omega-hydroxylase (CYP4A4): gene structure and expression. Arch. Biochem. Biophys. 300, 1–8. Pittendrigh, B.R., Mocelin, G., Andreev, O., Ffrench-Constant, R.H., 1996. The sequence of a Drosophila CYP4E2 cytochrome P450encoding cDNA. Gene 179, 295–296. Rose, R.L., Goh, D., Thompson, D.M., Verma, K.D., Heckel, D.G., Gahan, L.J., Roe, R.M., Hodgson, E., 1997. Cytochrome P450 (CYP)9A1 in Heliothis virescens: the first member of a new CYP family. Insect Mol. Biol. 27, 605–615. Rozman, D., Stromstedt, M., Waterman, M.R., 1996. The three human cytochrome P450 lanosterol 14a-demethylase (CYP51) genes reside on chromosomes 3,7 and 13: Structure of the two retrotransposed pseudogenes, associated with line-1 element, and evol-
ution of the human CYP51 family. Arch. Biochem. Biophys. 333, 466–474. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: a laboratory manualIn:, Cold Spring Harbor Laboratory Press, Cold Spring. Scott, J.A., Collins, F.H., Feyereisen, R., 1994. Diversity of cytochrome P450 genes in the mosquito, Anopheles albimanus. Biochem. Biophys. Res. Commun. 205, 1452–1459. Snyder, M.J., Stevens, J.L., Andersen, J.F., Feyereisen, R., 1995. Expression of cytochrome P450 genes of the CYP4 family in the midgut and fat body of the tobacco hornworm, Manduca sexta. Arch. Biochem. Biophys. 321, 13–20. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. Clustal W: improving the sensitivity of pregressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids Res. 22, 4673–4680. Tomita, T., Scott, J.G., 1995. cDNA and deduced protein sequence of CYP6D1 : the putative gene of a cytochrome P450 responsible for pyrethroid resistance in house fly. Insect Biochem. Mol. Biol. 25, 275–283. Wilde, C.D., 1986. Pseudogenes. Crit. Rev. Biochem. 19, 323–352.
Identification and characterisation of a cytochrome P450 gene and processed pseudogene from an arachnid: the cattle tick, Boophilus microplus夽 Andrea L. Crampton b
a,*
, Glenn D. Baxter a, Stephen C. Barker
a, b
a Department of Parasitology, The University of Queensland, Brisbane, 4072, Australia Centre for Molecular and Cellular Biology, The University of Queensland, Brisbane, 4072, Australia
Received 15 September 1998; received in revised form 15 January 1999; accepted 20 January 1999
Abstract We isolated and sequenced the first known cytochrome P450 gene and pseudogene from an arachnid, the cattle tick, Boophilus microplus. Both the gene and pseudogene belong to the family CYP4, but a new subfamily, CYP4W, had to be created for these genes because they are substantially different to other CYP4 genes. The gene, CYP4W1, has greatest homology with CYP4C1 from a cockroach, Blaberus discoidalis. The predicted molecular weight of the protein encoded by CYP4W1 (63 KDa) is greater than that of the other CYP4 genes. The pseudogene, CYP4W1P, is probably a processed pseudogene derived from the functional gene CYP4W1. This is only the third CYP processed pseudogene to be identified. The pseudogene is 98% identical to the functional gene, CYP4W1, therefore we hypothesise that this pseudogene evolved recently from the functional gene. The CYP4 genes from arthropods have diverged from each other more than those of mammals; consequently the phylogeny of the arthropod genes could not be resolved. 1999 Elsevier Science Ltd. All rights reserved. Keywords: Arachnid; Cytochrome P450; CYP4; Processed pseudogene; Boophilus microplus; Ixodida
. 1. Introduction The super-family CYP, the cytochrome P450s, is ancient and diverse. More than 481 CYP genes have been identified from prokaryotes and eukaryotes (Nelson et al., 1996). Members of a family of CYP genes have ⱖ40% amino acid identity whereas those placed in the same subfamily have ⱖ46% identity (Nebert et al., 1991). CYP enzymes metabolise a range of endogenous and exogenous substrates (Nelson et al., 1996). Many CYP enzymes are involved in endogenous metabolic pathways that are common to most organisms e.g., fatty acid metabolism (Kusunose, 1993). Other CYP enzymes 夽 Sequence accession: The sequences reported in this paper have been deposited in Genbank; accession numbers: AF081807 (CYP4W1) and AF081808 (CYP4W1P). * Corresponding author. Present address: Department of Biochemistry, 124 Engel Hall, Mail Stop 0308, Virginia Tech, Blacksburg, VA 24061, USA. Fax: +1-515-540-231-9070. E-mail address: [email protected] (A.L. Crampton)
metabolise and/or detoxify exogenous substances like drugs and pesticides (Nelson et al., 1996). Members of the families CYP6 and CYP9 contribute to resistance to insecticides in the house fly Musca domestica (Tomita and Scott, 1995) and tobacco budworm, Heliothis virescens (Rose et al., 1997). Both vertebrates and invertebrates have CYP4 genes; thus this is one of the most ancient families of cytochrome P450s (Bradfield et al., 1991; Gandhi et al., 1992). CYP4 enzymes primarily metabolise endogenous compounds e.g., CYP4A metabolises fatty acids and CYP4B metabolises steroids (Bradfield et al., 1991). To date, only 5 CYP4 genes from invertebrates have been fully sequenced; all are from insects, 3 from Drosophila melanogaster (fruit fly) CYP4D2, CYP4D1 (Gandhi et al., 1992) and CYP4E2 (Pittendrigh et al., 1996), the others are from, Blaberus discoidalis (cockroach), CYP4C1 (Bradfield et al., 1991) and Manduca sexta (tobacco hornworm), CYP4M2 (Snyder et al., 1995). Boophilus microplus, the cattle tick, is a haematophagous arachnid (suborder Ixodida, family Ixodidae). B. microplus is the most economically important tick of
0965-1748/99/$ - see front matter. 1999 Elsevier Science Ltd. All rights reserved. PII: S 0 9 6 5 - 1 7 4 8 ( 9 9 ) 0 0 0 1 3 - 2
378
A.L. Crampton et al. / Insect Biochemistry and Molecular Biology 29 (1999) 377–384
cattle in the world (Angus, 1996). Crampton et al. (1998) found an expressed sequenced tag (EST 118) from B. microplus, that was significantly similar to CYP6C2 from the house fly M. domestica. Here we report on a gene and pseudogene that were isolated by the polymerase chain reaction (PCR) on the basis of this EST.
ical clones was compared to protein sequences in Genbank (Benson et al., 1998) with BLASTX (Altschul et al., 1990) through ANGIS (Australian National Genomic Information Service) and found to be part of a CYP gene. 2.3. 5⬘ and 3⬘ RACE
2. Materials and methods 2.1. RNA extraction and “Marathon” cDNA construction Live B. microplus larvae were snap frozen in liquid nitrogen and ground to powder using a mortar and pestle. RNA was then extracted by the method of Chomczynski and Sacchi (1987). Poly A+ RNA was purified by oligo (dT) cellulose affinity chromatography (New England Bio-Labs) (Sambrook et al., 1989). cDNA was made with the Marathon cDNA Amplification Kit (Clontech). Adaptor sequences attached to the ends of the cDNA enabled it to be used in 5⬘ and 3⬘ RACE (Random Amplification of cDNA Ends). 2.2. Degenerate primer design and application Degenerate oligonucleotide primers were designed from the alignment of amino acid sequences of B. microplus EST 118 (Crampton et al., 1998), and 4 CYP4 sequences of insects, retrieved from GenPept: CYP4C1 (B. discoidalis), CYP4D1 (D. melanogaster), CYP4D2 (D. melanogaster) and CYP4E2 (D. melanogaster). Reverse primers 450CTR1 (5⬘ CCHATRCARTTYCTNGG 3⬘) and 450CTR2 (5⬘ CCHATRCARTTNCGNGG 3⬘) were designed to anneal to the heme binding region that is conserved among cytochrome P450 genes. A forward degenerate primer 450NT4F (5⬘ GARGTNGAYACNTTRAUGTT 3⬘) was designed to anneal to the CYP4 specific sequence motif EVDTFMF. These primers were used in PCR of cDNA to amplify fragments of any CYP4 genes present. Each 25 µl PCR reaction contained 0.2 µM of each primer, 200 µM each dNTP and 0.5 U of Expand Long Distance Enzyme Mix (Boehringer Mannheim); the cycling conditions were, 94°C for 10 mins followed by 30 cycles of 94°C for 1 min, 55°C for 1 min, 68°C for 2 mins, then a final extension step, one cycle of 68°C for 10 mins. Amplified products were cloned into pGEM T-easy vector (Promega); plasmids were purified with the High Pure Plasmid Isolation Kit (Boehringer Mannheim). The ends of the inserts from eight clones were sequenced by doublestrand dideoxy terminator cycle sequencing (Applied Biosystems) with the universal M13 forward and reverse primers (M13F and M13R). Labelled fragments were resolved with an ABI373 sequencer; six of the eight clones were identical. The sequence from the six ident-
Four gene specific primers were designed from the nucleotide sequence of the CYP fragment generated by degenerate PCR (above): two nested forward primers SP4N1 (5⬘ GAGGGTCATGACACTACGGCA 3⬘), SP4N2 (5⬘ GGGGATGAGCTGGGCCATCTA 3⬘) and two nested reverse primers SP4CA (5⬘ GTCTGGCCTGAATTCATCCGG 3⬘), SP4CB (GCTCGTCATGATGTAGGTTGT 3⬘). These primers were used in conjunction with the “anchor primer” API (Clontech), in 5⬘ and 3⬘ RACE, to amplify the 5⬘ and 3⬘ ends of the gene from cDNA. PCR reagents were as above, the cycling conditions were, 94°C for 5 mins, then 20 cycles of 94°C for 20 secs, 60°C for 10 secs and 68°C for 3 mins, followed by 15 cycles of 95°C for 20 secs, 60°C for 10 secs and 68°C for 5 mins, this was followed by a final extension cycle of 68°C for 10 mins. PCR products were cloned into pGEM T-easy vector (Promega) and full length sequences obtained by primer walking along three clones. Primers used to sequence the clones of the products amplified by 3⬘ RACE were SP4CB, SP4N4 (forward primer 5⬘ ACAACCTACATCATGACGAGC 3⬘) and M13R. Clones of the products amplified by 5⬘ RACE were sequenced with SP4CB, SP4N2, SP4CC (reverse primer 5⬘ AGATGGCCCAGCTCATCCCC 3⬘), SP4CD (reverse primer 5⬘ CGTCACTCTCACTGGCTG 3⬘) and M13F. 2.4. Whole gene amplifications from cDNA Nucleotide sequences from the 5⬘ and 3⬘ clones were combined to make a contig of the entire gene. A forward primer TKCYP4F (5⬘ GCGGTGAGCAGCACGATG 3⬘) and a reverse primer TKCYP4R (5⬘ CGGTACACGATGAGTCCC 3⬘) were then designed to anneal to the 5⬘ and 3⬘ ends. These primers were used to amplify the whole gene from cDNA in one fragment. PCR reagents were as above. The cycling conditions were 95°C for 5 mins followed by 30 cycles of 95°C for 20 secs, 62°C for 10 secs and 68°C for 3 mins, followed by a final extension of 68°C for 10 mins. PCR products were cloned into pGEM T-easy vector (Promega) and sequenced (as described above). Primers used in sequencing were, TKCYP4F, TKCYP4R, SP4CD, SP4CC, SP4N1, SP4CB, SP4N4 plus FIDOF2 (forward primer 5⬘ CCAACGAGGCGCACCGTTTG 3⬘) and FIDOR (reverse primer 5⬘ GCCTCAGGACGAGTTCCG 3⬘). See Fig. 1 for priming sites.
A.L. Crampton et al. / Insect Biochemistry and Molecular Biology 29 (1999) 377–384
379
Fig. 1. Primers used to sequence the functional gene, CYP4W1 and the pseudogene, CYP4W1P. Note that the primer FIDOF2 is immediately upstream of the 191 bases that are absent in the pseudogene, CYP4W1P.
2.5. PCR of genomic DNA DNA was extracted from larval ticks by a modified phenol chloroform extraction and purification (Crampton et al., 1996). We then attempted to use the primers TKCYP4F and TKCYP4R to amplify by PCR the gene from genomic DNA. The cycling conditions were: 95°C for 5 mins then 30 cycles of 95°C for 20 secs, 62°C for 20 secs and 68°C for 20 mins followed by a final extension cycle of 68°C for 20 mins. The amplified products were cloned and 10 of the clones sequenced (as described above) with the primer FIDOF2. 2.6. Gene characterisation and phylogenetic analysis The deduced amino acid sequence of our cDNA clone was aligned against other full length CYP4 amino acid sequences using EClustalW (Thompson et al., 1994) on ANGIS. Sequences used in the alignment and their Genbank accession numbers are: CYP4A4 from Oryctolagus cuniculus (rabbit), L04758; CYP4A6 from O. cuniculus, M28656; CYP4A11 from Homo sapiens (human), L04751; CYP4B1 from Mus musculus (mouse), D50834; CYP4C1 from B. discoidalis (cockroach), M63798; CYP4D1 from D. melanogaster (fruit fly), X67645; CYP4D2 from D. melanogaster, Z23005; CYP4E2 from D. melanogaster, U56957; CYP4F1 from Rattus norvegicus (rat), M94548; CYP4M2 from M. sexta (tobacco hornworm), L38671 and CYP3A1 from R. norvegicus, M10161. We used Pepwindow (a GCG program) on ANGIS to generate a Kyte–Doolittle hydrophobicity plot (Kyte and Doolittle, 1982) of our translated cDNA sequence. We used Pepstats (a GCG program) on ANGIS to determine the putative molecular weight of our translated cDNA sequence and the sequences used in the alignment above. Gap (a GCG program) on ANGIS was used to determine the percentage similarity and percentage identity of our sequence to the sequences retrieved from Genbank (above). Phylogenetic trees were constructed with PAUP* (beta test version, 4.06, written by D. Swafford). We used CYP3A1 for outgroup reference because CYP3 is thought to be a sister-family to CYP4 (Bradfield et al., 1991). We did maximum parsimony analysis with the branch and bound algorithm which is guaranteed to find the shortest tree (Hendy and Penny, 1989). Neighbour joining was used to construct genetic distance trees. Bootstrap resampling (200
replicates) was then used to test the support for branches in the parsimony and distance analyses.
3. Results and discussion 3.1. CYP4W1, the functional gene CYP4W1 is the first CYP4 gene to have been isolated from an arachnid (mites, ticks, spiders, scorpions and their kin); it was named by the P450 nomenclature committe (D. Nelson pers comm ). CYP4W1 has 549 residues and a hydrophobic N terminus which is characteristic of membrane-bound CYP proteins (Feyereisen et al., 1990). The protein predicted from CYP4W1 has a molecular weight of 63 KDa; this is larger than the predicted molecular weights of the other fully sequenced CYP4 genes which are 55–60 KDa. The CYP signature motif FxxGxxxCxG (Feyereisen et al., 1990) is present at residues 483–492 (Fig. 2); the cysteine residue is vital for binding the heme iron present in mature CYP enzymes (Gotoh et al., 1983). Residues 344–356 (EVDTFMFEGHDTT) are a sequence motif characteristic of all CYP4 genes (Bradfield et al., 1991); it is the presence of this motif rather than level of sequence similarity which best diagnoses members of this family (Bradfield et al., 1991). Other important motifs include residues ExxR (410–413) which form a salt-bridge in the mature protein (Graham-Lorence and Peterson, 1996), and threonine 356, which has been found in all CYP proteins so far and binds oxygen to the protein (Feyereisen et al., 1990). The presence of PxxFxP (residues 464–469) indicates that the protein is microsomal (i.e., binds to the membrane of the endoplasmic reticulum) rather than mitochondrial (Graham-Lorence and Peterson, 1996). CYP4W1 is most similar to CYP4C1 from a cockroach: 41.5% identical, 62.3% similar. 3.2. CYP4W1P, processed pseudogene While trying to amplify CYP4W1 from cDNA we amplified and subsequently isolated a smaller, related gene. This cDNA was identical to CYP4W1 except for three base substitutions, three insertions and a large (191 bp) putative deletion. The deletion not only shortened the gene but also caused a shift in the reading frame
380
A.L. Crampton et al. / Insect Biochemistry and Molecular Biology 29 (1999) 377–384
Fig. 2. Nucleotide sequence and deduced amino acids of the putative functional gene, CYP4W1. The double underlined residues (nucleotide positions 459–679) show the 191 bp that have been deleted from the pseudogene, CYP4W1P. Nucleotides in boxes show the six sites at which the pseudogene CYP4W1P differs from the functional gene CYP4W1. Threonine 356 is in bold, it is the last residue of the single underlined CYP4 signature-motif, EVDTFMFEGHDTT. ExxR which is conserved among CYP genes and forms a salt bridge in the mature protein is in a shaded box (residues 410–413) whereas the microsomal indicators, PxxFxP, that are conserved among CYP genes that code for microsomal proteins, are in bold (residues 464–469). The bold underlined area is the heme binding region, that contains the CYP signature motif, FxxGxxxCxG (residues 483–492) which is found in all CYP genes.
A.L. Crampton et al. / Insect Biochemistry and Molecular Biology 29 (1999) 377–384
381
Fig. 2. (continued)
which introduced 15 stop codons, therefore the transcript cannot produce a functional CYP protein and is thus a pseudogene. We also isolated this putative pseudogene from genomic DNA. The sequence of the genomic form
of the pseudogene was identicle to the cDNA form, thus the pesudogene lacks introns. We then attempted to amplify part of the functional gene, CYP4W1, from genomic DNA with primers on either side of the area that
382
A.L. Crampton et al. / Insect Biochemistry and Molecular Biology 29 (1999) 377–384
contains the region (191 bp) that has been deleted from the pseudogene. The only product isolated with this experiment was from the pseudogene CYP4W1P. A likely explanation for our result is that the genomic form of CYP4W1 is too large to be amplified by PCR due to the presence of large intron/s. Note that introns have been found in CYP4 genes from other arthropods (Frolov and Alatortsev, 1994; Scott et al., 1994) and CYP4 genes of mammals (Palmer et. al., 1993). Therefore the apparent lack of introns in the pseudogene and the mutations that led to a change in reading frame indicate to us that the gene is a processed pseudogene. Since the pseudogene is highly homologous to
CYP4W1 it probably arose from the retroposition of a processed CYP4W1 mRNA i.e., the mRNA was reverse transcribed, then the DNA product was incorporated into the genome. We named the pesudogene CYP4W1P in accordance with cytochrome P450 nomenclature (Nelson et al., 1996). When CYP4W1 and CYP4W1P were aligned and the alignment adjusted for the 191 bp deletion, the following differences in nucleotide and translated amino acid sequences were evident: (i) at base 235 the pseudogene has a “A” rather then “G” which results in a alanine rather than a threonine; (ii) at position 367 there is a synonymous substitution, the pseudogene has a “G” rather than “T”; and (iii) at position 1631 the
Fig. 3. Genetic distance (GD) tree produced by a neighbour joining analysis of the amino acid sequences. Numbers on internodes show bootstrap support (200 replicates) for the clade to the right of the internode. Numbers above the lines are from distance analyses whereas numbers below the line are from maximum parsimony analyses (MP). Absence of a number shows that the branch was not present in that particular analysis. CYP3A1 from a rat was used for outgroups reference (see text).
A.L. Crampton et al. / Insect Biochemistry and Molecular Biology 29 (1999) 377–384
pseudogene has a “A” rather than “T” which, when both genes are read in the correct frame results in a isoleucine instead of a lysine. The two remaining differences were in the 3⬘ untranslated region, there was, an additional “GT” at base position 1764, this extended an existing GT repeat; and a “G” has been inserted at position 1986. Pseudogenes are not constrained by the same selective forces as functional genes, thus, nonsynonymous nucleotide substitutions and substitutions that change the reading frame are more common in pseudogenes. Consequently the nucleotide sequence of pseudogenes tend to evolve more rapidly than the sequences of functional genes. Therefore pseudogenes such as CYP4W1P that are highly homologous (98% identity when the 191 bp deletion is ignored) to their “parent” gene, probably diverged recently (Wilde, 1986). Processed pseudogenes are derived from genes expressed in germ cells (Wilde, 1986), therefore the existence of the pseudogene, CYP4W1P, indicates that the functional gene, CYP4W1, is expressed in germ cells. Until now, the expression of CYP genes in germ cells was thought to be restricted to the CYP51 genes of mammals; CYP51 is the only other CYP family in which processed pseudogenes have been discovered (Rozman et al., 1996; Noshiro et al., 1997). Like CYP4W1P the CYP51 pseudogenes appear to have arisen relatively recently (Rozman et al., 1996; Noshiro et al., 1997). 3.3. Phylogeny Parsimony and distance analyses produced similar trees. The CYP4 subfamilies from mammals CYP4A11, CYP4A4, CYP4A6, CYP4B1 and CYP4F1, formed a well-supported clade (100% bootstrap support) but relationships among the subfamilies of CYP4s from arthropods (the remaining sequences) were poorly resolved (Fig. 3). However the genes from arthropods did form a clade with reasonable bootstrap support (73) in the genetic distance tree, but neither this branch nor the two internal branches were present in the maximum parsimony tree. The sequences from the arthropods have diverged much more than those from the mammals as might be expected since mammals only evolved about 100 million years ago (Gilbert et al., 1986) whereas arthropods are thought to have evolved 600–700 million years ago (Ayala et al., 1998). We cannot conclude anything about the phylogenetic relationships of CYP4W1, from the cattle tick, from our trees. The phylogenetic position of CYPW1 from B. microplus may be better resolved when more CYP genes have been isolated from other ticks and other arachnids. Acknowledgements We sincerely thank Peter Green, Queensland Department of Primary Industries, Animal Research Institute
383
Yeerongpilly, Brisbane Australia, for gifts of B. microplus. We also thank Dr David Nelson for his assistance with the naming of CYP4W1 and CYP4W1P. This work was supported in part by ACIAR project 9047.
References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.L., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Angus, B.A., 1996. The history of the cattle tick Boophilus microplus in Australia and achievements in its control. Int. J. Parasitol. 26, 1341–1355. Ayala, F.J., Rzhetsky, A., Ayala, F., 1998. Origin of the metazoan phyla: molecular clocks confirm paleontological estimates. Proc. Natl. Acad. Sci. USA 95, 606–611. Benson, D.A., Boguski, M.S., Lipman, D.J., Ostell, J., Francis, B.F., 1998. Genbank. Nucl. Acids Res. 26, 1–7. Bradfield, J.Y., Lee, Y., Keeley, L.L., 1991. Cytochrome P450 family 4 in a cockroach: Molecular cloning and regulation by hypertrehalosemic hormone. Proc. Natl. Acad. Sci. USA 88, 4558–4562. Chomczynski, P., Sacchi, N., 1987. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analyt. Biochem. 162, 156–159. Crampton, A., McKay, I., Barker, S.C., 1996. Phylogeny of Ticks (Ixodida) Inferred from nuclear ribosomal DNA. Int. J. Parasitol. 52, 511–517. Crampton, A.L., Miller, C., Baxter, G.D., Barker, S.C., 1998. Expressed sequenced tags and new genes from the cattle tick, Boophilus microplus. Expt. Appl. Acarol. 22, 177–186. Feyereisen, R., Koener, J.F., Carino, F.A., Daggett, A.S., 1990. Biochemistry and molecular biology of insect cytochrome P450. In: Hagedon, H.H. et al. (Eds.), Molecular Insect Science. Plenum Press, New York, pp. 263–272. Frolov, M.V., Alatortsev, V.E., 1994. Cluster of cytochrome P450 genes on the X chromosome of Drosophila melanogaster. DNA Cell Biol. 13, 663–668. Gandhi, R., Varak, E., Goldberg, M.L., 1992. Molecular analysis of a cytochrome P450 gene of family 4 on the Drosophila X Chromosome. DNA Cell Biol. 11, 397–404. Gilbert, W., Marchionni, M., McKnight, G., 1986. On the antiquity of introns. Cell 46, 151–154. Gotoh, O., Tagashira, Y., Iizuza, T., Fuji-Kuriyama, Y., 1983. Structural characteristics of cytochrome P-450. Possible location of the heme-binding cystein in determined amino-acid sequences. J. Biochem. 93, 807–817. Graham-Lorence, S.E., Peterson, J.A., 1996. Structural alignments of P450s and extrapolations to the unknown. Meths. Enzymol. 272, 315–326. Hendy, M.D., Penny, D., 1989. A framework for the quantitative study of evolutionary trees. Syst. Zool. 38, 297–309. Kusunose, M., 1993. Fatty acid omega-oxidation and eicosanoid metabolism. In: Omura, T. et al. (Eds.), Cytochrome P450. VCH, Tokyo, pp. 127–139. Kyte, J., Doolittle, R.F., 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157, 105–132. Nebert, D.W., Nelson, D.R., Coon, M.J., Estabrook, R.W., Feyereisen, R., Fujii-Kuriyama, Y., Gonzalez, F.J., Guengerich, F.P., Gunsalus, I.C., Johnson, E.F., Loper, J.C., Sato, R., Waterman, M.R., Waxman, D.J., 1991. The P450 superfamily: update on new sequences, gene mapping, and recommended nomenclature. DNA Cell Biol. 10, 1–14. Nelson, D.R., Koymans, L., Kamataki, T., Stegeman, J.J., Feyereisen, R., Waxman, D.J., Waterman, M.R., Gotoh, O., Coon, M.J., Estabrook, R.W., Gunsalus, I.C., Nebert, D.W., 1996. P450 superfamily:
384
A.L. Crampton et al. / Insect Biochemistry and Molecular Biology 29 (1999) 377–384
update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 6, 1–42. Noshiro, M., Aoyama, Y., Kawamoto, T., Gotoh, O., Horiuchi, T., Yoshida, Y., 1997. Structural and evolutionary studies on sterol 14-demethylase P450 (CYP51), the most conserved P450 monooxygenase: I. structural analyses of the gene and multiple sizes of mRNA. J. Biochem. 122, 1114–1121. Palmer, C.N., Griffin, K.J., Johnson, E.F., 1993. Rabbit prostaglandin omega-hydroxylase (CYP4A4): gene structure and expression. Arch. Biochem. Biophys. 300, 1–8. Pittendrigh, B.R., Mocelin, G., Andreev, O., Ffrench-Constant, R.H., 1996. The sequence of a Drosophila CYP4E2 cytochrome P450encoding cDNA. Gene 179, 295–296. Rose, R.L., Goh, D., Thompson, D.M., Verma, K.D., Heckel, D.G., Gahan, L.J., Roe, R.M., Hodgson, E., 1997. Cytochrome P450 (CYP)9A1 in Heliothis virescens: the first member of a new CYP family. Insect Mol. Biol. 27, 605–615. Rozman, D., Stromstedt, M., Waterman, M.R., 1996. The three human cytochrome P450 lanosterol 14a-demethylase (CYP51) genes reside on chromosomes 3,7 and 13: Structure of the two retrotransposed pseudogenes, associated with line-1 element, and evol-
ution of the human CYP51 family. Arch. Biochem. Biophys. 333, 466–474. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: a laboratory manualIn:, Cold Spring Harbor Laboratory Press, Cold Spring. Scott, J.A., Collins, F.H., Feyereisen, R., 1994. Diversity of cytochrome P450 genes in the mosquito, Anopheles albimanus. Biochem. Biophys. Res. Commun. 205, 1452–1459. Snyder, M.J., Stevens, J.L., Andersen, J.F., Feyereisen, R., 1995. Expression of cytochrome P450 genes of the CYP4 family in the midgut and fat body of the tobacco hornworm, Manduca sexta. Arch. Biochem. Biophys. 321, 13–20. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. Clustal W: improving the sensitivity of pregressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids Res. 22, 4673–4680. Tomita, T., Scott, J.G., 1995. cDNA and deduced protein sequence of CYP6D1 : the putative gene of a cytochrome P450 responsible for pyrethroid resistance in house fly. Insect Biochem. Mol. Biol. 25, 275–283. Wilde, C.D., 1986. Pseudogenes. Crit. Rev. Biochem. 19, 323–352.