- Email: [email protected]
Identification and characterization of a hepcidin from half-smooth tongue sole Cynoglossus semilaevis
Fish & Shellfish Immunology 33 (2012) 213e219
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Identification and characterization of a hepcidin from half-smooth tongue sole Cynoglossus semilaevis Yanan Wang a, Xudong Liu a, b, Liman Ma a, Yan Yu c, Haiyang Yu a, Shafi Mohammed a, Guannan Chu a, Linlin Mu a, Quanqi Zhang a, * a b c
College of Marine Life Science, Ocean University of China, Key Laboratory of Marine Genetics and Breeding, Ministry of Education, 5 Yushan Road, Qingdao 266003, PR China North China Sea Environment Monitoring Center, SOA, Qingdao 266033, PR China Department of Life Science, Huainan Normal University, Huainan 232001, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 16 January 2012 Received in revised form 9 April 2012 Accepted 23 April 2012 Available online 28 April 2012
Hepcidin, an antimicrobial peptide, has a dual function including innate immunity and iron regulation. Here, based on the sequence of an EST database, we have isolated and characterized a hepcidin gene (referred to as CsHepcidin) from half-smooth tongue sole (Cynoglossus semilaevis). Analysis of the coding regions indicated CsHepcidin gene comprised 3 exons and 2 introns. The putative CsHepcidin showed a great similarity to other hepcidin orthologues, particularly with respect to its 24 aa signal peptide, typical RX(K/R)R motif and eight conserved cysteine residues in the mature cationic peptide. Phylogenic analysis indicated that CsHepcidin was a hepcidin 1-type peptide of acanthopterygians, with highly homologous with Solea senegalensis hepcidin. In C. semilaevis ontogeny, CsHepcidin mRNA was detected at a low level in unfertilized eggs, increased on 6 d after hatching, and decreased remarkably at metamorphic stage. CsHepcidin transcripts showed a constitutive basal expression in most of the tissues, especially in liver. Challenge with formalin-inactivated Vibrio anguillarum led to significantly upregulations of CsHepcidin gene in liver, head kidney and spleen in time-dependent manners. Biological activity analysis showed that recombinant CsHEP exhibited direct antimicrobial activity against bacterial pathogens in vitro, particularly showed strong activity against the principal fish pathogens, V. anguillarum and Edwardsiella tarda. All these results suggest that CsHepcidin may be involved in the initial response to invasion of microbial pathogens. Further exploration to elucidate the role of CsHepcidin in iron regulation and embryogenesis in C. semilaevis are needed. Ó 2012 Elsevier Ltd. All rights reserved.
Keywords: Hepcidin Antimicrobial peptide Cynoglossus semilaevis Vibrio anguillarum Innate immunity
1. Introduction Innate immune system is vital to fish surviving in aquatic environments with a rich microbial flora. Owing to the lack of a well-developed adaptive immune system, fish rely heavily on the innate components of immunity [1]. Among the main effector molecules of innate immunity are antimicrobial peptides, or AMPs, involving in the first line of defense against a broad spectrum of pathogens [2]. Most of them, including hepcidin, are characterized by being cationic and amphipathic, exerting their lethal effects by solubilizing pathogenic membrane in a detergent like effect [3]. Hepcidin, was initially identified from human plasma ultrafiltrate and urine by two parallel groups [4,5], and recently has been investigated from various vertebrates. It is a diverse family of small
* Corresponding author. Tel./fax: þ86 532 82031806. E-mail address: [email protected] (Q. Zhang). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2012.04.011
cysteine-rich cationic peptides that has a dual function including innate immunity and iron regulation [4,6]. Hepcidin is conserved between mammals and fish at both gene sequence and protein structure. Hepcidin genes consist of three exons and two introns, and encode prepropeptides which are then cleaved to mature, bioactive hepcidins. In mammals and most fishes, it is produced mainly in the liver, but is also detected in other tissues [7]. With respect to iron homeostasis, hepcidin blocks the duodenal iron absorption and iron release from macrophages through degradation of ferroportin, resulting in lowered serum iron [8]. This regulation is proposed to be a defensive mechanism against microbes by iron-withholding [9]. The human hepcidin has been found in three mature isoforms (hep20, hep22 and hep25), differing in amino-terminal truncations, of which hep25 showed antibacterial and antifungal activity in vitro [4,5]. In mouse infected with mycobacteria, hepcidin localizes to the phagosome of macrophages and exhibits antimycobacterial activity in vitro [10]. Similar to mammalian hepcidins, the
214
Y. Wang et al. / Fish & Shellfish Immunology 33 (2012) 213e219
expression of fish hepcidins can be induced dramatically by bacteria, lipopolysaccharide (LPS), polyI:C and vaccination, following different patterns depending on the tissue [9,11e20]. In addition, a direct antimicrobial effect of purified natural peptides [16], recombinant fusion hepcidin [20] and synthetic peptides [4,11,19] is also demonstrated in vitro. These observations support the idea that hepcidin plays an important and wide-ranging role in innate immune defense. The hepcidin gene has been identified from diverse taxa. Amongst marine and fresh water species, more interest has been given to economically important fishes [7]. Half-smooth tongue sole (Cynoglossus semilaevis) is one of the principal economic flatfish cultured in China. However, little information is available about the innate immune mechanism of C. semilaevis. In this work, we report one hepcidin isolated from C. semilaevis, named CsHepcidin. Its genomic organization, tissue and developmental expression patterns, expression response to bacterial infection as well as in vitro antimicrobial activities are characterized. 2. Materials and methods 2.1. Fish, total RNA and DNA isolation The fish used in this study was half-smooth tongue sole C. semilaevis (Pleuronectiformes, Cynoglossidae). All experimental fish were collected from a commercial farm in Haiyang City, China. After acclimation, healthy adult fish were dissected and tissue samples (heart, liver, spleen, head kidney, brain, intestine, gill, muscle and gonads) were collected. Samples of different developmental stages were collected including eight embryonic stages (unfertilized egg, 0.5 h, 2.5 h, 4.5 h, 15 h, 18 h, 23 h and 30 h after fertilization) and seven fry and juvenile stages (1.5 d, 3 d, 6 d, 10 d, 17 d, 24 d and 27 d after hatching). All collected samples were frozen immediately in liquid nitrogen, and then stored at 80 C until use. Total RNA was extracted using the RNAprep Animal RNA Purification Kit (Tiangen, China) and treated with RNase-free DNase (Tiangen, China) according to the manufacturer’s protocol. Genomic DNA was isolated from blood using standard protocol [21]. The quality of the RNA and DNA was evaluated by agarose gel electrophoresis and spectrophotometric measurement. 2.2. Molecular cloning of CsHepcidin gene All used primers are listed in Table 1 and described below. From a normalized cDNA library of C. semilaevis constructed in our laboratory, we found a full length of cDNA that had high identities to Scophthalmus maximus hepcidin precursor by our previous analysis. Then the cDNA clones were sequenced and complete cDNA was verified again. Specific primers Hep-DNA-fw and HepDNA-rv (Table 1) were designed to obtain genomic sequence and to confirm the resulted full-length coding sequence. PCR conditions
Table 1 List of primers used in present study. Primers
Sequence (50 / 30 )
Hep-DNA-fw Hep-DNA-rv Hep-RT-fw Hep-RT-rv 18S-RT-fw 18S-RT-rv Hep-PE-fw Hep-PE-rv
GTTCAGTTGGAGAAAGGTGGA GTCGTCGCCGCTCAGTATT TGGATCAATGGATTACACCGT CGCCGCTCAGTATTTACAACA GGTCTGTGATGCCCTTAGATGTC AGTGGGGTTCAGCGGGTTAC GGAATTCCGTGTGAAGCGC TATGCGGCCGCTTAGTATTTACAAC
were: 94 C for 5 min followed by 35 cycles of 94 C for 30 s, 58 C for 30 s and 72 C for 1 min, with a final extension step of 7 min at 72 C. All the amplified PCR products were separated by agarose gel electrophoresis, purified, cloned into pMD18-T vector (TaKaRa, Dalian, China) and sequenced. The exon and intron boundaries were determined by alignment of the obtained cDNA sequence with the genome sequence generated above. 2.3. Sequence analysis Putative signal peptide was determined by SignalP 4.0 server (http://www.cbs.dtu.dk/services/SignalP/) and cleavage sites for the family of subtilisin/kexin-like proprotein convertases were calculated by the ProP server [22]. Biochemical properties of mature CsHepcidin peptides were evaluated using the ProtParam tool (http://ca.expasy.org/tools/protparam.html). The amino acid sequence alignments of unprocessed preprohepcidins were obtained using ClustalX 1.81 [23]. Phylogenetic tree was accomplished with MEGA v4 [24] using Neighbor-Joining (NJ) method [25] based on the Poisson-corrected distances. One thousand bootstraps were performed for the NJ trees to estimate for the topological stability. 2.4. Bacterial challenge Vibrio anguillarum, a kind of Gram-negative bacterium that shown to be pathogenic to fish [26], was grown in marine broth at 17 C with agitation (200 rpm) for 48 h. The bacteria were then fixed overnight at 4 C in 0.5% formalin, spun down and resuspended in 0.7% NaCl to an optical density of 1.0 (600 nm) for future use. Seventy-five fish (200e250 g) were kept at 16 C seawater in 500 l tanks with continuous aeration. After acclimation, all fish were anaesthetized using 50 mg/l Metacaine prior to treatments. The fish were injected intraperitoneally with 100 ml (per 100 g body weight) of the formalin-inactivated V. anguillarum (35 fish), or with corresponding amount of 0.7% NaCl (35 fish) as immunization control. Five fish were no-injected as blank control. All fish survived throughout the experiment. Five bacteria-injected fish and five 0.7% NaCl injected fish were sacrificed at each sampling time of 1, 4, 8, 16, 24, 48 and 72 h post injection (hpi), respectively. Head kidney, spleen and liver tissues were sampled as described above. 2.5. Quantitative real-time PCR Total RNA was extracted separately from each sample as described in Section 2.1. For cDNA synthesis, 1.0 mg of RNA, Quantiscript RT Kit (Tiangen, China) and random hexamers (Tiangen, China) were used according to the manufacturer’s instructions. Primers for real-time PCR Hep-RT-fw/rv (Table 1) were designed across exoneintron borders to avoid amplification of genomic DNA. Amplifications were performed in 20 ml volume using an ABI Prism 7500 Sequence Detection System (Applied Biosystems, Forster City, CA) and the SYBRÒ Premix Ex TaqÔ II (1) (Perfect Real Time) (TaKaRa, Dalian, China). A dissociation protocol was made at the end of each run to verify that only a single product was amplified. Negative control (no-template reaction) was always included. Evaluation of eight housekeeping genes as references for quantitative real-time RT-PCR analysis of gene expression in C. semilaevis was assayed in our lab (unpublished). 18S rRNA was recognized as the most stable gene at different development stages and in different tissues. Therefore relative expression was determined using the 18S rRNA as reference gene. Quantification of CsHepcidin and 18S rRNA for all samples was derived from the standard curves, which were generated by serial dilutions of plasmids containing either CsHepcidin or 18S rRNA fragments. The results of real-time
Y. Wang et al. / Fish & Shellfish Immunology 33 (2012) 213e219
215
A 93-bp cDNA fragment encoding the predicted mature CsHepcidin was amplified by Pfu DNA Polymerase (Fermentas, Glen Burnie, USA) with primers containing EcoR I and Not I restriction site Hep-PE-fw/rv (Table 1), cloned to vector pET32a (þ) (Novagen, Darmstadt, Germany) and transformed into Escherichia coli host strain BL21(DE3)pLysS. The resulting construct, pET32a-hepcidin, was confirmed by restriction digestion and DNA sequencing. The recombinant protein named CsHEP, fused with Trx improving disulfide formation, was induced following established protocols [27]. The fusion protein CsHEP was purified using AKTA prime plus system (GE Amersham Biosciences, Waukesha, USA), desalinated by MD34 (Solarbio, China) and analyzed by 15% SDS-PAGE. The concentration of purified protein was determined as described by Bradford [28]. As control, empty pET32a (þ) vector was transformed into E. coli host strain BL21(DE3)pLysS, induced, purified, desalinated and analyzed as described above.
for the signal peptide located between Ala24 and Leu25. An Arg-XLys/Arg-Arg motif for recognition and cleavage by furin propeptide convertases [22] was located at Arg67-Arg70, producing a 26 amino acid peptide. This deduced mature hepcidin has an estimated Mw of 2784 Da and theoretical pI of 8.52. A stretch of eight cysteines, a key feature for hepcidins [30], was located at the Cterminal. The alignment of CsHepcidin with selected mammalian and teleost preprohepcidins showed that the putative CsHepcidin shared high identity with that of S. maximus (61.1%) and Micropterus dolomieu (61%), and much lower identity with Homo sapiens prohepcidin (23.8%). The NJ tree constructed from the alignments showed that CsHepcidin and other fish hepcidins were grouped together to form a fish cluster distinct from the mammalian cluster (Fig. 2). The tree indicated that several isotypes of hepcidin are common in the acanthopterygian fish, and these paralogues clearly fell into two classes: hepcidin 1 and hepcidin 2. Being coincident with the taxonomic position, our CsHepcidin was clustered into hepcidin 1 group of acanthopterygian. A conserved sequence Q-S/IH-L/I-S/A-L prior to the first cysteine of the mature hepcidin was lacking in all the peptides of the hepcidin 2 clade, which had 3e5 amino acids, instead. In this position, the predicted mature CsHepcidin had a N-terminal G-G-L-V-A-L sequence differing from all the other hepcidins.
2.7. Antimicrobial assay
3.2. Determination of CsHepcidin genomic DNA sequence
The antimicrobial activities of CsHEP were tested against five Gram-negative bacteria (E. coli, Vibrio harveyi, Vibrio parahaemolyticus, Edwardsiella tarda, V. anguillarum) and one Grampositive bacterium (Staphylococcus aureus). At first, antimicrobial activity was confirmed by an inhibition zone assay. Approximately 1 106 bacterial cells in mid-logarithmic phase were plated onto 20 ml LB broth (or 2216E broth). Purified CsHEP of 1.5 mM in PBS was added into 8 mm diameter wells on the plates respectively, and incubated at appropriate temperatures (25 C for V. anguillarum, 28 C for E. tarda, V. harveyi and V. parahaemolyticus, or 37 C for E. coli and S. aureus) until circular antibacterial zones appeared. PBS, antibiotic and 8.18 mM control protein were used as controls. Then, the minimal inhibition concentration (MIC) of CsHEP was determined by a liquid growth inhibition assay, as previously described [29]. Briefly, logarithmic phase bacterial cultures were diluted to 105 CFU/ml in appropriate broth, and purified CsHEP ranging from 8.18 to 0.06 mM were prepared in PBS buffer in Eppendorf tubes. Diluted bacteria (90 ml) were mixed with 10 ml CsHEP of each concentration in wells of a microtitration plate, and incubated for 24 h (or 48 h for E. tarda) at appropriate temperatures. Wells without bacteria, or without CsHEP (replaced with PBS buffer), or with control protein were set as controls. The MICs were confirmed by visual verification of microbial sedimentation as well as the absorbance reading at 600 nm. All experiments were performed in triplicate.
Sequences of the genomic DNA cloned from several individuals were found to be approximately 1.2 kb (accession number: JQ219158). Analysis of the gene organization showed that the CsHepcidin possessed three exons and two introns. The first intron of 274 bp is markedly short compared to the corresponding introns reported for their human and murine counterparts (2.1 and 1.2 kb, respectively) [4,31]. The length determination of intron 2 was inconclusive as it contained a microsatellite with the tri-nucleotide ACA making the sequencing difficult.
PCR were normalized with the copy number of 18S rRNA of each sample. All samples were run in triplicate. Statistical analysis was performed by one-way analysis of variance (ANOVA) with SPSS13.0 software. A probability value of P < 0.05 was considered to indicate statistical significance. 2.6. Prokaryotic expression and purification of CsHEP
3. Results 3.1. Molecular characterization of CsHepcidin Using specific primers based on the contig of constructed cDNA library, we have isolated a cDNA that contained the full-length CDS of a hepcidin orthologue in C. semilaevis. The CsHepcidin cDNA consisted of 614 bp, comprising a 171 bp 50 -UTR, a 291 bp open reading frame (ORF) predicted to encode a pre-pro-peptide of 96 amino acids, and a 151 bp 30 -UTR with a typical polyadenylation signal (AATAAA) located 13 bp upstream of the poly(A)þ tail (Fig. 1). Analysis of the N-terminal region predicted a potential cleavage site
3.3. Expression of CsHepcidin mRNA in different tissues To assess the expression profile of CsHepcidin mRNA, Quantitative real-time PCR was performed for all sampled tissues from healthy fish (Fig. 3A). The result revealed that CsHepcidin transcripts were abundantly expressed in liver and brain, moderately detected in heart, intestine, ovary and head kidney, and less observed in spleen, testis, gill and muscle. 3.4. Expression of CsHepcidin mRNA in different development stages The qPCR analysis indicated that the expression of CsHepcidin appeared to be developmentally regulated (Fig. 3B). Unfertilized eggs and embryos at different stages before hatching contained very low amount of hepcidin transcripts. The relative level of CsHepcidin mRNA increased slightly after hatching, and elevated steeply to maximum level, about 2.6 fold, from 6 d to 10 d after hatching, when fry started external feeding, then decreased sharply around 24 d and elevated again at the 27-d stage, the last stage we studied. 3.5. The temporal expression of CsHepcidin after microbial challenge To ascertain the effects of bacterial challenge on CsHepcidin expression, C. semilaevis were injected with 1 ml of formalininactivated V. anguillarum per kg fish or with 0.7% NaCl. Expression
216
Y. Wang et al. / Fish & Shellfish Immunology 33 (2012) 213e219
Fig. 1. A nucleotide sequence of unspliced CsHepcidin cDNA. Uppercase letters denote the coding regions and lowercase letters denote the UTRs or introns. The deduce amino acid sequences are translated and shadowed below the coding sequence. The gt/ag intron/exon boundaries are shown in italic and the polyadenylation signal (aataaa) is highlighted in bold. Cysteine residues and the microsatellite located in intron 2 are single and double underlined, respectively. The putative signal peptide cleavage site and proregion cleavage site are also shown. The box indicates the furin cleavage site motif.
of CsHepcidin was measured by real-time PCR in liver, head kidney and spleen tissues. The effectiveness of the bacterial immunization in this study was confirmed by csIL-1b as a positive control (data not shown). The results showed that the kinetics of CsHepcidin expression after bacterial challenge was similar in spleen, head kidney and liver (Fig. 4AeC). In comparison to blank control, the transcription level of CsHepcidin in spleen increased at 8 hpi and came to the highest level at 16 hpi (P < 0.05), followed by a gradual decline to the original level until 48 hpi. The up-regulation of CsHepcidin at 16 hpi was also observed in head kidney and liver, about 12- and 3-fold, respectively. In immunization control, hepcidin expression fluctuated slightly in spleen and head kidney, while inducted significantly in liver at 48 hpi (P < 0.05). This may be because the relative level of CsHepcidin mRNA in liver was more sensitive to the exogenous stimulus than head kidney and spleen. The reason still need further study. 3.6. Antimicrobial activity of CsHEP The recombinant protein CsHEP was induced with 1 mM IPTG at 28 C, and detected mainly in sonicated supernatant (Fig. 5). The
fusion protein was then purified for further use. Detected by inhibition zone assay, direct antimicrobial capability of CsHEP was found against all tested bacteria, especially strong against V. anguillarum and E. tarda, resembling the liquid growth inhibition assay (Table 2). Most of Gram-negative bacteria exhibited obvious susceptibility to CsHEP treatment with MIC ranging from 5.8 mM to 2.92 mM, except E. coli with MIC > 8.18 mM. In contrast, Grampositive bacteria S. aureus was less sensitive (MIC > 8.18 mM). The control protein didn’t show antimicrobial activity by two methods. 4. Discussion AMPs, also known as host defense peptides, play major roles in the innate immune system and some other physiological functions. Fish are a major component of the aquatic fauna that continually fight against pathogens by producing a diverse array of AMPs [32]. Among AMPs, hepcidin is a small cysteine-rich protein with not only antimicrobial activity but also pivotal function in iron homeostasis. In fish, the role of hepcidin in innate immunity has been the subject of intense research interests [33]. In the present study, we have characterized the structure and role of hepcidin in
Y. Wang et al. / Fish & Shellfish Immunology 33 (2012) 213e219
217
Fig. 2. Phylogenetic analysis of hepcidins from C. semilaevis and other vertebrates. The NJ tree was constructed based on the Poisson-corrected distances, with pairwise deletion of gaps. Numbers above the nodes indicate bootstrap percentages of 1000 replicates. The scale bar refers to a phylogenetic distance of 0.1 amino acid substitutions per site.
the immune system of C. semilaevis. Analysis of the gene sequence identified a 291 bp ORF encoding for a putative 96 amino acid peptide with very high homology with other known hepcidins. Most hepcidin genes identified in fish code for a highly conserved signal peptide of 24 residues, an acidic propiece of 38e40 amino acids, and a mature peptide of approximately 19e27 residues [34]. It was not surprising to find that the putative CsHepcidin precursor also shared this structure. The typical RX(K/R)R motif for propeptide convertases [22] is highly conserved among most fish species, including C. semilaevis, but the actual cleavage site may differ. Sequence analysis of the mature region indicated that CsHepcidin possessed eight cysteines, which involved in one vicinal and three interstrand disulfide bridges in human and bass hepcidin [19,35]. Since this structure was known to be associated with antimicrobial activity of the protein [4], it can be predicted that CsHepcidin may also have this immunological function. The first five or six amino acids (Q-S/I-H-L/I-S/A-L) of the predicted mature hepcidin seem to be essential for its ironregulatory activity [36]. However, this sequence is missing in all the peptides of hepcidin 2 cluster in phylogenetic analyses. It is possible that hepcidin variants in some fishes may have evolved different functions for different circumstances, some serve to only support innate immunity while others act solely as iron regulating hormones. As noted above, the predicted NH2-terminus (GGLVAL) of mature CsHepcidin differed from other hepcidins, resembling the phylogenetic analysis, and thus it is reasonable to suggest that CsHepcidin may not involve in iron homeostasis. Further experiments are needed to elucidate the role of CsHepcidin in iron regulation. Quantitative RT-PCR revealed that a low amount of CsHepcidin transcripts were detectable in unfertilized eggs of C. semilaevis, which suggested the presence of maternal hepcidin mRNA. It was
also coincident with the fact that CsHepcidin transcript was more abundant in ovary than in testis (Fig. 3A). The early detection of mRNAs in fish eggs is not rare. In channel catfish, hepcidin gene is expressed early during development [18]. This result implies that hepcidin might take part in development itself, or more probably involve in the immune defense of embryos in C. semilaevis. As is well known, the metamorphosis of flatfish is prominently characterized by morphological transformation from a symmetrical to an asymmetrical body shape, accompanying with eye migration, cranium deformation, asymmetric pigmentation and other changes [37]. An interesting finding of this study was the dramatic decrease of CsHepcidin mRNA at metamorphic stage around 24 days after hatching. Similar phenomenon has been reported in other immune-related molecules, such as MyD88, TLR9 and MHC IIB of C. semilaevis [38e40]. The reasons why the expression of immunerelated genes of C. semilaevis decreases during metamorphosis need further study. In human and mouse, hepcidin transcript is mainly produced by the hepatocytes [4], but it is also expressed in a number of cell types such as macrophages and Kupffer cells [10,41]. In teleost fish, acidophilic granulocytes, macrophages and lymphocytes are shown to express hepcidin gene at different level in the gilthead seabream [42]. As for the distribution in different tissues, the transcripts of hepcidin were usually expressed at a higher level in liver of mammals and most fishes [7]. In this study, we confirmed that the CsHepcidin gene was widely distributed in most tissues evaluated by real-time PCR, with the highest expression being detected in liver followed by heart, intestine, spleen and head kidney (Fig. 2A). This result agreed with previous findings in most reported fishes including tilapia [11], black porgy [15], Japanese flounder [13] and sea bass [14]. Its presences in these tissues might indicate its important function in piscine immune system.
218
Y. Wang et al. / Fish & Shellfish Immunology 33 (2012) 213e219
Fig. 3. (A) Relative expression levels of CsHepcidin gene in different tissues from C. semilaevis. (B) Relative expression levels of CsHepcidin gene during embryos and larvae development in C. semilaevis. UN, unfertilized egg. The relative expression variance is showed as ratio (the amounts of CsHepcidin mRNA normalized to the corresponding 18S rRNA values). Data are shown as mean SEM (n ¼ 3). Values with different superscripts indicate statistically different (P < 0.05).
To understand the potential role of CsHepcidin in the innate immune response, we have generated an experimental model of bacterial challenge, and analyzed the expression of CsHepcidin transcripts in liver, head kidney and spleen. A clear induction of CsHepcidin transcription was detected in all tested tissues at 8 hpi and reached to a peak at 16 hpi. In Atlantic cod, an up-regulation of hepcidin transcription was detected in head kidney and peritoneum examined 1 day after i.p. injection of inactivated V. anguillarum [9]. In mammals, expression of hepcidin was also stimulated by a variety of stimuli including LPS, TNF-a, IL-6 and IL-1 [30]. Interestingly, similar induction and kinetics of C. semilaevis IL-1b was observed in spleen and head kidney during V. anguillarum infection (data not shown). The regulation of Hepcidin expression by cytokines IL-1 has not yet been studied in fish. Besides, the recombinant CsHEP exhibited direct antimicrobial activity against bacterial pathogens in vitro, particularly against the Gram-negative bacteria like V. anguillarum and E. tarda that cause great mortalities and economic losses in many aquaculture species. These results, together with the observation that CsHepcidin expression was upregulated by bacterial challenge, strongly suggest that CsHepcidin may be related to the immune response system and involved in the direct defense against the invasion of microbial pathogens in C. semilaevis. To summarize, starting from a sequence in the cDNA library, we have presented the gene organization and expression data of CsHepcidin, and demonstrated the biological activity of the recombinant mature peptide. CsHepcidin had a wide distribution of expression in normal fish and was dramatically induced by bacterial infection. Furthermore, recombinant CsHEP possessed potent bactericidal activity against several bacterial pathogens at a low concentration. This study will facilitate for the understanding of flatfish innate immunity and will provide potential application of antimicrobial peptides to control fish diseases.
Fig. 4. Temporal expression of CsHepcidin in liver (A), head kidney (B) and spleen (C) after immunized with inactivated V. anguillarum. The relative expression variance is showed as ratio (the amounts of CsHepcidin mRNA normalized to the corresponding 18S rRNA values). Data are shown as mean SEM (n ¼ 5). BC, blank control. Values with different superscripts indicate statistically different (P < 0.05).
Fig. 5. Prokaryotic expression and purification of recombinant CsHEP. The proteins were kept tract using 15% SDS-PAGE. Lane M, protein marker; lane 1, uninduced cells; lane 2, induced cells; lane 3, sonicated supernatant; lane 4, sonicated pellet; lane 5, fraction that eluted from the Ni2þ-NTA resin with 60 mM imidazole; lane 6, purified recombinant CsHEP.
Y. Wang et al. / Fish & Shellfish Immunology 33 (2012) 213e219 Table 2 Antibacterial spectra of the recombinant CsHEP. Bacterium Gram-negative bacteria Escherichia coli Vibrio harveyi Vibrio parahaemolyticus Edwardsiella tarda Vibrio anguillarum Gram-positive bacteria Staphylococcus aureus
Area of inhibition (mm2)
MIC (mM)
12.6 11.3 12.6 28.8 22.6
>8.18 5.84 5.84 2.92 2.92
12.1
>8.18
Acknowledgments This work was supported by the National High-Tech Research and Development Program (No. 2012AA100802). The authors wish to thank Pro. Xiaohua Zhang of Ocean University of China for her gift of bacterial strains used in this paper. References [1] Magnadottir B. Innate immunity of fish (overview). Fish Shellfish Immunol 2006;20:137e51. [2] Hancock REW. Cationic peptides: effectors in innate immunity and novel antimicrobials. Lancet Infect Dis; 2001:156e64. [3] Hancock REW, Chapple DS. Peptide antibiotics. Antimicrobial Agents Chemother 1999;43:1317e23. [4] Krause A, Neitz S, Mägert HJ, Schulz A, Forssmann WG, Schulz-Knappe P, et al. LEAP-1, a novel highly disulfide-bonded human peptide, exhibits antimicrobial activity. FEBS Lett 2000;480:147e50. [5] Park CH, Valore EV, Waring AJ, Ganz T. Hepcidin, a urinary antimicrobial peptide synthesized in the liver. J Biol Chem 2001;276:7806e10. [6] Nicolas G, Bennoun M, Devaux I, Beaumont C, Grandchamp B, Kahn A, et al. Lack of hepcidin gene expression and severe tissue iron overload in upstream stimulatory factor 2 (USF2) knockout mice. Proc Natl Acad Sci U S A 2001;98: 8780e5. [7] Hilton KB, Lambert LA. Molecular evolution and characterization of hepcidin gene products in vertebrates. Gene 2008;415:40e8. [8] Nemeth E, Tuttle MS, Powelson J, Vaughn MB, Donovan A, Ward DM, et al. Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization. Science 2004;306:2090e3. [9] Solstad T, Larsen AN, Seppola M, Jørgensen TØ. Identification, cloning and expression analysis of a hepcidin cDNA of the Atlantic cod (Gadus morhua L.). Fish Shellfish Immunol 2008;25:298e310. [10] Sow FB, Florence WC, Satoskar AR, Schlesinger LS, Zwilling BS, Lafuse WP. Expression and localization of hepcidin in macrophages: a role in host defense against tuberculosis. J Leukoc Biol 2007;82:934e45. [11] Huang PH, Chen JY, Kuo CM. Three different hepcidins from tilapia, Oreochromis mossambicus: analysis of their expressions and biological functions. Mol Immunol 2007;44:1922e34. [12] Douglas SE, Gallant JW, Liebscher RS, Dacanay A, Tsoi SC. Identification and expression analysis of hepcidin-like antimicrobial peptides in bony fish. Dev Comp Immunol 2003;27:589e601. [13] Hirono I, Hwang JY, Ono Y, Kurobe T, Ohira T, Nozaki R, et al. Two different types of hepcidins from the Japanese flounder Paralichthys olivaceus. FEBS J 2005;272:5257e64. [14] Rodrigues PN, Vázquez-Dorado S, Neves JV, Wilson JM. Dual function of fish hepcidin: response to experimental iron overload and bacterial infection in sea bass (Dicentrarchus labrax). Dev Comp Immunol 2006;30:1156e67. [15] Yang M, Wang KJ, Chen JH, Qu HD, Li SJ. Genomic organization and tissuespecific expression analysis of hepcidin-like genes from black porgy (Acanthopagrus schlegelii B). Fish Shellfish Immunol 2007;23:1060e71. [16] Shike H, Lauth X, Westerman ME, Ostland VE, Carlberg JM, Van Olst JC, et al. Bass hepcidin is a novel antimicrobial peptide induced by bacterial challenge. Eur J Biochem 2002;269:2232e7. [17] Park KC, Osborne JA, Tsoi SC, Brown LL, Johnson SC. Expressed sequence tags analysis of Atlantic halibut (Hippoglossus hippoglossus) liver, kidney and spleen tissues following vaccination against Vibrio anguillarum and Aeromonas salmonicida. Fish Shellfish Immunol 2005;18:393e415.
219
[18] Bao B, Peatman E, Li P, He C, Liu Z. Catfish hepcidin gene is expressed in a wide range of tissues and exhibits tissue-specific upregulation after bacterial infection. Dev Comp Immunol 2005;29:939e50. [19] Lauth X, Babon JJ, Stannard JA, Singh S, Nizet V, Carlberg JM, et al. Bass hepcidin synthesis, solution structure, antimicrobial activities and synergism, and in vivo hepatic response to bacterial infections. J Biol Chem 2005;280: 9272e82. [20] Zhang H, Yuan Q, Zhu Y, Ma R. Expression and preparation of recombinant hepcidin in Escherichia coli. Protein Exp Purif 2005;41:409e16. [21] Ausubel F, Brent R, Kingston R, Moore D, Seidman J, Smith J, et al. Current protocols in molecular biology. New York: John Wiley and Sons; 1998. [22] Duckert P, Brunak S, Blom N. Prediction of proprotein convertase cleavage sites. Protein Eng Des Sel 2004;17:107e12. [23] Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 1997;25(24):4876e82. [24] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24:1596e9. [25] Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4(4):406e25. [26] Larsen JL. Vibrio anguillarum: prevalence of typical and atypical strains in marine recipients with special reference to carbohydrate pollution. Acta Vet Scand 1985;26(4):449e60. [27] Sambrook J, Russell DW. Molecular cloning: a laboratory manual. 3ed. New York: Cold Spring Harbor Laboratory; 2001. [28] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem 1976;72:248e54. [29] Bulet P, Dimarcq JL, Hetru C, Lagueux M, Charlet M, Hegy G, et al. A novel inducible antibacterial peptide of Drosophila carries an O-glycosylated substitution. J Biol Chem 1993;268:14893e7. [30] Shi J, Camus AC. Hepcidins in amphibians and fishes: antimicrobial peptides or iron-regulatory hormones? Dev Comp Immunol 2006;30:746e55. [31] Pigeon C, Ilyin G, Courselaud B, Leroyer P, Turlin B, Brissot P, et al. A new mouse liver-specific gene, encoding a protein homologous to human antimicrobial peptide hepcidin, is overexpressed during iron overload. J Biol Chem 2001;16(276):7811e9. [32] Rajanbabu V, Chen JY. Applications of antimicrobial peptides from fish and perspectives for the future. Peptides; 2011:415e20. [33] Barnes AC, Trewin B, Snape N, Kvennefors ECE. Two hepcidin-like antimicrobial peptides in Barramundi Lates calcarifer exhibit differing tissue tropism and are induced in response to lipopolysaccharide. Fish Shellfish Immunol 2011;31:350e7. [34] Robertson LS, Iwanowicz LR, Marranca JM. Identification of centrarchid hepcidins and evidence that 17b-estradiol disrupts constitutive expression of hepcidin-1 and inducible expression of hepcidin-2 in largemouth bass (Micropterus salmoides). Fish Shellfish Immunol 2009;26:898e907. [35] Hunter HN, Fulton DB, Ganz T, Vogel HJ. The solution structure of human hepcidin, a peptide hormone with antimicrobial activity that is involved in iron uptake and hereditary hemochromatosis. J Biol Chem 2002;277: 37597e603. [36] Nemeth E, Preza GC, Jung CL, Kaplan J, Waring AJ, Ganz T. The N-terminus of hepcidin is essential for its interaction with ferroportin: structure-function study. Blood 2006;107:328e33. [37] Fu YS, Shi ZY, Wu ML, Zhang JL, Jia L, Chen XW. Identification and differential expression of microRNAs during metamorphosis of the Japanese flounder (Paralichthys olivaceus). PLoS One 2011;6(7):e22957. [38] Yu Y, Zhang QQ, Li CM, Jiang LM, Yan FS, Wang ZG, et al. Isolation and characterization of Toll-like receptor 9 in half-smooth tongue sole Cynoglossus semilaevis. Fish Shellfish Immunol 2009;26:492e9. [39] Li CM, Yu Y, Sun YY, Li S, Zhong QW, Wang XB, et al. Isolation, polymorphism and expression study of two distinct major histocompatibility complex class II B genes from half-smooth tongue sole (Cynoglossus semilaevis). Int J Immunogenet 2010;37(3):185e97. [40] Yu Y, Zhong QW, Li CM, Jiang LM, Yan FS, Wang ZG, et al. Full-length sequence and expression analysis of a myeloid differentiation factor 88 (MyD88) in halfsmooth tongue sole Cynoglossus semilaevis. Int J Immunogenet 2009;36: 173e82. [41] Theurl M, Theurl I, Hochegger K, Obrist P, Subramaniam N, van Rooijen N, et al. Kupffer cells modulate iron homeostasis in mice via regulation of hepcidin expression. J Mol Med 2008;86:825e35. [42] Cuesta A, Meseguer J, Esteban MA. The antimicrobial peptide hepcidin exerts an important role in the innate immunity against bacteria in the bony fish gilthead seabream. Mol Immunol 2008;45:2333e42.
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Identification and characterization of a hepcidin from half-smooth tongue sole Cynoglossus semilaevis Yanan Wang a, Xudong Liu a, b, Liman Ma a, Yan Yu c, Haiyang Yu a, Shafi Mohammed a, Guannan Chu a, Linlin Mu a, Quanqi Zhang a, * a b c
College of Marine Life Science, Ocean University of China, Key Laboratory of Marine Genetics and Breeding, Ministry of Education, 5 Yushan Road, Qingdao 266003, PR China North China Sea Environment Monitoring Center, SOA, Qingdao 266033, PR China Department of Life Science, Huainan Normal University, Huainan 232001, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 16 January 2012 Received in revised form 9 April 2012 Accepted 23 April 2012 Available online 28 April 2012
Hepcidin, an antimicrobial peptide, has a dual function including innate immunity and iron regulation. Here, based on the sequence of an EST database, we have isolated and characterized a hepcidin gene (referred to as CsHepcidin) from half-smooth tongue sole (Cynoglossus semilaevis). Analysis of the coding regions indicated CsHepcidin gene comprised 3 exons and 2 introns. The putative CsHepcidin showed a great similarity to other hepcidin orthologues, particularly with respect to its 24 aa signal peptide, typical RX(K/R)R motif and eight conserved cysteine residues in the mature cationic peptide. Phylogenic analysis indicated that CsHepcidin was a hepcidin 1-type peptide of acanthopterygians, with highly homologous with Solea senegalensis hepcidin. In C. semilaevis ontogeny, CsHepcidin mRNA was detected at a low level in unfertilized eggs, increased on 6 d after hatching, and decreased remarkably at metamorphic stage. CsHepcidin transcripts showed a constitutive basal expression in most of the tissues, especially in liver. Challenge with formalin-inactivated Vibrio anguillarum led to significantly upregulations of CsHepcidin gene in liver, head kidney and spleen in time-dependent manners. Biological activity analysis showed that recombinant CsHEP exhibited direct antimicrobial activity against bacterial pathogens in vitro, particularly showed strong activity against the principal fish pathogens, V. anguillarum and Edwardsiella tarda. All these results suggest that CsHepcidin may be involved in the initial response to invasion of microbial pathogens. Further exploration to elucidate the role of CsHepcidin in iron regulation and embryogenesis in C. semilaevis are needed. Ó 2012 Elsevier Ltd. All rights reserved.
Keywords: Hepcidin Antimicrobial peptide Cynoglossus semilaevis Vibrio anguillarum Innate immunity
1. Introduction Innate immune system is vital to fish surviving in aquatic environments with a rich microbial flora. Owing to the lack of a well-developed adaptive immune system, fish rely heavily on the innate components of immunity [1]. Among the main effector molecules of innate immunity are antimicrobial peptides, or AMPs, involving in the first line of defense against a broad spectrum of pathogens [2]. Most of them, including hepcidin, are characterized by being cationic and amphipathic, exerting their lethal effects by solubilizing pathogenic membrane in a detergent like effect [3]. Hepcidin, was initially identified from human plasma ultrafiltrate and urine by two parallel groups [4,5], and recently has been investigated from various vertebrates. It is a diverse family of small
* Corresponding author. Tel./fax: þ86 532 82031806. E-mail address: [email protected] (Q. Zhang). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2012.04.011
cysteine-rich cationic peptides that has a dual function including innate immunity and iron regulation [4,6]. Hepcidin is conserved between mammals and fish at both gene sequence and protein structure. Hepcidin genes consist of three exons and two introns, and encode prepropeptides which are then cleaved to mature, bioactive hepcidins. In mammals and most fishes, it is produced mainly in the liver, but is also detected in other tissues [7]. With respect to iron homeostasis, hepcidin blocks the duodenal iron absorption and iron release from macrophages through degradation of ferroportin, resulting in lowered serum iron [8]. This regulation is proposed to be a defensive mechanism against microbes by iron-withholding [9]. The human hepcidin has been found in three mature isoforms (hep20, hep22 and hep25), differing in amino-terminal truncations, of which hep25 showed antibacterial and antifungal activity in vitro [4,5]. In mouse infected with mycobacteria, hepcidin localizes to the phagosome of macrophages and exhibits antimycobacterial activity in vitro [10]. Similar to mammalian hepcidins, the
214
Y. Wang et al. / Fish & Shellfish Immunology 33 (2012) 213e219
expression of fish hepcidins can be induced dramatically by bacteria, lipopolysaccharide (LPS), polyI:C and vaccination, following different patterns depending on the tissue [9,11e20]. In addition, a direct antimicrobial effect of purified natural peptides [16], recombinant fusion hepcidin [20] and synthetic peptides [4,11,19] is also demonstrated in vitro. These observations support the idea that hepcidin plays an important and wide-ranging role in innate immune defense. The hepcidin gene has been identified from diverse taxa. Amongst marine and fresh water species, more interest has been given to economically important fishes [7]. Half-smooth tongue sole (Cynoglossus semilaevis) is one of the principal economic flatfish cultured in China. However, little information is available about the innate immune mechanism of C. semilaevis. In this work, we report one hepcidin isolated from C. semilaevis, named CsHepcidin. Its genomic organization, tissue and developmental expression patterns, expression response to bacterial infection as well as in vitro antimicrobial activities are characterized. 2. Materials and methods 2.1. Fish, total RNA and DNA isolation The fish used in this study was half-smooth tongue sole C. semilaevis (Pleuronectiformes, Cynoglossidae). All experimental fish were collected from a commercial farm in Haiyang City, China. After acclimation, healthy adult fish were dissected and tissue samples (heart, liver, spleen, head kidney, brain, intestine, gill, muscle and gonads) were collected. Samples of different developmental stages were collected including eight embryonic stages (unfertilized egg, 0.5 h, 2.5 h, 4.5 h, 15 h, 18 h, 23 h and 30 h after fertilization) and seven fry and juvenile stages (1.5 d, 3 d, 6 d, 10 d, 17 d, 24 d and 27 d after hatching). All collected samples were frozen immediately in liquid nitrogen, and then stored at 80 C until use. Total RNA was extracted using the RNAprep Animal RNA Purification Kit (Tiangen, China) and treated with RNase-free DNase (Tiangen, China) according to the manufacturer’s protocol. Genomic DNA was isolated from blood using standard protocol [21]. The quality of the RNA and DNA was evaluated by agarose gel electrophoresis and spectrophotometric measurement. 2.2. Molecular cloning of CsHepcidin gene All used primers are listed in Table 1 and described below. From a normalized cDNA library of C. semilaevis constructed in our laboratory, we found a full length of cDNA that had high identities to Scophthalmus maximus hepcidin precursor by our previous analysis. Then the cDNA clones were sequenced and complete cDNA was verified again. Specific primers Hep-DNA-fw and HepDNA-rv (Table 1) were designed to obtain genomic sequence and to confirm the resulted full-length coding sequence. PCR conditions
Table 1 List of primers used in present study. Primers
Sequence (50 / 30 )
Hep-DNA-fw Hep-DNA-rv Hep-RT-fw Hep-RT-rv 18S-RT-fw 18S-RT-rv Hep-PE-fw Hep-PE-rv
GTTCAGTTGGAGAAAGGTGGA GTCGTCGCCGCTCAGTATT TGGATCAATGGATTACACCGT CGCCGCTCAGTATTTACAACA GGTCTGTGATGCCCTTAGATGTC AGTGGGGTTCAGCGGGTTAC GGAATTCCGTGTGAAGCGC TATGCGGCCGCTTAGTATTTACAAC
were: 94 C for 5 min followed by 35 cycles of 94 C for 30 s, 58 C for 30 s and 72 C for 1 min, with a final extension step of 7 min at 72 C. All the amplified PCR products were separated by agarose gel electrophoresis, purified, cloned into pMD18-T vector (TaKaRa, Dalian, China) and sequenced. The exon and intron boundaries were determined by alignment of the obtained cDNA sequence with the genome sequence generated above. 2.3. Sequence analysis Putative signal peptide was determined by SignalP 4.0 server (http://www.cbs.dtu.dk/services/SignalP/) and cleavage sites for the family of subtilisin/kexin-like proprotein convertases were calculated by the ProP server [22]. Biochemical properties of mature CsHepcidin peptides were evaluated using the ProtParam tool (http://ca.expasy.org/tools/protparam.html). The amino acid sequence alignments of unprocessed preprohepcidins were obtained using ClustalX 1.81 [23]. Phylogenetic tree was accomplished with MEGA v4 [24] using Neighbor-Joining (NJ) method [25] based on the Poisson-corrected distances. One thousand bootstraps were performed for the NJ trees to estimate for the topological stability. 2.4. Bacterial challenge Vibrio anguillarum, a kind of Gram-negative bacterium that shown to be pathogenic to fish [26], was grown in marine broth at 17 C with agitation (200 rpm) for 48 h. The bacteria were then fixed overnight at 4 C in 0.5% formalin, spun down and resuspended in 0.7% NaCl to an optical density of 1.0 (600 nm) for future use. Seventy-five fish (200e250 g) were kept at 16 C seawater in 500 l tanks with continuous aeration. After acclimation, all fish were anaesthetized using 50 mg/l Metacaine prior to treatments. The fish were injected intraperitoneally with 100 ml (per 100 g body weight) of the formalin-inactivated V. anguillarum (35 fish), or with corresponding amount of 0.7% NaCl (35 fish) as immunization control. Five fish were no-injected as blank control. All fish survived throughout the experiment. Five bacteria-injected fish and five 0.7% NaCl injected fish were sacrificed at each sampling time of 1, 4, 8, 16, 24, 48 and 72 h post injection (hpi), respectively. Head kidney, spleen and liver tissues were sampled as described above. 2.5. Quantitative real-time PCR Total RNA was extracted separately from each sample as described in Section 2.1. For cDNA synthesis, 1.0 mg of RNA, Quantiscript RT Kit (Tiangen, China) and random hexamers (Tiangen, China) were used according to the manufacturer’s instructions. Primers for real-time PCR Hep-RT-fw/rv (Table 1) were designed across exoneintron borders to avoid amplification of genomic DNA. Amplifications were performed in 20 ml volume using an ABI Prism 7500 Sequence Detection System (Applied Biosystems, Forster City, CA) and the SYBRÒ Premix Ex TaqÔ II (1) (Perfect Real Time) (TaKaRa, Dalian, China). A dissociation protocol was made at the end of each run to verify that only a single product was amplified. Negative control (no-template reaction) was always included. Evaluation of eight housekeeping genes as references for quantitative real-time RT-PCR analysis of gene expression in C. semilaevis was assayed in our lab (unpublished). 18S rRNA was recognized as the most stable gene at different development stages and in different tissues. Therefore relative expression was determined using the 18S rRNA as reference gene. Quantification of CsHepcidin and 18S rRNA for all samples was derived from the standard curves, which were generated by serial dilutions of plasmids containing either CsHepcidin or 18S rRNA fragments. The results of real-time
Y. Wang et al. / Fish & Shellfish Immunology 33 (2012) 213e219
215
A 93-bp cDNA fragment encoding the predicted mature CsHepcidin was amplified by Pfu DNA Polymerase (Fermentas, Glen Burnie, USA) with primers containing EcoR I and Not I restriction site Hep-PE-fw/rv (Table 1), cloned to vector pET32a (þ) (Novagen, Darmstadt, Germany) and transformed into Escherichia coli host strain BL21(DE3)pLysS. The resulting construct, pET32a-hepcidin, was confirmed by restriction digestion and DNA sequencing. The recombinant protein named CsHEP, fused with Trx improving disulfide formation, was induced following established protocols [27]. The fusion protein CsHEP was purified using AKTA prime plus system (GE Amersham Biosciences, Waukesha, USA), desalinated by MD34 (Solarbio, China) and analyzed by 15% SDS-PAGE. The concentration of purified protein was determined as described by Bradford [28]. As control, empty pET32a (þ) vector was transformed into E. coli host strain BL21(DE3)pLysS, induced, purified, desalinated and analyzed as described above.
for the signal peptide located between Ala24 and Leu25. An Arg-XLys/Arg-Arg motif for recognition and cleavage by furin propeptide convertases [22] was located at Arg67-Arg70, producing a 26 amino acid peptide. This deduced mature hepcidin has an estimated Mw of 2784 Da and theoretical pI of 8.52. A stretch of eight cysteines, a key feature for hepcidins [30], was located at the Cterminal. The alignment of CsHepcidin with selected mammalian and teleost preprohepcidins showed that the putative CsHepcidin shared high identity with that of S. maximus (61.1%) and Micropterus dolomieu (61%), and much lower identity with Homo sapiens prohepcidin (23.8%). The NJ tree constructed from the alignments showed that CsHepcidin and other fish hepcidins were grouped together to form a fish cluster distinct from the mammalian cluster (Fig. 2). The tree indicated that several isotypes of hepcidin are common in the acanthopterygian fish, and these paralogues clearly fell into two classes: hepcidin 1 and hepcidin 2. Being coincident with the taxonomic position, our CsHepcidin was clustered into hepcidin 1 group of acanthopterygian. A conserved sequence Q-S/IH-L/I-S/A-L prior to the first cysteine of the mature hepcidin was lacking in all the peptides of the hepcidin 2 clade, which had 3e5 amino acids, instead. In this position, the predicted mature CsHepcidin had a N-terminal G-G-L-V-A-L sequence differing from all the other hepcidins.
2.7. Antimicrobial assay
3.2. Determination of CsHepcidin genomic DNA sequence
The antimicrobial activities of CsHEP were tested against five Gram-negative bacteria (E. coli, Vibrio harveyi, Vibrio parahaemolyticus, Edwardsiella tarda, V. anguillarum) and one Grampositive bacterium (Staphylococcus aureus). At first, antimicrobial activity was confirmed by an inhibition zone assay. Approximately 1 106 bacterial cells in mid-logarithmic phase were plated onto 20 ml LB broth (or 2216E broth). Purified CsHEP of 1.5 mM in PBS was added into 8 mm diameter wells on the plates respectively, and incubated at appropriate temperatures (25 C for V. anguillarum, 28 C for E. tarda, V. harveyi and V. parahaemolyticus, or 37 C for E. coli and S. aureus) until circular antibacterial zones appeared. PBS, antibiotic and 8.18 mM control protein were used as controls. Then, the minimal inhibition concentration (MIC) of CsHEP was determined by a liquid growth inhibition assay, as previously described [29]. Briefly, logarithmic phase bacterial cultures were diluted to 105 CFU/ml in appropriate broth, and purified CsHEP ranging from 8.18 to 0.06 mM were prepared in PBS buffer in Eppendorf tubes. Diluted bacteria (90 ml) were mixed with 10 ml CsHEP of each concentration in wells of a microtitration plate, and incubated for 24 h (or 48 h for E. tarda) at appropriate temperatures. Wells without bacteria, or without CsHEP (replaced with PBS buffer), or with control protein were set as controls. The MICs were confirmed by visual verification of microbial sedimentation as well as the absorbance reading at 600 nm. All experiments were performed in triplicate.
Sequences of the genomic DNA cloned from several individuals were found to be approximately 1.2 kb (accession number: JQ219158). Analysis of the gene organization showed that the CsHepcidin possessed three exons and two introns. The first intron of 274 bp is markedly short compared to the corresponding introns reported for their human and murine counterparts (2.1 and 1.2 kb, respectively) [4,31]. The length determination of intron 2 was inconclusive as it contained a microsatellite with the tri-nucleotide ACA making the sequencing difficult.
PCR were normalized with the copy number of 18S rRNA of each sample. All samples were run in triplicate. Statistical analysis was performed by one-way analysis of variance (ANOVA) with SPSS13.0 software. A probability value of P < 0.05 was considered to indicate statistical significance. 2.6. Prokaryotic expression and purification of CsHEP
3. Results 3.1. Molecular characterization of CsHepcidin Using specific primers based on the contig of constructed cDNA library, we have isolated a cDNA that contained the full-length CDS of a hepcidin orthologue in C. semilaevis. The CsHepcidin cDNA consisted of 614 bp, comprising a 171 bp 50 -UTR, a 291 bp open reading frame (ORF) predicted to encode a pre-pro-peptide of 96 amino acids, and a 151 bp 30 -UTR with a typical polyadenylation signal (AATAAA) located 13 bp upstream of the poly(A)þ tail (Fig. 1). Analysis of the N-terminal region predicted a potential cleavage site
3.3. Expression of CsHepcidin mRNA in different tissues To assess the expression profile of CsHepcidin mRNA, Quantitative real-time PCR was performed for all sampled tissues from healthy fish (Fig. 3A). The result revealed that CsHepcidin transcripts were abundantly expressed in liver and brain, moderately detected in heart, intestine, ovary and head kidney, and less observed in spleen, testis, gill and muscle. 3.4. Expression of CsHepcidin mRNA in different development stages The qPCR analysis indicated that the expression of CsHepcidin appeared to be developmentally regulated (Fig. 3B). Unfertilized eggs and embryos at different stages before hatching contained very low amount of hepcidin transcripts. The relative level of CsHepcidin mRNA increased slightly after hatching, and elevated steeply to maximum level, about 2.6 fold, from 6 d to 10 d after hatching, when fry started external feeding, then decreased sharply around 24 d and elevated again at the 27-d stage, the last stage we studied. 3.5. The temporal expression of CsHepcidin after microbial challenge To ascertain the effects of bacterial challenge on CsHepcidin expression, C. semilaevis were injected with 1 ml of formalininactivated V. anguillarum per kg fish or with 0.7% NaCl. Expression
216
Y. Wang et al. / Fish & Shellfish Immunology 33 (2012) 213e219
Fig. 1. A nucleotide sequence of unspliced CsHepcidin cDNA. Uppercase letters denote the coding regions and lowercase letters denote the UTRs or introns. The deduce amino acid sequences are translated and shadowed below the coding sequence. The gt/ag intron/exon boundaries are shown in italic and the polyadenylation signal (aataaa) is highlighted in bold. Cysteine residues and the microsatellite located in intron 2 are single and double underlined, respectively. The putative signal peptide cleavage site and proregion cleavage site are also shown. The box indicates the furin cleavage site motif.
of CsHepcidin was measured by real-time PCR in liver, head kidney and spleen tissues. The effectiveness of the bacterial immunization in this study was confirmed by csIL-1b as a positive control (data not shown). The results showed that the kinetics of CsHepcidin expression after bacterial challenge was similar in spleen, head kidney and liver (Fig. 4AeC). In comparison to blank control, the transcription level of CsHepcidin in spleen increased at 8 hpi and came to the highest level at 16 hpi (P < 0.05), followed by a gradual decline to the original level until 48 hpi. The up-regulation of CsHepcidin at 16 hpi was also observed in head kidney and liver, about 12- and 3-fold, respectively. In immunization control, hepcidin expression fluctuated slightly in spleen and head kidney, while inducted significantly in liver at 48 hpi (P < 0.05). This may be because the relative level of CsHepcidin mRNA in liver was more sensitive to the exogenous stimulus than head kidney and spleen. The reason still need further study. 3.6. Antimicrobial activity of CsHEP The recombinant protein CsHEP was induced with 1 mM IPTG at 28 C, and detected mainly in sonicated supernatant (Fig. 5). The
fusion protein was then purified for further use. Detected by inhibition zone assay, direct antimicrobial capability of CsHEP was found against all tested bacteria, especially strong against V. anguillarum and E. tarda, resembling the liquid growth inhibition assay (Table 2). Most of Gram-negative bacteria exhibited obvious susceptibility to CsHEP treatment with MIC ranging from 5.8 mM to 2.92 mM, except E. coli with MIC > 8.18 mM. In contrast, Grampositive bacteria S. aureus was less sensitive (MIC > 8.18 mM). The control protein didn’t show antimicrobial activity by two methods. 4. Discussion AMPs, also known as host defense peptides, play major roles in the innate immune system and some other physiological functions. Fish are a major component of the aquatic fauna that continually fight against pathogens by producing a diverse array of AMPs [32]. Among AMPs, hepcidin is a small cysteine-rich protein with not only antimicrobial activity but also pivotal function in iron homeostasis. In fish, the role of hepcidin in innate immunity has been the subject of intense research interests [33]. In the present study, we have characterized the structure and role of hepcidin in
Y. Wang et al. / Fish & Shellfish Immunology 33 (2012) 213e219
217
Fig. 2. Phylogenetic analysis of hepcidins from C. semilaevis and other vertebrates. The NJ tree was constructed based on the Poisson-corrected distances, with pairwise deletion of gaps. Numbers above the nodes indicate bootstrap percentages of 1000 replicates. The scale bar refers to a phylogenetic distance of 0.1 amino acid substitutions per site.
the immune system of C. semilaevis. Analysis of the gene sequence identified a 291 bp ORF encoding for a putative 96 amino acid peptide with very high homology with other known hepcidins. Most hepcidin genes identified in fish code for a highly conserved signal peptide of 24 residues, an acidic propiece of 38e40 amino acids, and a mature peptide of approximately 19e27 residues [34]. It was not surprising to find that the putative CsHepcidin precursor also shared this structure. The typical RX(K/R)R motif for propeptide convertases [22] is highly conserved among most fish species, including C. semilaevis, but the actual cleavage site may differ. Sequence analysis of the mature region indicated that CsHepcidin possessed eight cysteines, which involved in one vicinal and three interstrand disulfide bridges in human and bass hepcidin [19,35]. Since this structure was known to be associated with antimicrobial activity of the protein [4], it can be predicted that CsHepcidin may also have this immunological function. The first five or six amino acids (Q-S/I-H-L/I-S/A-L) of the predicted mature hepcidin seem to be essential for its ironregulatory activity [36]. However, this sequence is missing in all the peptides of hepcidin 2 cluster in phylogenetic analyses. It is possible that hepcidin variants in some fishes may have evolved different functions for different circumstances, some serve to only support innate immunity while others act solely as iron regulating hormones. As noted above, the predicted NH2-terminus (GGLVAL) of mature CsHepcidin differed from other hepcidins, resembling the phylogenetic analysis, and thus it is reasonable to suggest that CsHepcidin may not involve in iron homeostasis. Further experiments are needed to elucidate the role of CsHepcidin in iron regulation. Quantitative RT-PCR revealed that a low amount of CsHepcidin transcripts were detectable in unfertilized eggs of C. semilaevis, which suggested the presence of maternal hepcidin mRNA. It was
also coincident with the fact that CsHepcidin transcript was more abundant in ovary than in testis (Fig. 3A). The early detection of mRNAs in fish eggs is not rare. In channel catfish, hepcidin gene is expressed early during development [18]. This result implies that hepcidin might take part in development itself, or more probably involve in the immune defense of embryos in C. semilaevis. As is well known, the metamorphosis of flatfish is prominently characterized by morphological transformation from a symmetrical to an asymmetrical body shape, accompanying with eye migration, cranium deformation, asymmetric pigmentation and other changes [37]. An interesting finding of this study was the dramatic decrease of CsHepcidin mRNA at metamorphic stage around 24 days after hatching. Similar phenomenon has been reported in other immune-related molecules, such as MyD88, TLR9 and MHC IIB of C. semilaevis [38e40]. The reasons why the expression of immunerelated genes of C. semilaevis decreases during metamorphosis need further study. In human and mouse, hepcidin transcript is mainly produced by the hepatocytes [4], but it is also expressed in a number of cell types such as macrophages and Kupffer cells [10,41]. In teleost fish, acidophilic granulocytes, macrophages and lymphocytes are shown to express hepcidin gene at different level in the gilthead seabream [42]. As for the distribution in different tissues, the transcripts of hepcidin were usually expressed at a higher level in liver of mammals and most fishes [7]. In this study, we confirmed that the CsHepcidin gene was widely distributed in most tissues evaluated by real-time PCR, with the highest expression being detected in liver followed by heart, intestine, spleen and head kidney (Fig. 2A). This result agreed with previous findings in most reported fishes including tilapia [11], black porgy [15], Japanese flounder [13] and sea bass [14]. Its presences in these tissues might indicate its important function in piscine immune system.
218
Y. Wang et al. / Fish & Shellfish Immunology 33 (2012) 213e219
Fig. 3. (A) Relative expression levels of CsHepcidin gene in different tissues from C. semilaevis. (B) Relative expression levels of CsHepcidin gene during embryos and larvae development in C. semilaevis. UN, unfertilized egg. The relative expression variance is showed as ratio (the amounts of CsHepcidin mRNA normalized to the corresponding 18S rRNA values). Data are shown as mean SEM (n ¼ 3). Values with different superscripts indicate statistically different (P < 0.05).
To understand the potential role of CsHepcidin in the innate immune response, we have generated an experimental model of bacterial challenge, and analyzed the expression of CsHepcidin transcripts in liver, head kidney and spleen. A clear induction of CsHepcidin transcription was detected in all tested tissues at 8 hpi and reached to a peak at 16 hpi. In Atlantic cod, an up-regulation of hepcidin transcription was detected in head kidney and peritoneum examined 1 day after i.p. injection of inactivated V. anguillarum [9]. In mammals, expression of hepcidin was also stimulated by a variety of stimuli including LPS, TNF-a, IL-6 and IL-1 [30]. Interestingly, similar induction and kinetics of C. semilaevis IL-1b was observed in spleen and head kidney during V. anguillarum infection (data not shown). The regulation of Hepcidin expression by cytokines IL-1 has not yet been studied in fish. Besides, the recombinant CsHEP exhibited direct antimicrobial activity against bacterial pathogens in vitro, particularly against the Gram-negative bacteria like V. anguillarum and E. tarda that cause great mortalities and economic losses in many aquaculture species. These results, together with the observation that CsHepcidin expression was upregulated by bacterial challenge, strongly suggest that CsHepcidin may be related to the immune response system and involved in the direct defense against the invasion of microbial pathogens in C. semilaevis. To summarize, starting from a sequence in the cDNA library, we have presented the gene organization and expression data of CsHepcidin, and demonstrated the biological activity of the recombinant mature peptide. CsHepcidin had a wide distribution of expression in normal fish and was dramatically induced by bacterial infection. Furthermore, recombinant CsHEP possessed potent bactericidal activity against several bacterial pathogens at a low concentration. This study will facilitate for the understanding of flatfish innate immunity and will provide potential application of antimicrobial peptides to control fish diseases.
Fig. 4. Temporal expression of CsHepcidin in liver (A), head kidney (B) and spleen (C) after immunized with inactivated V. anguillarum. The relative expression variance is showed as ratio (the amounts of CsHepcidin mRNA normalized to the corresponding 18S rRNA values). Data are shown as mean SEM (n ¼ 5). BC, blank control. Values with different superscripts indicate statistically different (P < 0.05).
Fig. 5. Prokaryotic expression and purification of recombinant CsHEP. The proteins were kept tract using 15% SDS-PAGE. Lane M, protein marker; lane 1, uninduced cells; lane 2, induced cells; lane 3, sonicated supernatant; lane 4, sonicated pellet; lane 5, fraction that eluted from the Ni2þ-NTA resin with 60 mM imidazole; lane 6, purified recombinant CsHEP.
Y. Wang et al. / Fish & Shellfish Immunology 33 (2012) 213e219 Table 2 Antibacterial spectra of the recombinant CsHEP. Bacterium Gram-negative bacteria Escherichia coli Vibrio harveyi Vibrio parahaemolyticus Edwardsiella tarda Vibrio anguillarum Gram-positive bacteria Staphylococcus aureus
Area of inhibition (mm2)
MIC (mM)
12.6 11.3 12.6 28.8 22.6
>8.18 5.84 5.84 2.92 2.92
12.1
>8.18
Acknowledgments This work was supported by the National High-Tech Research and Development Program (No. 2012AA100802). The authors wish to thank Pro. Xiaohua Zhang of Ocean University of China for her gift of bacterial strains used in this paper. References [1] Magnadottir B. Innate immunity of fish (overview). Fish Shellfish Immunol 2006;20:137e51. [2] Hancock REW. Cationic peptides: effectors in innate immunity and novel antimicrobials. Lancet Infect Dis; 2001:156e64. [3] Hancock REW, Chapple DS. Peptide antibiotics. Antimicrobial Agents Chemother 1999;43:1317e23. [4] Krause A, Neitz S, Mägert HJ, Schulz A, Forssmann WG, Schulz-Knappe P, et al. LEAP-1, a novel highly disulfide-bonded human peptide, exhibits antimicrobial activity. FEBS Lett 2000;480:147e50. [5] Park CH, Valore EV, Waring AJ, Ganz T. Hepcidin, a urinary antimicrobial peptide synthesized in the liver. J Biol Chem 2001;276:7806e10. [6] Nicolas G, Bennoun M, Devaux I, Beaumont C, Grandchamp B, Kahn A, et al. Lack of hepcidin gene expression and severe tissue iron overload in upstream stimulatory factor 2 (USF2) knockout mice. Proc Natl Acad Sci U S A 2001;98: 8780e5. [7] Hilton KB, Lambert LA. Molecular evolution and characterization of hepcidin gene products in vertebrates. Gene 2008;415:40e8. [8] Nemeth E, Tuttle MS, Powelson J, Vaughn MB, Donovan A, Ward DM, et al. Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization. Science 2004;306:2090e3. [9] Solstad T, Larsen AN, Seppola M, Jørgensen TØ. Identification, cloning and expression analysis of a hepcidin cDNA of the Atlantic cod (Gadus morhua L.). Fish Shellfish Immunol 2008;25:298e310. [10] Sow FB, Florence WC, Satoskar AR, Schlesinger LS, Zwilling BS, Lafuse WP. Expression and localization of hepcidin in macrophages: a role in host defense against tuberculosis. J Leukoc Biol 2007;82:934e45. [11] Huang PH, Chen JY, Kuo CM. Three different hepcidins from tilapia, Oreochromis mossambicus: analysis of their expressions and biological functions. Mol Immunol 2007;44:1922e34. [12] Douglas SE, Gallant JW, Liebscher RS, Dacanay A, Tsoi SC. Identification and expression analysis of hepcidin-like antimicrobial peptides in bony fish. Dev Comp Immunol 2003;27:589e601. [13] Hirono I, Hwang JY, Ono Y, Kurobe T, Ohira T, Nozaki R, et al. Two different types of hepcidins from the Japanese flounder Paralichthys olivaceus. FEBS J 2005;272:5257e64. [14] Rodrigues PN, Vázquez-Dorado S, Neves JV, Wilson JM. Dual function of fish hepcidin: response to experimental iron overload and bacterial infection in sea bass (Dicentrarchus labrax). Dev Comp Immunol 2006;30:1156e67. [15] Yang M, Wang KJ, Chen JH, Qu HD, Li SJ. Genomic organization and tissuespecific expression analysis of hepcidin-like genes from black porgy (Acanthopagrus schlegelii B). Fish Shellfish Immunol 2007;23:1060e71. [16] Shike H, Lauth X, Westerman ME, Ostland VE, Carlberg JM, Van Olst JC, et al. Bass hepcidin is a novel antimicrobial peptide induced by bacterial challenge. Eur J Biochem 2002;269:2232e7. [17] Park KC, Osborne JA, Tsoi SC, Brown LL, Johnson SC. Expressed sequence tags analysis of Atlantic halibut (Hippoglossus hippoglossus) liver, kidney and spleen tissues following vaccination against Vibrio anguillarum and Aeromonas salmonicida. Fish Shellfish Immunol 2005;18:393e415.
219
[18] Bao B, Peatman E, Li P, He C, Liu Z. Catfish hepcidin gene is expressed in a wide range of tissues and exhibits tissue-specific upregulation after bacterial infection. Dev Comp Immunol 2005;29:939e50. [19] Lauth X, Babon JJ, Stannard JA, Singh S, Nizet V, Carlberg JM, et al. Bass hepcidin synthesis, solution structure, antimicrobial activities and synergism, and in vivo hepatic response to bacterial infections. J Biol Chem 2005;280: 9272e82. [20] Zhang H, Yuan Q, Zhu Y, Ma R. Expression and preparation of recombinant hepcidin in Escherichia coli. Protein Exp Purif 2005;41:409e16. [21] Ausubel F, Brent R, Kingston R, Moore D, Seidman J, Smith J, et al. Current protocols in molecular biology. New York: John Wiley and Sons; 1998. [22] Duckert P, Brunak S, Blom N. Prediction of proprotein convertase cleavage sites. Protein Eng Des Sel 2004;17:107e12. [23] Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 1997;25(24):4876e82. [24] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24:1596e9. [25] Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4(4):406e25. [26] Larsen JL. Vibrio anguillarum: prevalence of typical and atypical strains in marine recipients with special reference to carbohydrate pollution. Acta Vet Scand 1985;26(4):449e60. [27] Sambrook J, Russell DW. Molecular cloning: a laboratory manual. 3ed. New York: Cold Spring Harbor Laboratory; 2001. [28] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem 1976;72:248e54. [29] Bulet P, Dimarcq JL, Hetru C, Lagueux M, Charlet M, Hegy G, et al. A novel inducible antibacterial peptide of Drosophila carries an O-glycosylated substitution. J Biol Chem 1993;268:14893e7. [30] Shi J, Camus AC. Hepcidins in amphibians and fishes: antimicrobial peptides or iron-regulatory hormones? Dev Comp Immunol 2006;30:746e55. [31] Pigeon C, Ilyin G, Courselaud B, Leroyer P, Turlin B, Brissot P, et al. A new mouse liver-specific gene, encoding a protein homologous to human antimicrobial peptide hepcidin, is overexpressed during iron overload. J Biol Chem 2001;16(276):7811e9. [32] Rajanbabu V, Chen JY. Applications of antimicrobial peptides from fish and perspectives for the future. Peptides; 2011:415e20. [33] Barnes AC, Trewin B, Snape N, Kvennefors ECE. Two hepcidin-like antimicrobial peptides in Barramundi Lates calcarifer exhibit differing tissue tropism and are induced in response to lipopolysaccharide. Fish Shellfish Immunol 2011;31:350e7. [34] Robertson LS, Iwanowicz LR, Marranca JM. Identification of centrarchid hepcidins and evidence that 17b-estradiol disrupts constitutive expression of hepcidin-1 and inducible expression of hepcidin-2 in largemouth bass (Micropterus salmoides). Fish Shellfish Immunol 2009;26:898e907. [35] Hunter HN, Fulton DB, Ganz T, Vogel HJ. The solution structure of human hepcidin, a peptide hormone with antimicrobial activity that is involved in iron uptake and hereditary hemochromatosis. J Biol Chem 2002;277: 37597e603. [36] Nemeth E, Preza GC, Jung CL, Kaplan J, Waring AJ, Ganz T. The N-terminus of hepcidin is essential for its interaction with ferroportin: structure-function study. Blood 2006;107:328e33. [37] Fu YS, Shi ZY, Wu ML, Zhang JL, Jia L, Chen XW. Identification and differential expression of microRNAs during metamorphosis of the Japanese flounder (Paralichthys olivaceus). PLoS One 2011;6(7):e22957. [38] Yu Y, Zhang QQ, Li CM, Jiang LM, Yan FS, Wang ZG, et al. Isolation and characterization of Toll-like receptor 9 in half-smooth tongue sole Cynoglossus semilaevis. Fish Shellfish Immunol 2009;26:492e9. [39] Li CM, Yu Y, Sun YY, Li S, Zhong QW, Wang XB, et al. Isolation, polymorphism and expression study of two distinct major histocompatibility complex class II B genes from half-smooth tongue sole (Cynoglossus semilaevis). Int J Immunogenet 2010;37(3):185e97. [40] Yu Y, Zhong QW, Li CM, Jiang LM, Yan FS, Wang ZG, et al. Full-length sequence and expression analysis of a myeloid differentiation factor 88 (MyD88) in halfsmooth tongue sole Cynoglossus semilaevis. Int J Immunogenet 2009;36: 173e82. [41] Theurl M, Theurl I, Hochegger K, Obrist P, Subramaniam N, van Rooijen N, et al. Kupffer cells modulate iron homeostasis in mice via regulation of hepcidin expression. J Mol Med 2008;86:825e35. [42] Cuesta A, Meseguer J, Esteban MA. The antimicrobial peptide hepcidin exerts an important role in the innate immunity against bacteria in the bony fish gilthead seabream. Mol Immunol 2008;45:2333e42.