Identification and characterization of a yeast gene encoding an adenylate kinase homolog

12

Biochimica et BiophysicaA cta, 1172(1993) 12-16 ~.3 1993 Elsevier Science Publishers B.V. All rights reserved 0167-4781/93/$06.00

BBAEXP 92457

Identification and characterization of a yeast gene encoding an adenylate kinase homolog Manfred Konrad Department of Molecular Genetics. Max-Planck-lnstitutefor Biophysical Chemistry, G6ttingen (Germany) (Received 29 July 1992)

Key words: Adenylate kinase homolog; Gene disruption; (Yeast) Screening for genes homologous to adenylate kinase in the yeast Saccharomyces cerevisiae resulted in the isolation of a homolog of the previously characterized ADK1. The derived protein sequence is most closely related to mammalian GTP:AMP phosphotransferase (adenylate kinase isozyme 3; AK3); this novel gene is therefore named ADK3. Its deletion from the yeast genome does not lead to an observable change in cellular phenotype. A strain defective for both ADK1 and ADK3 is viable. When introduced on a multicopy plasmid into an ADKl-deficient yeast strain, which shows a reduced proliferation rate, ADK3 did not rescue this growth defect. The protein was also highly overexpressed in E. coli cells. However, no change in enzymatic activity was detected in cellular extracts of yeast or bacteria.

Introduction

Adenylate kinases (AK; N T P : A M P phosphotransferases;N, adenine or guanine) are ubiquitous nuleoside monophosphate kinases which contribute to homeostasis of the adenine nucleotide pool in the cell. They catalyze the reversible transfer of a phosphoryl group from Mg 2+ A T P to A M P and from Mg 2+ A D P to ADP. Three isozymes (AK1, AK2, AK3) have so far been characterized in vertebrates. AK1 is present in the cytosol of various tissues, whereas AK2 is found in the mitochondrial intermembrane space, and AK3, a G T P : A M P transphosphorylase, is present in the mitochondrial matrix [1]. In prokaryotes and lower eukaryotes only one enzyme species has been found resembling AK2. Both the tertiary structure and the catalytic mechanism of these small kinases (molecular masses ranging from 21 to 27 kDa) have been studied in detail [2,3]. Not much is known, however, about the activities and interconnections of A K isozymes in the cell. Recently, I reported on the characterization of the gene ADK1 encoding the so-called cytosolic adenylate kinase of the yeast Saccharomyces cerevisiae [4]. Its nucleotide binding sites were characterized both by X-ray crystallography [5] and by t H - N M R spectroscopy [6]. By gene disruption it was shown that ADK1 is not essential for

Correspondence to: M. Konrad, Department of Molecular Genetics, Max-Planck-Institute for Biophysical Chemistry, P.O. Box 2841, D3400 G6ttingen, Germany.

cell viability [4,7]; this deletion mutant strain, however, grows two to three times more slowly than wild-type. In extracts of total cellular protein of ADKl-deficient cells, there were still about 10% of the wild-type enzymatic activity present which indicated the existence of at least one other adenylate kinase isozyme in yeast [4]. Thus, we set out to screen for adenylate kinase homologs in S. cerevisiae. Oligonucleotides corresponding to amino acid sequences in conserved regions of A K proteins [2] were chosen as probes, and a novel gene, named ADK3, was isolated. This p a p e r describes the characterization of the ADK3 gene, its in vivo disruption, and its overexpression both in yeast and in bacterial cells. During preparation of this article, the nucleotide sequence of a putative second adenylate kinase-encoding gene from yeast was reported [8]; it was detected by analyzing an open reading frame upstream from the RAD3 gene lying on yeast chromosome V. The two sequences turned out to be identical. Therefore, we do not present the sequence of ADK3 here. Materials and Methods

Strains, media and genetic methods The following S. cerevisiae strains were used: AH215 (leu2, his3, GAL), AG430 ( M A T a / M A T a , leu2/leu2, his3/his3, G A L / G A L ) and A H 2 1 5 a l H (leu2, adkl::HIS3, G A L ) [4]. Methods of yeast growth in complete medium YPD and synthetic medium SD, isolation of yeast D N A and RNA, transformation,

13 (pBLUE;Bam3.7) was digested with SnaBI and MluI, thereby removing a 297 bp fragment from the 5' noncoding and from the N-terminal region of ADK3. The 2.2 kb fragment containing LEU2 [13] was introduced into this gap by blunt-end ligation, yielding the partially deleted ADK3-allele adk3::LEU2 (Fig. 1B). The mutated gene was isolated as a linear 5.6 kb BamHI fragment and used to transform AH215, AG430, and AH215alH. Selection of transformants was done as described previously [4]. To verify correct integration in the yeast genome, nuclear DNA was prepared from Leu+-transformants, digested with BamHI, and analyzed by using the 3zp-labelled 3.7 kb BamHI fragment as hybridization probe.

sporulation and tetrad analysis were as described by Rose et al. [9]. For growth on nonfermentable carbon sources, glucose was replaced by 3% glycerol, 3% ethanol, 2% glycerol and 2% ethanol, or 2% lactate, respectively. For induction of the GALIO promoter, glucose was replaced by 2% galactose.

Hybridization of yeast DNA with oligonucleotide probes Yeast genomic DNA was digested with appropriate restriction endonucleases, run in an 0.8% agarose gel and denatured in situ; the gel was dried and then used for direct hybridization [10]. The gel was probed with 5' end-labelled oligonucleotides of various lengths and degeneracy, corresponding to the following conserved regions of adenylate kinases [2]: PGAGKGTQ, LDGFPRT, FNPPK. Hybridization was carried out at 37°C for 14 h in 6 × SSC (1 × SSC contains 0.15 M NaC1, 0.015 M sodium citrate, pH 7.0), 0.1% SDS, 5 mM EDTA, 20 txg E. coli t-RNA/ml. Gels were washed twice in 6 × SSC for 10 rain at 25°C, twice in 4 × SSC at 25°C, and twice in 4 × SSC for 5 min at 37°C.

Ouerexpression of ADK3 in yeast The 3.7 kb BamHI-fragment, which contains the entire ADK3 gene (Fig. 1A), was cloned into the 2/x plasmid YEpl3 [14] and transformed into the strains AH215 and AH215alH. This results in strains harboring the ADK3 gene under the control of its own promoter on a multicopy plasmid. Alternatively, the ADK3 coding region was placed behind the GALl0 promoter inducible in galactose-containing medium. To do this, the 682 bp NdeI/BamHI fragment obtained by PCR as described below was inserted into the YEp51 yeast expression vector [14]. Extracts of total cellular protein were prepared as before [4].

Cloning of genomic ADK3 DNA and sequencing Yeast DNA was digested with BamHI and electrophoresed in an 0.8% agarose gel. DNA fragments of 3 to 5 kb in length were isolated by the freeze squeeze method [11], ligated into the BamHI site of the pBLUESCRIPT KS vector (Stratagene), and transformed into the E. coli strain XL1-BLUE (Stratagene). Colonies were screened essentially in the same way as described before [4]. The resulting ADK3-containing plasmid was called pADK3(pBLUE;Bam3.7). DNA fragments to be sequenced wire subcloned in pBLUESCRIPT, and double-stranded DNA was used as template for sequencing with Sequenase (United States Biochemical Corporation).

Ouerexpression of ADK3 in E. coil A T7 promoter overexpression system [15] was used for producing the ADK3 protein in E. coli. The ADK3 open reading frame was amplified by PCR [16] using a 5' sense primer containing an NdeI restriction site (5' G G G C C C CA TA T G A A A G C A G A C G C G A A A CAAATAAC 3') and a 3' reverse complement primer with a SmaI site (5' CCCTTGCCCGGGTCAATAATTTCGGAAGATAAT 3'). Reaction conditions, in a HYBAID Thermal Reactor, were 94°C for 1 min, 55°C for 2 min, 72°C for 1 min, 20 cycles, using plasmid

Gene disruption One-step gene disruption experiments were carried out as described by Rothstein [12]. Plasmid pADK3

--

(A) ADK3

~vvvIN'wvwv ~

I I ~

~ 200 bp

--

~ ~

~,

J

~

~,

~

ADK 3

~" 3'

~

~,RAD3

5"

3'

~

- -

=

~

=

(B)adk3::LEU2L'vvvvlh/w'cvc¢l~//.

~ LEU

m

~

I

2

Fig. 1. Partial restriction map of the ADK3 gene locus. (A) Wild type gene: a 3.7 kb BamHI genomic D N A fragment containing the ADK3 coding region (hatched box) was cloned in p B L U E S C R I P T KS. Restriction sites indicated were obtained from sequencing of the 1695 bp P s t I / H i n d l l l subfragment in both directions. T h e coding region of the RAD3 gene starts 429 bp downstream from ADK3, being transcribed in the same direction. (B) Disruption of the ADK3 locus: the adk3::LEU2 construct was created by replacement of the N-terminal half of ADK3 with a 2.2 kb fragment carrying the LEU2 marker gene. The derived plasmid was linearized at the unique BamHI sites and the resulting 5.6 kb fragment was used for one-step gene replacement.

14 pADK3(pBLUE;Bam3.7) as template. The 699 bp product was digested with NdeI and BamHI, ligated into pJC20 [17] to create pADK3express, and then transformed into the bacterial strain BL21(DE3)[15]. The correct in-frame cloning of ADK3 was confirmed by plasmid D N A sequencing using the T7 primer and several internal primers. Cells were induced by the addition of I P T G to 0.5 mM for 3 h. For analysis of total cell protein, cells were collected by centrifugation, suspended in sample buffer, heated and subjected to S D S - P A G E according to Laemmli [18]. ADK3 protein was partially purified from bacterial lysate by using a Blue Sepharose column in the first step, as described for adenylate kinase of E. coli [19].

Enzymatic activity assays Nucleoside monophosphate kinase activities were determined by spectrophotometric assays [1] at 25°C in a reaction medium containing 50 mM Tris-C1 (pH 7.4), 100 mM KC1, 5 mM MgCI~, 0.2 m M N A D H , 0.5 mM phosphoenolpyruvate, 2 mM nucleoside triphosphate (ATP or GTP), 2 mM nucleoside monophosphate (AMP, G M P or UMP), and 2.5 units each of lactate dehydrogenase and pyruvate kinase. The reaction was started by the addition of 50 to 250 ng of partially purified ADK3 enzyme or 5 to 100/zg of total cellular protein. Results A novel gene encoding a protein highly homologous to adenylate kinases Genomic yeast D N A digested with several restriction enzymes was hybridized in situ in dried agarose gels using degenerate oligonucleotides as probes. A 3.7 kb B a m H I fragment (Fig. 2A) was finally cloned and further dissected for sequencing of a 1899 bp P s t I / B a m H I subfragment (Fig. 1A). The open reading frame of 675 nucleotides was found to code for a protein of 225 amino acids which contained, near the N-terminus, the sequence motif G x P G x G K G T as well as the highly conserved sequences L L D G F P R T and NPPK in the central part of the primary structure, all diagnostic for adenylate kinases. The length of 225 amino acids is typical for the mitocbondrial or so-called long variants of adenylate kinases studied so far [2]. Sequence comparison shows that this protein is more closely related to bovine AK3 (43% identity), which is a G T P : A M P phosphotransferase, than to bovine AK2 (37%) or to yeast ADK1 (36%). This novel yeast gene, which one would predict to possess AK3-1ike enzymatic properties, was therefore designated ADK3. Its sequence was found to be identical to the one being published [8] when this work was in progress. That one was detected, by coincidence, when completely sequencing an open reading frame lying ahead of the

B

A "r ~: --Kbp

rn

W

0~0~

2345

I

II

21.2

5.0 4.3 3.5

~i~

o-W

~

~1~

2.0 1.9 1.6 1.3 1.0 0.8

Fig. 2. Hybridization analysis of yeast genomic DNA. (A) Localization of ADK3 on various restriction fragments: DNA (about 5 /zg per lane) from wild-type strain AG 430 was digested with restriction enzymes as indicated and probed with the 884 bp SnaBl/Sspl fragment covering the ADK3 coding region. The migration distance of DNA size markers (in kb) is indicated to the left. Filters were washed at 65°C in 0.5 × SSC, 0.1% SDS. (B) Identification of mutant strains carrying an ADK3 deletion/LEU2 insertion mutation: genomic DNA from strains AH215 (lane 1), AH215(adk3::LEU2)(lane 2), AG430(ADK3/adk3::LEU2)(lane 3), AH215(adkl ::H1S3;adk3::LEU2XI ane 4) and Leu + tetrad spore from strain AG430(ADK3/adk3::LEU2Xlane 5) was digested with BamH1, electrophoresed in 0.8% agarose and transferred to nylon filters. For comparison is shown BamHI-cut plasmid DNA of the isolated parent clone pADK3(pBLUE;Bam 3.7) (lane I) and of the derived ADK3 deletion/LEU2 insertion clone pADK3(pBLUE; adk3::LEU2)(lane I1). The entire 3.7 kb BamHI/BamHI fragment was used as probe for hybridization.

yeast RAD3 gene on chromosome V [20]. However, besides sequence comparisons, no data about further studies on this AK-related protein were presented by these authors.

ADK3 does not encode an essential function and does not complement the growth defect of ADKl-deficient cells To determine whether ADK3 is required for cellular metabolism, we disrupted the cloned gene by replacing the partially deleted coding region with a fragment carrying the auxotrophic marker LEU2. Gene replacement in the Leu + yeast transformants, through homologous recombination, was subsequently verified by D N A blot analysis (Fig. 2B). A diploid strain, heterozygous at the ADK3 locus, AG430 ( A D K 3 / adk3::LEU2), gave rise to four viable spores. Colonies formed by ADK3-deficient spores, as well as individual

15 cells, were morphologically indistinguishable from those of wild-type spores, at various incubation temperatures (23°C, 30°C, and 35°C). When the gene replacement experiment was performed with the haploid strain AH215alH, which was characterized by a 2- to 3-fold slower growth rate [4], no further phenotypic change was observed. Thus, haploid yeast cells defective for both ADK1 and A D K 3 are viable. Since the primary structure of the A D K 3 gene product points to the mitochondrial variant of adenylate kinase, we asked whether mitochondrial function is affected in mutant strains. In an attempt to detect a phenotypic change in ADK3-deficient cells, wild-type strain A H 215 as well as adkl::HIS3, adk3::LEU2, and adkl::HIS3 adk3::LEU2 mutant strains were tested for their capability to grow on various nonfermentable carbon sources. Under the conditions chosen, growth rate of adk3 cells was indistinguishable from that of wild-type cells, and the a d k l adk3 double-null mutant strain showed no noticeable phenotypic change beyond that associated with the loss of ADK1 function alone. In order to gain further insight into the functional role of the A D K 3 gene, it was tested for its ability to eventually restore the growth defect of the strain A H 2 1 5 a l H when overproduced in these cells lacking ADK1. It was cloned into the multicopy plasmids Y E p l 3 (under the control of its own transcription regulation sequences) and into YEp51 (under the control of the strong GALIO promoter). However, transformants containing either construct were not rescued from their slow growth rate. The A D K 3 gene product lacks enzymatic actit, ity As mentioned before, amino acid sequence characteristics suggest that A D K 3 encodes an AK2-type ( A T P : A M P phosphotransferase) or an AK3-type ( G T P : A M P phosphotransferase) adenylate kinase. When probing a blot of total yeast RNA with the 32p-labelled 884 bp S n a B I / S s p I fragment covering the A D K 3 coding region a relatively weak signal of a 0.8 to 1 kb transcript was seen (data not shown). No further analysis at the transcriptional level was done, however, since the main purpose of this work was to obtain information about the encoded protein. To test whether A D K 3 expresses a functional enzyme in yeast we studied its enzymatic properties in extracts of total cellular protein in various A D K 3 transformants. Neither in the strain defective for A D K 3 nor in the one defective for both ADK1 and A D K 3 could any change in enzymatic activity be observed when using the substrate pairs A T P / A M P , A T P / G M P , G T P / A M P and A T P / U M P and comparing to activities found in wild type and in A D K l - d e f i c i e n t cells, respectively [4]. In yeast cells carrying ADK3 on a multicopy plasmid no increase in enzymatic activity with respect to these substrate pairs

KDa

M

1

2

3

4

200 97.4 68.0 43.0

29.0

18.4 Fig. 3. SDS-PAGE analysis of ADK3 expressed in E. coil. Crude extracts from uninduced (lane 1) and induced (lane 2:0.5 h after induction with IPTG; lane 3:3 h after induction) E. coli strain BL21(DE3) carrying the plasmid pADK3express were loaded on a 12% polyacrylamidegel and stained with Coomassie blue. Partially purified lysate protein is shown in lane 4. The position of the ADK3 protein is indicated by an arrow. Molecular size standards (lane M) in kDa are givenon the left. could be demonstrated either. This is in strong contrast to ADK1 which was found to lead to drastically increased enzymatic activity when expressed under similar conditions (data not shown). It might be assumed that, for unknown reasons, the ADK3 enzyme is kept in a silent state in yeast cells, and we therefore decided to produce it in bacteria. Induction of the bacterial expression vector harboring the A D K 3 coding region as insert resulted in the massive production of a protein of 25 kDa molecular weight as seen on Coomassie blue staining of SDS/polyacrylamide gels (Fig. 3). Lysates of bacteria containing the expression vector with or without insert, and partially purified protein were assayed for kinase activity using various substrate pairs. Again, and in contrast to ADK1 expressed in the same system, no activity above background was detectable. Taken together, these data suggest that no enzymatic activity is attributable to the A D K 3 gene product when using standard assays that measure nucleoside monophosphate kinase activity. Discussion We have identified in the yeast S. cerevisiae a gene sharing high similarity with members of the adenylate kinase family, being most closely related to the mitochondrial AK3 isozyme ( G T P : A M P phosphotransferase) from mammals. To maintain consistency in nomenclature, we therefore call it ADK3. Having cloned both the ADK1 and the A D K 3 gene we were in

16 a position to examine the viability and phenotype of mutant ceils defective in one or both genes. In the present report it has been shown that this putative adenylate kinase is dispensable for growth of yeast cells both on fermentable and nonfermentable carbon sources, at least under the limited number of conditions tested. Several in vitro assays failed to demonstrate enzymatic activity of ADK3 even when overproduced either in yeast itself or in E. coli. A cloning artefact can certainly be excluded as our ADK3 sequence is identical to the one published by Cooper and Friedberg [8]. This protein cannot, therefore, be identified with the predicted second adenylate kinase which is responsible for the ATP:AMP transphosphorylase activity present in yeast cells lacking ADK1 [4,7]. In fact, we have meanwhile purified this second enzyme (which is consequently designated ADK2) from baker's yeast, and peptide sequences clearly show that it is different from ADK3 (M. Konrad, unpublished results). It remains to clarify why ADK3 does not exhibit nucleoside monophosphate kinase activity although its primary structure contains stretches of highly conserved amino acid sequence which are characteristic for adenylate kinases. Inspection of its sequence does not reveal deleterious amino acid exchanges at sites known to be crucial for the enzymatic activity of adenylate kinases [3]. Two specific residues of ADK3 deserve a short comment, however, one is Ser-43 [8] which in all other kinases known so far, except that of E. coli, is at the position of a histidine whose functional role was studied in detail notably in vertebrate isozyme AK1 (His-36) [3]. Although this was initially thought to be a key residue involved in substrate binding it was later found not to be essential for catalysis [3]. So we do not believe that this mutation would explain the lack of activity of ADK3. The other residue is Tyr-159 [8] which is at the place of phenylalanine found in all long variants of adenylate kinases and thus represents a very conservative amino acid exchange. More work is needed to determine whether the ADK3 protein possibly binds nucleotides without catalyzing the phosphoryltransfer reaction. The most direct approach will be to study binding of the substrate inhibitors ApsA or Gp.sA which are known to be highly specific for this class of enzymes [21]. Comparative 1H-NMR studies on ADK1 [6] and ADK3 may eventually reveal structural alterations which would explain the lack of enzymatic activity.

Acknowledgments I wish to thank Dieter Gallwitz for continuous support, Ines Bonk for technical assistance and Hans-Peter Geithe for prompt supply of oligonucleotides.

Addendum While this work was under review, a report was published (Schricker, R., Magdolen, V. and Bandlow, W. (1992) Mol. Gen. Genet. 233, 363-371) which described the isolation and characterization of the yeast gene PAK3. This gene turned out to be identical to ADK3. The results obtained by these authors are in agreement with those published here.

References l Noda, L.(1973) in The Enzymes (Boyer, P.D., ed.), Vol, 8, pp. 279-305, Academic Press, Orlando, FL. 2 Schulz, G.E., Schiltz, E., Tomasselli, A.G., Frank, R., Brune, M., Wittinghofer, A. and Schirmer, R.H. (1986) Eur. J. Biochem. 161, 127-132. 3 Tsai, M.D. and Yan, H. (1991) Biochemistry 30, 6806-6818. 4 Konrad, M. (1988) J. Biol. Chem. 263, 19468-19474. 5 Egner, U., Tomasselli, A.G. and Schulz, G.E. (1987) J. Mol. Biol. 195,649-658. 6 Vetter, I., Konrad, M. and R6sch, P. (1991) Biochemistry 30, 4137-4142. 7 Bandlow, W., Strobel, G., Zoglowek, C., Oechsner, U. and Magdolen, V. (1988) Eur. J. Biochem. 178, 451-457. 8 Cooper, A.J. and Friedberg, E.C. (1992) Gene 114, 145-148. 9 Rose, M.D., Winston, F. and Hieter, P. (1990) Methods in Yeast Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor. 10 Purrello, M. and Balzas, 1. (1983) Anal. Biochem. 128 393-397. 11 Tautz, D. and Renz, M. (1983) Anal. Biochem. 132, 14-19. 12 Rothstein, R.J. (1983) Methods Enzymol. 101,202-211. 13 Andreadis, A., Hsu, Y.P., Hermodson, M., Kohlhaw, G. and Schimmel, P. (1984) J. Biol. Chem. 259, 8059-8062. 14 Rose, A.B. and Broach, J.R. (1990) Methods Enzymol. 185, 234-279. 15 Studier, F.W., Rosenberg, A.H., Dunn, J.J. and Dubendorff, J.W. (1990) Methods Enzymol. 185, 60-89. 16 Mullis, K. and Faloona, F. (1987) Methods Enzymol. 155,335-350. 17 Clos, J., Westwood, J.T., Becket, P.G., Wilson, S., Lambert, K. and Wu, C. (1990) Cell 63, 1085-1097. 18 Laemmli, U.K. (1970) Nature 227, 680-685. 19 Reinstein, J., Brune, M. and Wittinghofer, A. (1988) Biochemistry 27, 4712-4720. 20 Naumovski, L., Chu, G., Berg, P. and Friedberg, E.C. (1985) Mol. Cell. Biol. 5, 17-26. 21 Feldhaus, P., Fr6hlich, T., Goody, R.S., Isakov, M. and Schirmer, R.H. (1975) Eur. J. Biochem. 57, 197-204.