- Email: [email protected]
Identification, characterization and cytogenetic mapping of a yeast Vps54 homolog in rat and mouse
Gene 285 (2002) 213–220 www.elsevier.com/locate/gene
Identification, characterization and cytogenetic mapping of a yeast Vps54 homolog in rat and mouse q Lutz Walter a,1,*, Sandra Stark a,1, 2, Khalil Helou b, Perris Flu¨gge a, Go¨ran Levan b, Eberhard Gu¨nther a b
a Division of Immunogenetics, Georg-August-University, D-37073 Go¨ttingen, Germany CMB – Genetics, Lundberg Laboratory, Go¨teborg University, S-41390 Go¨teborg, Sweden
Received 18 July 2001; received in revised form 31 July 2001; accepted 2 August 2001 Received by S. Salzberg
Abstract A novel gene, VPS54-like (Vps54l), is described in the rat that is homologous to the yeast Vps54 gene which is known to be involved in intracellular protein sorting. Furthermore, Vps54-related sequences of human, mouse, Drosophila melanogaster, Caenorhabditis elegans and Arabidopsis thaliana could be identified in the EMBL/GenBank/DDBJ database. Each of the deduced amino acid sequences of the Vps54 genes in these species contain a coiled-coil region and eight to 13 dileucine motifs. The rat Vps54l gene could be mapped to the end of chromosome 14 by radiation hybrid analysis 7 cR3000 from the D14Rat22 marker and to 14q22 by fluorescence in situ hybridization. Using a rat Vps54l-containing P1-derived artificial chromosome (PAC) clone the respective ortholog was mapped to chromosome 11A3 in the mouse. In addition, the rat genome contains a processed pseudogene of Vps54l on chromosome 7q22. PAC clone analysis shows that the rat Vps54l gene maps close to the UDP-glucose-pyrophosphorylase 2 gene. The two genes are in tail to tail orientation with their polyadenylation sites 497 bp apart. Rat Vps54l appears to be expressed ubiquitously, but at a relatively low level. Alternatively spliced transcripts could be isolated which lack the sequence coding for the coiled-coil region. q 2002 Elsevier Science B.V. All rights reserved. Keywords: Rat; Expression; Alternative splicing; Radiation hybrid mapping; Fluorescence in situ hybridization mapping; Evolution
1. Introduction In yeast the Vps52, Vps53, and Vps54 proteins form a trimolecular complex that is required for retrograde transport of proteins from an endosomal/prevacuolar to the late Golgi compartment (Conibear and Stevens, 2000). Single
Abbreviations: cDNA, DNA complementary to RNA; EST, expressed sequence tag; FISH, fluorescence in situ hybridization; HSA, human chromosome; kDa, kilodaltons; MHC, major histocompatibility complex; MMU, mouse chromosome; PAC, P1-derived artificial chromosome; RH, radiation hybrid; RNO, rat chromosome; RT-PCR, reverse transcriptase polymerase chain reaction; Ugp2, UDP-glucose-pyrophopshorylase 2 gene; Vps54l, VPS54-like gene; utr, untranslated region q The sequences for Vps54l cDNA, Vps54lp and the Vps54l-Ugp2 intergenic region reported in this paper have been assigned the EMBL accession numbers AJ010392, AJ276170 and AJ276169, respectively. * Corresponding author. Division of Immunogenetics, University of Go¨ttingen, Heinrich-Du¨ker-Weg 12, D-37073 Go¨ttingen, Germany. Tel.: 149-551-395-854; fax: 149-551-395-852. E-mail address: [email protected] (L. Walter). 1 Both authors contributed equally. 2 Present address: NOXXON Pharma AG, Gustav-Meyer-Allee 25, D13355 Berlin, Germany.
mutations in any of the three proteins can result in missorting of proteins and impaired Golgi to vacuole protein traffic, indicating that VPS52, VPS53, and VPS54 each play an essential role in the protein transport between the Golgi and endosomal/vacuolar compartments. Recently, we identified a Vps52 (previously designated Sac2) homolog, Sacm2l, in the centromeric part of the human, rat and mouse major histocompatibility complex (MHC) on human chromosome (HSA)6p21.3, rat chromosome (RNO)20p12, and mouse chromosome (MMU) 17, respectively (Walter and Gu¨nther, 1998a). Sacm2l is ubiquitously expressed and contains coiled-coil and dileucine motifs as well as putative transmembrane segments. We describe here the identification, physical and cytogenetic mapping of the rat and mouse Vps54 homologs.
2. Materials and methods 2.1. Identification of Vps54l cDNA In the course of expression analysis of the rat myeloma
0378-1119/02/$ - see front matter q 2002 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(02)00405-5
214
L. Walter et al. / Gene 285 (2002) 213–220
cell line 210-RCY3-Ag.1.2.3 (Y3) of LOU/C inbred rat strain origin (Galfre et al., 1979) by the differential display method (Bauer et al., 1993) a differential band, Bd8, was isolated and sequenced. This partial sequence was completed at the 3 0 and 5 0 ends by using anchored reverse transcriptase polymerase chain reaction (RT-PCR) as described (Walter and Gu¨ nther, 1998b). 2.2. Genomic analysis High density filters of a P1-derived artificial chromosome (PAC) library (RPCIP712) of BN rat origin (Woon et al., 1998), individual PAC clones and a rat kidney cDNA library (UI_p612) were obtained from the German Resource Center, Berlin, Germany. 2.3. Sequencing analysis Sequencing reactions were analyzed with an ABI310 automated sequencer (Applied Biosystems, Weiterstadt, Germany). 2.4. Analysis of amino acid sequences Prediction of coiled-coil regions (http://www.ch.embnet.org/software/COILS_form.html), dileucine motifs (http:// psort.nibb.ac.jp/) and transmembrane segments (http:// www.ch.embnet.org/software/TMPRED_form.html) were carried out with the respective programs at the indicated servers. Multiple alignment of amino acid sequences was carried out with the ClustalX software (version 1.8, Thompson et al., 1997). 2.5. PCR analysis Standard conditions with Taq DNA polymerase (Roche Diagnostics, Mannheim, Germany) were used according to melting temperature of primers and expected length of amplificate. Analysis of PCR products was performed in 1% agarose gels run in Tris borate buffer. Long range PCR was performed with the Expand w Long Template PCR System according to the manufacturer’s recommendations (Roche Diagnostics). 2.6. Chromosomal mapping A rat radiation hybrid (RH) panel (Research Genetics, Huntsville, Alabama) was screened with primers GAGGTATGTCATTGGTTCTT and GCAATGAGCTTTTAGTCTAAGG which are located in the 3 0 untranslated region (utr) of Vps54l and Ugp2, respectively, and amplify the 3 0 utrs and intergenic region between these genes. Hamster and rat-specific amplificates could be discriminated according to their different lengths. Analysis of the RH data was carried out online at the Bioinformatics Research Center, Medical College of Wisconsin (MCW), USA (http://rgd. mcw.edu/RHMAPSERVER/#instruction) and the Otsuka GEN Research Institute, Japan (http://e4000.otsuka.gr.
jp:8012/cgi-bin/RH/rhNgv.pl). FISH analysis was performed as described previously (Helou et al., 1998). 2.7. Expression analysis Total RNA derived from several rat tissues, the rat insulinoma cell line RIN-m, the rat lymphoma cell line 210-RCY3Ag.1.2.3 (Y3) and the mouse fibroblast L cell line was isolated according to Chomczynski and Sacchi (1987). Northern blot analysis was carried out with 30 mg of total RNA and a rat Vps54l probe encompassing 2065 bp (positions 1–2065, accession number AJ010392). For RT-PCR, 1 mg of total RNA derived from the rat cell line Y3 was transcribed using random nonamer oligonucleotides and 400 units of reverse transcriptase (Amersham Pharmacia Biotech, Freiburg, Germany). PCR was subsequently carried out with primers 5 0 TTGAGTGGTGATTTTATGCA3 0 and 5 0 GCAACTTCTTGAATTGAAGTACT3 0 (positions 1–20 and 2317–2339; AJ010392) and semi-nested PCR was performed with primers 5 0 TTGAGTGGTGATTTTATGCA3 0 and 5 0 AGACAATGAGCGTTGGAAGCA3 0 (positions 1–20 and 2045–2065; AJ010392). Resulting products were cloned in the PCR cloning vector pcDNA3.1/V5 and sequenced with the T7 promoter primer (Invitrogen, Groningen, The Netherlands). 3. Results and discussion 3.1. Isolation and characterization of Vps54l On the basis of a cDNA fragment of 350 bp initially isolated by the differential display procedure and provisionally designated Bd8, the corresponding complete cDNA was established by 3 0 and 5 0 anchored RT-PCR (database accession number AJ010392). It contains an open reading frame of 2895 bp that starts with an ATG, fulfilling the criteria of a start codon (Kozak, 1988). The 3 0 utr carries three classical polyadenylation signals. Expressed sequence tags (ESTs) of different species that corresponded to Bd8 were found in the database (http://www.ncbi.nlm.nih.gov). The ESTs appear to be derived predominantly from transcripts using the first or third polyadenylation signal. The deduced amino acid sequence of this novel rat gene encompasses 965 amino acid residues (Fig. 1) with a calculated molecular weight of about 110 kDa. Closer inspection of the deduced amino acid sequence shows a putative coiled-coil region (residues 227–254) and 13 dileucine motifs. Furthermore, two putative transmembrane regions are predicted at positions 726–743 and 772–790. Deduced amino acid sequences homologous to the rat protein over the entire length could be identified in the database for human, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, and Saccharomyces cerevisiae showing sequence identities (sequence similarities) of 88% (92%), 37% (55%), 25% (47%), 25% (41%) and 19% (36%), respectively (Fig. 1). Therefore, the rat gene described
L. Walter et al. / Gene 285 (2002) 213–220
Fig. 1. (continued overleaf)
215
216
L. Walter et al. / Gene 285 (2002) 213–220
L. Walter et al. / Gene 285 (2002) 213–220
217
Fig. 2. Expression analysis of rat Vps54l by northern blot with total RNA. Vps54l crosshybridizing bands of 4.5 and 2 kb are indicated by arrowheads. Exposure of the blot was for 2 days. After 6 days of exposure faint bands of 4.5 kb became detectable in the lanes containing skin, heart and muscle RNA. The lower panel shows rehybridization of the blot with a b-actin probe.
here is designated Vps54-like (Vps54l). With the exception of yeast VPS54 (vacuolar sorting protein 54), no function has been ascribed to these gene products so far. In yeast the VPS54 protein was found to be essential for retrograde transport of proteins from an endosomal/vacuolar to the late Golgi compartment (Conboy and Cyert, 2000; Conibear and Stevens, 2000). The function of this protein might be conserved from yeast to man, since all VPS54L-homologous proteins contain a coiled-coil region and dileucine motifs at comparable positions (Fig. 1). Interestingly, these motifs were also identified in the VPS54-interacting proteins VPS52 and VPS53 in yeast (Conibear and Stevens, 2000) as well as in the rat VPS52-homolog SACM2L (Walter and Gu¨ nther, 1998a) suggesting that these proteins might have a similar function in higher eukaryotes.
to the 4.5 kb transcript, a faint band of about 2 kb is detectable in most samples suggesting the presence of alternatively spliced transcripts (Fig. 2). Indeed, RT-PCR analysis using cDNA derived from the Y3 cell line revealed products of different length, and sequence analysis confirmed the presence of alternatively spliced transcripts (Fig. 1). Interestingly, in all the splicing variants that were analyzed, the sequence coding for the coiled-coil domain was missing. This finding is reminiscent of alternative splicing products reported for the rat Vps52 homolog Sacm2l (Walter and Gu¨ nther, 1998a), where the coiled-coil domain is also spliced out, suggesting a functional significance of these alternatively spliced products.
3.3. Physical and chromosomal mapping of Vps54l 3.2. Expression of Vps54l Northern blot analysis using total RNA revealed a transcript of about 4.5 kb in all tissues and cell lines tested, which corresponds in length to the Vps54l cDNA sequence reported here (Fig. 2). The expression level of Vps54l appears to be low in general, but is lower in skin, heart and skeletal muscle and higher in the B lymphoma cell line Y3 compared to the other tissues analyzed. In addition
A probe derived from the 3 0 part of the Vps54l cDNA (positions 2408–3416; AJ010392) was used to screen a rat PAC library. The hybridization patterns of the 14 clones analyzed after EcoRI digestion could be assigned to two types represented either by fragments of 9 and 2.5 kb in eight PAC clones, e.g. PAC RPCIP712J19115, or by fragments of 1.5 and 0.4 kb in six PAC clones, e.g. PAC RPCIP712B04201. These four EcoRI fragments were also
Fig. 1. Comparison between the deduced amino acid sequences of the rat Vps54l gene, yeast Vps54 as well as Vps54-like genes of other species. The respective database accession numbers are AJ010392 (rat), AF102177 (human), AE003624 (Drosophila), Z73098 (C. elegans), AL021768 (A. thaliana), NC_001136 (S. cerevisiae). Gaps (dots) are introduced to maximize homology. Numbering is listed individually for each protein to the right. Shading indicates identical or closely related amino acid residues according to the ClustalX program. The predicted coiled-coil region is boxed and dileucine motifs are shown in bold. Arrows mark amino acids 74–644 (P), 95–647 ( + ) and 102–536 ( * ), missing in alternatively spliced transcripts. Exon-intron boundaries were determined in the 3 0 part of rat Vps54l and are indicated by diamonds.
218
L. Walter et al. / Gene 285 (2002) 213–220
obtained by Southern blot analysis of BN strain genomic DNA with the same probe (data not shown). Primers 1 (positions 2190–2214; AJ010392) and 2 (positions 2925–2949; AJ010392) were used in long-range PCR and yielded a 10 kb amplificate with PACs of the first type (e.g. PAC RPCIP712J19115) and a 1.1 kb amplificate with PACs of the other type (e.g. PAC RPCIP712B04201). Sequencing revealed that the 10 kb amplificate contained exactly the cDNA sequence reported above, interrupted by four introns. Size and sequence of each exon were determined as well as parts of the introns (Fig. 1). The sequence of the 1.1 kb amplificate (accession number AJ276170) exhibited 21 nucleotide substitutions compared to the Vps54l cDNA sequence. Most characteristically, this amplificate did not contain introns. Further sequencing of the PAC clone revealed the presence of a short poly(A) tail adjacent to the third polyadenylation signal. Thus, the second type of PAC clones presumably carries a processed pseudogene (Vanin, 1984; Wagner, 1986) of Vps54l, which will be designated Vps54lp. End sequencing of one of the Vps54l-carrying PAC clones (RPCIP712G21378) resulted in a sequence that was 95% identical to nucleotide positions 233–332 of the coding sequence of the hamster UDP-glucose pyrophosphorylase 2 (Ugp2) cDNA (accession number AF004368). In order to determine the distance between the rat Ugp2 and Vps54l genes, a rat kidney cDNA library was screened with the partial rat Ugp2 sequence obtained from PAC RPCIP712G21378 (see above). A complete cDNA clone (UI_p612J1828) of the rat Ugp2 gene was obtained. Its 3 0 utr sequence of 339 bp was found to be adjacent to a sequence that extended 497 bp downstream of the third Vps54l polyadenylation signal (accession number AJ276169). Thus, both, the Vps54l and Ugp2 genes, are in tail-to-tail orientation and are separated by only 497 bp. A similar organization is found in the human genome where the respective polyadenylation signals of VPS54L and UGP2 are separated by 617 bp (see unfinished human genome sequence, EMBL accession number AC007910). Sequence similarity (80%) between the human and rat VPS54L – UGP2 intergenic regions extends only for 85 bp distal to the VPS54L gene and can not be observed over the entire region. In order to determine the chromosomal localization of the rat Vps54l and Ugp2 genes, specific primers were designed from the 3 0 utrs of both genes (see Section 2) resulting in the amplification of the remaining parts of the 3 0 utrs and intergenic region. This primer combination was used to screen a rat radiation hybrid (RH) panel. The RH vector of the 106 PCR reactions 000000101100000000100100110000000001 0000000000001000000001000110001010110010100100001100000000010111010001 was analyzed at the MCW and Otsuka servers (see Section 2). Both servers mapped the amplificate and thus Vps54l and Ugp2 to the end of chromosome 14 in close linkage with the D14rat22 marker showing the same high probability (lod score 22). In the MCW map
of chromosome 14, Vps54l and Ugp2 are localized at 7 cR3000 distance to D14Rat22 (Fig. 3). The chromosomal location was confirmed by FISH analysis of elongated metaphase/prometaphase chromosomes with PAC J19115 DNA as probe identifying the Vps54l gene on rat chromosome (RNO) 14q22 (Fig. 4A). The Vps54lp gene could be mapped to RNO7q22 by FISH (Fig. 4B). In view of the close proximity of the Vps54l and Ugp2 genes, the human VPS54L gene can be extrapolated to be localized on HSA2p13–p14 where the human UGP2 gene maps (Cheng et al., 1997). This is supported by unpublished data of Stenner-Liewen and colleagues (see database accession number AF102177) who mapped the human VPS54L gene (designated tumor antigen SLP-8p by these authors) to the same region. This localization is in accord with a conserved segment of orthology in rat and human (Watanabe et al., 1999, http://ratmap.ims.u-tokyo.ac.jp/cgi-bin/ Mapview_rat.pl?RNO14). On the basis of conserved homology the mouse Vps54l ortholog was predicted to map to the centromeric part of mouse chromosome (MMU) 11. This was confirmed by FISH analysis, since the PAC RPCIP712J19115 probe hybridzed to MMU11A3 (Fig. 4C). Only a limited number of genes have been assigned to
Fig. 3. Radiation hybrid analysis of rat Vps54l and Ugp2. The map of chromosome 14 shows the localization of the Vps54l and Ugp2 genes and framework markers and is redrawn from the MCW RH Map Server printout. 1 cR3000 corresponds to ,155 kb (Steen et al., 1999).
L. Walter et al. / Gene 285 (2002) 213–220
219
Fig. 5. Cytogenetic maps of RNO 7 and RNO 14. The FISH data of Fig. 4 have been integrated into the cytogenetic maps available in RATMAP (http://ratmap.gen.gu.se).
RNO14 yet and few have been mapped regionally (RATMAP, http://ratmap.gen.gu.se). The data reported here contribute to the cytogenetic map of RNO14 and also of RNO7 (Fig. 5) and to the corresponding comparative maps of human and mouse. 3.4. Conclusions 1. A novel gene is isolated in the rat, Vps54l, which is a homolog of the yeast Vps54 gene. VPS54-homologous sequences of human, Drosophila, Caenorhabditis and Arabidopsis are found in the database. VPS54 and the VPS54-homologous proteins contain a coiled-coil region and dileucine motifs. In yeast, VPS54 is involved in cellular protein sorting in the endosomal/vacuolar and Golgi compartment. 2. The rat Vps54l gene is expressed ubiquitously, but at a low level. Alternatively spliced transcripts can be identified. These transcripts lack the sequence coding for the coiledcoil region which mediates protein-protein interaction. 3. The Vps54l gene maps to rat chromosome 14q22 and mouse chromosome 11A3. A processed pseudogene of Vps54l is identified in the rat and maps to rat chromosome 7q22. Fig. 4. Mapping of Vps54l by FISH in rat and mouse. (A) Mapping of the rat Vps54l gene (probe PAC RPCIP712J19115) to chromosome RNO14q22 (arrows). (B) Mapping of the Vps54l pseudogene (probe PAC RPCIP712B04201) to RNO7q22 (arrows). (C). Mapping of the mouse Vps54l homolog to MMU11A3. In each figure the FITC probe signals have been superimposed on the DAPI stained metaphase chromosomes permitting unequivocal chromosome identification.
Acknowledgements This work was supported by the Deutsche Forschungsgemeinschaft (SFB 500, E.G., S.S.), the Swedish Cancer Society, the Swedish Medical Research Council, the IngaB-
220
L. Walter et al. / Gene 285 (2002) 213–220
ritt and Arne Lundberg Research Foundation, the Wilhelm and Martina Lundgren Foundation, the Royal Swedish Academy of Sciences, the Royal and Hvitfeldtska Foundation (K.H., G.L.), and a joint grant (E.G, K.H., G.L., L.W.) from the European Union (contract No. BIO4-CT96-0562). P.F., E.G., S.S., and L.W. acknowledge in particular the supply of PAC filters and clones by the German Resource Center in Berlin. References Bauer, D., Mu¨ ller, H., Reich, J., Riedel, H., Ahrenkiel, V., Warthoe, P., Strauss, M., 1993. Identification of differentially expressed mRNA species by an improved display technique (DDRT-PCR). Nucleic Acids Res. 21, 4272–4280. Cheng, S.-D., Peng, H.-L., Chang, H.-Y., 1997. Localization of the human UGP2 gene encoding the muscle isoform of UDP glucose pyrophosphorylase to 2p13–p14 by fluorescence in situ hybridization. Genomics 39, 414–416. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. Conboy, M.J., Cyert, M.S., 2000. Luv1p/Rki1p/Vps54p, a yeast protein that localizes to the late Golgi and early endosome, is required for normal vacuolar morphology. Mol. Biol. Cell 11, 2429–2443. Conibear, E., Stevens, T.H., 2000. Vps52p, Vps53p, and Vps54p form a novel multisubunit complex required for protein sorting at the yeast late Golgi. Mol. Biol. Cell 11, 305–323. Galfre, G., Milstein, C., Wright, B., 1979. Rat £ rat hybrid myeloma and a monoclonal anti-Fd portion of mouse IgG. Nature 277, 131–132. Helou, K., Walter, L., Gu¨ nther, E., Levan, G., 1998. Cytogenetic orientation of the rat major histocompatibility complex (MHC) on chromosome 20. Immunogenetics 47, 166–169. Kozak, M., 1988. Compilation and analysis of sequences upstream from the
translational start site in eukaryotic mRNAs. Nucleic Acids Res. 12, 857–872. Steen, R.G., Kwitek-Black, A.E., Glenn, C., Gullings-Handley, J., Van Etten, W., Atkinson, S.O., Appel, D., Twigger, S., Muir, M., Mull, T., Granados, M., Kissebah, M., Russo, K., Crane, R., Popp, M., Peden, M., Matise, T., Brown, D.M., Lu, J., Kingsmore, S., Tonellato, P.J., Rozen, S., Slonim, D., Young, P., Knoblauch, M., Provoost, A., Ganten, D., Colman, S.D., Rothberg, J., Lander, E.S., Jacob, H.J., 1999. A high-density integrated genetic linkage and radiation hybrid map of the laboratory rat. Genome Res. 9, AP1–AP8. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876–4882. Vanin, E.F., 1994. Processed pseudogenes, characteristics and evolution. Biochim. Biophys. Acta 782, 231–241. Wagner, M., 1986. A consideration of the origin of processed pseudogenes. Trends Genet. 2, 134–137. Walter, L., Gu¨ nther, E., 1998a. Identification of a novel highly conserved gene in the centromeric part of the major histocompatibility complex. Genomics 52, 298–304. Walter, L., Gu¨ nther, E., 1998b. Isolation and molecular characterization of the rat MR1 homologue, a non-MHC-linked class I-related gene. Immunogenetics 47, 477–482. Watanabe, T.K., Bihoreau, M.-T., McCarthy, L.C., Kiguwa, S.L., Hishigaki, H., Tsuji, A., Browne, J., Yamasaki, Y., Mizoguchi-Miyakita, A., Oga, K., Ono, T., Okuno, S., Kanemoto, N., Takahashi, E., Tomita, K., Hayashi, H., Adachi, M., Webber, C., Davis, M., Kiel, S., Knights, C., Smith, A., Critcher, R., Miller, J., Thangarajah, T., Day, P.J.R., Hudson Jr, J.R., Irie, Y., Takagi, T., Nakamura, Y., Goodfellow, P.N., Lathrop, G.M., Tanigami, A., James, M.R., 1999. A radiation hybrid map of the rat genome containing 5255 markers. Nat. Genet. 22, 27–36. Woon, P.Y., Osoegawa, K., Kaisaki, P.J., Zhao, B., Catanese, J.J., Gauguier, D., Cox, R., Levy, E.R., Lathrop, G.M., Monaco, A.P., de Jong, P.J., 1998. Construction and characterization of a 10-fold genome equivalent rat P1-derived artificial chromosome library. Genomics 50, 306–316.
Identification, characterization and cytogenetic mapping of a yeast Vps54 homolog in rat and mouse q Lutz Walter a,1,*, Sandra Stark a,1, 2, Khalil Helou b, Perris Flu¨gge a, Go¨ran Levan b, Eberhard Gu¨nther a b
a Division of Immunogenetics, Georg-August-University, D-37073 Go¨ttingen, Germany CMB – Genetics, Lundberg Laboratory, Go¨teborg University, S-41390 Go¨teborg, Sweden
Received 18 July 2001; received in revised form 31 July 2001; accepted 2 August 2001 Received by S. Salzberg
Abstract A novel gene, VPS54-like (Vps54l), is described in the rat that is homologous to the yeast Vps54 gene which is known to be involved in intracellular protein sorting. Furthermore, Vps54-related sequences of human, mouse, Drosophila melanogaster, Caenorhabditis elegans and Arabidopsis thaliana could be identified in the EMBL/GenBank/DDBJ database. Each of the deduced amino acid sequences of the Vps54 genes in these species contain a coiled-coil region and eight to 13 dileucine motifs. The rat Vps54l gene could be mapped to the end of chromosome 14 by radiation hybrid analysis 7 cR3000 from the D14Rat22 marker and to 14q22 by fluorescence in situ hybridization. Using a rat Vps54l-containing P1-derived artificial chromosome (PAC) clone the respective ortholog was mapped to chromosome 11A3 in the mouse. In addition, the rat genome contains a processed pseudogene of Vps54l on chromosome 7q22. PAC clone analysis shows that the rat Vps54l gene maps close to the UDP-glucose-pyrophosphorylase 2 gene. The two genes are in tail to tail orientation with their polyadenylation sites 497 bp apart. Rat Vps54l appears to be expressed ubiquitously, but at a relatively low level. Alternatively spliced transcripts could be isolated which lack the sequence coding for the coiled-coil region. q 2002 Elsevier Science B.V. All rights reserved. Keywords: Rat; Expression; Alternative splicing; Radiation hybrid mapping; Fluorescence in situ hybridization mapping; Evolution
1. Introduction In yeast the Vps52, Vps53, and Vps54 proteins form a trimolecular complex that is required for retrograde transport of proteins from an endosomal/prevacuolar to the late Golgi compartment (Conibear and Stevens, 2000). Single
Abbreviations: cDNA, DNA complementary to RNA; EST, expressed sequence tag; FISH, fluorescence in situ hybridization; HSA, human chromosome; kDa, kilodaltons; MHC, major histocompatibility complex; MMU, mouse chromosome; PAC, P1-derived artificial chromosome; RH, radiation hybrid; RNO, rat chromosome; RT-PCR, reverse transcriptase polymerase chain reaction; Ugp2, UDP-glucose-pyrophopshorylase 2 gene; Vps54l, VPS54-like gene; utr, untranslated region q The sequences for Vps54l cDNA, Vps54lp and the Vps54l-Ugp2 intergenic region reported in this paper have been assigned the EMBL accession numbers AJ010392, AJ276170 and AJ276169, respectively. * Corresponding author. Division of Immunogenetics, University of Go¨ttingen, Heinrich-Du¨ker-Weg 12, D-37073 Go¨ttingen, Germany. Tel.: 149-551-395-854; fax: 149-551-395-852. E-mail address: [email protected] (L. Walter). 1 Both authors contributed equally. 2 Present address: NOXXON Pharma AG, Gustav-Meyer-Allee 25, D13355 Berlin, Germany.
mutations in any of the three proteins can result in missorting of proteins and impaired Golgi to vacuole protein traffic, indicating that VPS52, VPS53, and VPS54 each play an essential role in the protein transport between the Golgi and endosomal/vacuolar compartments. Recently, we identified a Vps52 (previously designated Sac2) homolog, Sacm2l, in the centromeric part of the human, rat and mouse major histocompatibility complex (MHC) on human chromosome (HSA)6p21.3, rat chromosome (RNO)20p12, and mouse chromosome (MMU) 17, respectively (Walter and Gu¨nther, 1998a). Sacm2l is ubiquitously expressed and contains coiled-coil and dileucine motifs as well as putative transmembrane segments. We describe here the identification, physical and cytogenetic mapping of the rat and mouse Vps54 homologs.
2. Materials and methods 2.1. Identification of Vps54l cDNA In the course of expression analysis of the rat myeloma
0378-1119/02/$ - see front matter q 2002 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(02)00405-5
214
L. Walter et al. / Gene 285 (2002) 213–220
cell line 210-RCY3-Ag.1.2.3 (Y3) of LOU/C inbred rat strain origin (Galfre et al., 1979) by the differential display method (Bauer et al., 1993) a differential band, Bd8, was isolated and sequenced. This partial sequence was completed at the 3 0 and 5 0 ends by using anchored reverse transcriptase polymerase chain reaction (RT-PCR) as described (Walter and Gu¨ nther, 1998b). 2.2. Genomic analysis High density filters of a P1-derived artificial chromosome (PAC) library (RPCIP712) of BN rat origin (Woon et al., 1998), individual PAC clones and a rat kidney cDNA library (UI_p612) were obtained from the German Resource Center, Berlin, Germany. 2.3. Sequencing analysis Sequencing reactions were analyzed with an ABI310 automated sequencer (Applied Biosystems, Weiterstadt, Germany). 2.4. Analysis of amino acid sequences Prediction of coiled-coil regions (http://www.ch.embnet.org/software/COILS_form.html), dileucine motifs (http:// psort.nibb.ac.jp/) and transmembrane segments (http:// www.ch.embnet.org/software/TMPRED_form.html) were carried out with the respective programs at the indicated servers. Multiple alignment of amino acid sequences was carried out with the ClustalX software (version 1.8, Thompson et al., 1997). 2.5. PCR analysis Standard conditions with Taq DNA polymerase (Roche Diagnostics, Mannheim, Germany) were used according to melting temperature of primers and expected length of amplificate. Analysis of PCR products was performed in 1% agarose gels run in Tris borate buffer. Long range PCR was performed with the Expand w Long Template PCR System according to the manufacturer’s recommendations (Roche Diagnostics). 2.6. Chromosomal mapping A rat radiation hybrid (RH) panel (Research Genetics, Huntsville, Alabama) was screened with primers GAGGTATGTCATTGGTTCTT and GCAATGAGCTTTTAGTCTAAGG which are located in the 3 0 untranslated region (utr) of Vps54l and Ugp2, respectively, and amplify the 3 0 utrs and intergenic region between these genes. Hamster and rat-specific amplificates could be discriminated according to their different lengths. Analysis of the RH data was carried out online at the Bioinformatics Research Center, Medical College of Wisconsin (MCW), USA (http://rgd. mcw.edu/RHMAPSERVER/#instruction) and the Otsuka GEN Research Institute, Japan (http://e4000.otsuka.gr.
jp:8012/cgi-bin/RH/rhNgv.pl). FISH analysis was performed as described previously (Helou et al., 1998). 2.7. Expression analysis Total RNA derived from several rat tissues, the rat insulinoma cell line RIN-m, the rat lymphoma cell line 210-RCY3Ag.1.2.3 (Y3) and the mouse fibroblast L cell line was isolated according to Chomczynski and Sacchi (1987). Northern blot analysis was carried out with 30 mg of total RNA and a rat Vps54l probe encompassing 2065 bp (positions 1–2065, accession number AJ010392). For RT-PCR, 1 mg of total RNA derived from the rat cell line Y3 was transcribed using random nonamer oligonucleotides and 400 units of reverse transcriptase (Amersham Pharmacia Biotech, Freiburg, Germany). PCR was subsequently carried out with primers 5 0 TTGAGTGGTGATTTTATGCA3 0 and 5 0 GCAACTTCTTGAATTGAAGTACT3 0 (positions 1–20 and 2317–2339; AJ010392) and semi-nested PCR was performed with primers 5 0 TTGAGTGGTGATTTTATGCA3 0 and 5 0 AGACAATGAGCGTTGGAAGCA3 0 (positions 1–20 and 2045–2065; AJ010392). Resulting products were cloned in the PCR cloning vector pcDNA3.1/V5 and sequenced with the T7 promoter primer (Invitrogen, Groningen, The Netherlands). 3. Results and discussion 3.1. Isolation and characterization of Vps54l On the basis of a cDNA fragment of 350 bp initially isolated by the differential display procedure and provisionally designated Bd8, the corresponding complete cDNA was established by 3 0 and 5 0 anchored RT-PCR (database accession number AJ010392). It contains an open reading frame of 2895 bp that starts with an ATG, fulfilling the criteria of a start codon (Kozak, 1988). The 3 0 utr carries three classical polyadenylation signals. Expressed sequence tags (ESTs) of different species that corresponded to Bd8 were found in the database (http://www.ncbi.nlm.nih.gov). The ESTs appear to be derived predominantly from transcripts using the first or third polyadenylation signal. The deduced amino acid sequence of this novel rat gene encompasses 965 amino acid residues (Fig. 1) with a calculated molecular weight of about 110 kDa. Closer inspection of the deduced amino acid sequence shows a putative coiled-coil region (residues 227–254) and 13 dileucine motifs. Furthermore, two putative transmembrane regions are predicted at positions 726–743 and 772–790. Deduced amino acid sequences homologous to the rat protein over the entire length could be identified in the database for human, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, and Saccharomyces cerevisiae showing sequence identities (sequence similarities) of 88% (92%), 37% (55%), 25% (47%), 25% (41%) and 19% (36%), respectively (Fig. 1). Therefore, the rat gene described
L. Walter et al. / Gene 285 (2002) 213–220
Fig. 1. (continued overleaf)
215
216
L. Walter et al. / Gene 285 (2002) 213–220
L. Walter et al. / Gene 285 (2002) 213–220
217
Fig. 2. Expression analysis of rat Vps54l by northern blot with total RNA. Vps54l crosshybridizing bands of 4.5 and 2 kb are indicated by arrowheads. Exposure of the blot was for 2 days. After 6 days of exposure faint bands of 4.5 kb became detectable in the lanes containing skin, heart and muscle RNA. The lower panel shows rehybridization of the blot with a b-actin probe.
here is designated Vps54-like (Vps54l). With the exception of yeast VPS54 (vacuolar sorting protein 54), no function has been ascribed to these gene products so far. In yeast the VPS54 protein was found to be essential for retrograde transport of proteins from an endosomal/vacuolar to the late Golgi compartment (Conboy and Cyert, 2000; Conibear and Stevens, 2000). The function of this protein might be conserved from yeast to man, since all VPS54L-homologous proteins contain a coiled-coil region and dileucine motifs at comparable positions (Fig. 1). Interestingly, these motifs were also identified in the VPS54-interacting proteins VPS52 and VPS53 in yeast (Conibear and Stevens, 2000) as well as in the rat VPS52-homolog SACM2L (Walter and Gu¨ nther, 1998a) suggesting that these proteins might have a similar function in higher eukaryotes.
to the 4.5 kb transcript, a faint band of about 2 kb is detectable in most samples suggesting the presence of alternatively spliced transcripts (Fig. 2). Indeed, RT-PCR analysis using cDNA derived from the Y3 cell line revealed products of different length, and sequence analysis confirmed the presence of alternatively spliced transcripts (Fig. 1). Interestingly, in all the splicing variants that were analyzed, the sequence coding for the coiled-coil domain was missing. This finding is reminiscent of alternative splicing products reported for the rat Vps52 homolog Sacm2l (Walter and Gu¨ nther, 1998a), where the coiled-coil domain is also spliced out, suggesting a functional significance of these alternatively spliced products.
3.3. Physical and chromosomal mapping of Vps54l 3.2. Expression of Vps54l Northern blot analysis using total RNA revealed a transcript of about 4.5 kb in all tissues and cell lines tested, which corresponds in length to the Vps54l cDNA sequence reported here (Fig. 2). The expression level of Vps54l appears to be low in general, but is lower in skin, heart and skeletal muscle and higher in the B lymphoma cell line Y3 compared to the other tissues analyzed. In addition
A probe derived from the 3 0 part of the Vps54l cDNA (positions 2408–3416; AJ010392) was used to screen a rat PAC library. The hybridization patterns of the 14 clones analyzed after EcoRI digestion could be assigned to two types represented either by fragments of 9 and 2.5 kb in eight PAC clones, e.g. PAC RPCIP712J19115, or by fragments of 1.5 and 0.4 kb in six PAC clones, e.g. PAC RPCIP712B04201. These four EcoRI fragments were also
Fig. 1. Comparison between the deduced amino acid sequences of the rat Vps54l gene, yeast Vps54 as well as Vps54-like genes of other species. The respective database accession numbers are AJ010392 (rat), AF102177 (human), AE003624 (Drosophila), Z73098 (C. elegans), AL021768 (A. thaliana), NC_001136 (S. cerevisiae). Gaps (dots) are introduced to maximize homology. Numbering is listed individually for each protein to the right. Shading indicates identical or closely related amino acid residues according to the ClustalX program. The predicted coiled-coil region is boxed and dileucine motifs are shown in bold. Arrows mark amino acids 74–644 (P), 95–647 ( + ) and 102–536 ( * ), missing in alternatively spliced transcripts. Exon-intron boundaries were determined in the 3 0 part of rat Vps54l and are indicated by diamonds.
218
L. Walter et al. / Gene 285 (2002) 213–220
obtained by Southern blot analysis of BN strain genomic DNA with the same probe (data not shown). Primers 1 (positions 2190–2214; AJ010392) and 2 (positions 2925–2949; AJ010392) were used in long-range PCR and yielded a 10 kb amplificate with PACs of the first type (e.g. PAC RPCIP712J19115) and a 1.1 kb amplificate with PACs of the other type (e.g. PAC RPCIP712B04201). Sequencing revealed that the 10 kb amplificate contained exactly the cDNA sequence reported above, interrupted by four introns. Size and sequence of each exon were determined as well as parts of the introns (Fig. 1). The sequence of the 1.1 kb amplificate (accession number AJ276170) exhibited 21 nucleotide substitutions compared to the Vps54l cDNA sequence. Most characteristically, this amplificate did not contain introns. Further sequencing of the PAC clone revealed the presence of a short poly(A) tail adjacent to the third polyadenylation signal. Thus, the second type of PAC clones presumably carries a processed pseudogene (Vanin, 1984; Wagner, 1986) of Vps54l, which will be designated Vps54lp. End sequencing of one of the Vps54l-carrying PAC clones (RPCIP712G21378) resulted in a sequence that was 95% identical to nucleotide positions 233–332 of the coding sequence of the hamster UDP-glucose pyrophosphorylase 2 (Ugp2) cDNA (accession number AF004368). In order to determine the distance between the rat Ugp2 and Vps54l genes, a rat kidney cDNA library was screened with the partial rat Ugp2 sequence obtained from PAC RPCIP712G21378 (see above). A complete cDNA clone (UI_p612J1828) of the rat Ugp2 gene was obtained. Its 3 0 utr sequence of 339 bp was found to be adjacent to a sequence that extended 497 bp downstream of the third Vps54l polyadenylation signal (accession number AJ276169). Thus, both, the Vps54l and Ugp2 genes, are in tail-to-tail orientation and are separated by only 497 bp. A similar organization is found in the human genome where the respective polyadenylation signals of VPS54L and UGP2 are separated by 617 bp (see unfinished human genome sequence, EMBL accession number AC007910). Sequence similarity (80%) between the human and rat VPS54L – UGP2 intergenic regions extends only for 85 bp distal to the VPS54L gene and can not be observed over the entire region. In order to determine the chromosomal localization of the rat Vps54l and Ugp2 genes, specific primers were designed from the 3 0 utrs of both genes (see Section 2) resulting in the amplification of the remaining parts of the 3 0 utrs and intergenic region. This primer combination was used to screen a rat radiation hybrid (RH) panel. The RH vector of the 106 PCR reactions 000000101100000000100100110000000001 0000000000001000000001000110001010110010100100001100000000010111010001 was analyzed at the MCW and Otsuka servers (see Section 2). Both servers mapped the amplificate and thus Vps54l and Ugp2 to the end of chromosome 14 in close linkage with the D14rat22 marker showing the same high probability (lod score 22). In the MCW map
of chromosome 14, Vps54l and Ugp2 are localized at 7 cR3000 distance to D14Rat22 (Fig. 3). The chromosomal location was confirmed by FISH analysis of elongated metaphase/prometaphase chromosomes with PAC J19115 DNA as probe identifying the Vps54l gene on rat chromosome (RNO) 14q22 (Fig. 4A). The Vps54lp gene could be mapped to RNO7q22 by FISH (Fig. 4B). In view of the close proximity of the Vps54l and Ugp2 genes, the human VPS54L gene can be extrapolated to be localized on HSA2p13–p14 where the human UGP2 gene maps (Cheng et al., 1997). This is supported by unpublished data of Stenner-Liewen and colleagues (see database accession number AF102177) who mapped the human VPS54L gene (designated tumor antigen SLP-8p by these authors) to the same region. This localization is in accord with a conserved segment of orthology in rat and human (Watanabe et al., 1999, http://ratmap.ims.u-tokyo.ac.jp/cgi-bin/ Mapview_rat.pl?RNO14). On the basis of conserved homology the mouse Vps54l ortholog was predicted to map to the centromeric part of mouse chromosome (MMU) 11. This was confirmed by FISH analysis, since the PAC RPCIP712J19115 probe hybridzed to MMU11A3 (Fig. 4C). Only a limited number of genes have been assigned to
Fig. 3. Radiation hybrid analysis of rat Vps54l and Ugp2. The map of chromosome 14 shows the localization of the Vps54l and Ugp2 genes and framework markers and is redrawn from the MCW RH Map Server printout. 1 cR3000 corresponds to ,155 kb (Steen et al., 1999).
L. Walter et al. / Gene 285 (2002) 213–220
219
Fig. 5. Cytogenetic maps of RNO 7 and RNO 14. The FISH data of Fig. 4 have been integrated into the cytogenetic maps available in RATMAP (http://ratmap.gen.gu.se).
RNO14 yet and few have been mapped regionally (RATMAP, http://ratmap.gen.gu.se). The data reported here contribute to the cytogenetic map of RNO14 and also of RNO7 (Fig. 5) and to the corresponding comparative maps of human and mouse. 3.4. Conclusions 1. A novel gene is isolated in the rat, Vps54l, which is a homolog of the yeast Vps54 gene. VPS54-homologous sequences of human, Drosophila, Caenorhabditis and Arabidopsis are found in the database. VPS54 and the VPS54-homologous proteins contain a coiled-coil region and dileucine motifs. In yeast, VPS54 is involved in cellular protein sorting in the endosomal/vacuolar and Golgi compartment. 2. The rat Vps54l gene is expressed ubiquitously, but at a low level. Alternatively spliced transcripts can be identified. These transcripts lack the sequence coding for the coiledcoil region which mediates protein-protein interaction. 3. The Vps54l gene maps to rat chromosome 14q22 and mouse chromosome 11A3. A processed pseudogene of Vps54l is identified in the rat and maps to rat chromosome 7q22. Fig. 4. Mapping of Vps54l by FISH in rat and mouse. (A) Mapping of the rat Vps54l gene (probe PAC RPCIP712J19115) to chromosome RNO14q22 (arrows). (B) Mapping of the Vps54l pseudogene (probe PAC RPCIP712B04201) to RNO7q22 (arrows). (C). Mapping of the mouse Vps54l homolog to MMU11A3. In each figure the FITC probe signals have been superimposed on the DAPI stained metaphase chromosomes permitting unequivocal chromosome identification.
Acknowledgements This work was supported by the Deutsche Forschungsgemeinschaft (SFB 500, E.G., S.S.), the Swedish Cancer Society, the Swedish Medical Research Council, the IngaB-
220
L. Walter et al. / Gene 285 (2002) 213–220
ritt and Arne Lundberg Research Foundation, the Wilhelm and Martina Lundgren Foundation, the Royal Swedish Academy of Sciences, the Royal and Hvitfeldtska Foundation (K.H., G.L.), and a joint grant (E.G, K.H., G.L., L.W.) from the European Union (contract No. BIO4-CT96-0562). P.F., E.G., S.S., and L.W. acknowledge in particular the supply of PAC filters and clones by the German Resource Center in Berlin. References Bauer, D., Mu¨ ller, H., Reich, J., Riedel, H., Ahrenkiel, V., Warthoe, P., Strauss, M., 1993. Identification of differentially expressed mRNA species by an improved display technique (DDRT-PCR). Nucleic Acids Res. 21, 4272–4280. Cheng, S.-D., Peng, H.-L., Chang, H.-Y., 1997. Localization of the human UGP2 gene encoding the muscle isoform of UDP glucose pyrophosphorylase to 2p13–p14 by fluorescence in situ hybridization. Genomics 39, 414–416. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. Conboy, M.J., Cyert, M.S., 2000. Luv1p/Rki1p/Vps54p, a yeast protein that localizes to the late Golgi and early endosome, is required for normal vacuolar morphology. Mol. Biol. Cell 11, 2429–2443. Conibear, E., Stevens, T.H., 2000. Vps52p, Vps53p, and Vps54p form a novel multisubunit complex required for protein sorting at the yeast late Golgi. Mol. Biol. Cell 11, 305–323. Galfre, G., Milstein, C., Wright, B., 1979. Rat £ rat hybrid myeloma and a monoclonal anti-Fd portion of mouse IgG. Nature 277, 131–132. Helou, K., Walter, L., Gu¨ nther, E., Levan, G., 1998. Cytogenetic orientation of the rat major histocompatibility complex (MHC) on chromosome 20. Immunogenetics 47, 166–169. Kozak, M., 1988. Compilation and analysis of sequences upstream from the
translational start site in eukaryotic mRNAs. Nucleic Acids Res. 12, 857–872. Steen, R.G., Kwitek-Black, A.E., Glenn, C., Gullings-Handley, J., Van Etten, W., Atkinson, S.O., Appel, D., Twigger, S., Muir, M., Mull, T., Granados, M., Kissebah, M., Russo, K., Crane, R., Popp, M., Peden, M., Matise, T., Brown, D.M., Lu, J., Kingsmore, S., Tonellato, P.J., Rozen, S., Slonim, D., Young, P., Knoblauch, M., Provoost, A., Ganten, D., Colman, S.D., Rothberg, J., Lander, E.S., Jacob, H.J., 1999. A high-density integrated genetic linkage and radiation hybrid map of the laboratory rat. Genome Res. 9, AP1–AP8. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876–4882. Vanin, E.F., 1994. Processed pseudogenes, characteristics and evolution. Biochim. Biophys. Acta 782, 231–241. Wagner, M., 1986. A consideration of the origin of processed pseudogenes. Trends Genet. 2, 134–137. Walter, L., Gu¨ nther, E., 1998a. Identification of a novel highly conserved gene in the centromeric part of the major histocompatibility complex. Genomics 52, 298–304. Walter, L., Gu¨ nther, E., 1998b. Isolation and molecular characterization of the rat MR1 homologue, a non-MHC-linked class I-related gene. Immunogenetics 47, 477–482. Watanabe, T.K., Bihoreau, M.-T., McCarthy, L.C., Kiguwa, S.L., Hishigaki, H., Tsuji, A., Browne, J., Yamasaki, Y., Mizoguchi-Miyakita, A., Oga, K., Ono, T., Okuno, S., Kanemoto, N., Takahashi, E., Tomita, K., Hayashi, H., Adachi, M., Webber, C., Davis, M., Kiel, S., Knights, C., Smith, A., Critcher, R., Miller, J., Thangarajah, T., Day, P.J.R., Hudson Jr, J.R., Irie, Y., Takagi, T., Nakamura, Y., Goodfellow, P.N., Lathrop, G.M., Tanigami, A., James, M.R., 1999. A radiation hybrid map of the rat genome containing 5255 markers. Nat. Genet. 22, 27–36. Woon, P.Y., Osoegawa, K., Kaisaki, P.J., Zhao, B., Catanese, J.J., Gauguier, D., Cox, R., Levy, E.R., Lathrop, G.M., Monaco, A.P., de Jong, P.J., 1998. Construction and characterization of a 10-fold genome equivalent rat P1-derived artificial chromosome library. Genomics 50, 306–316.