- Email: [email protected]
Identification and function of 11 Rab GTPases in giant freshwater prawn Macrobrachium rosenbergii
Fish & Shellfish Immunology 43 (2015) 120e130
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Identification and function of 11 Rab GTPases in giant freshwater prawn Macrobrachium rosenbergii Ying Huang, Qian Ren* Jiangsu Key Laboratory for Biodiversity & Biotechnology and Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 24 October 2014 Received in revised form 15 December 2014 Accepted 16 December 2014 Available online 24 December 2014
Rab GTPases, members of the Ras-like GTPase superfamily, are central elements in endocytic membrane trafficking. However, little is known of the Rab genes in the giant freshwater prawn Macrobrachium rosenbergii. In this study, 11 Rab genes were identified from M. rosenbergii. All MrRabs have a RAB domain. Phylogenetic analysis showed that these 11 MrRabs were divided into different groups. The MrRab genes were ubiquitously expressed in heart, hemocytes, hepatopancreas, gills, stomach, and intestines. Real-time polymerase chain reaction revealed that the MrRab genes were significantly upregulated by white spot syndrome virus (WSSV) in the prawns, indicating that MrRabs might play an important role in innate immune response against WSSV. Moreover, after challenge with Vibrio parahaemolyticus, the expression levels of all MrRabs in the hepatopancreas were also upregulated, which might indicated the involvement of MrRabs in prawns antibacterial immunity. In all, these preliminary results showed that MrRabs were involved in innate immunity of M. rosenbergii. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Macrobrachium rosenbergii Rab GTPases Anti-WSSV Antibacterial Innate immunity
1. Introduction Rab GTPase, a monophyletic clade of the Ras-like small GTPase superfamily (Ras, Rho/Rac/Cdc42, Ran, Sar/Arf, and Rab) with a molecular mass of 20 kDae40 kDa, is well known for its control function in intracellular membrane trafficking in all eukaryotic cells [1e4]. Rab GTPase is an important component of the endomembrane system, which includes the endoplasmic reticulum (ER), Golgi, endosomes, lysosomes, nucleus, plasma membrane, mitochondria, and centrioles [5]. Members in this family function as “molecular switches” that shuttle between a guanosine diphosphate (GDP)-bound inactive conformation (cytosolic localization) and a guanosine triphosphate (GTP)-bound active conformation (membranous localization) [6]. In the GTP-bound state, Rab interacts with various effector proteins that function in the regulation of many key steps in membrane trafficking, including vesicle formation, vesicle motility, membrane remodeling, vesicle docking, membrane fusion, and multiple stages of intracellular transport processes [2,3,7]. Moreover, Rab GTPases are essential for some important biological processes, including growth and
* Corresponding author. Tel.: þ86 25 85891955; fax: þ86 25 85891526. E-mail address: [email protected] (Q. Ren). http://dx.doi.org/10.1016/j.fsi.2014.12.021 1050-4648/© 2014 Elsevier Ltd. All rights reserved.
differentiation, morphogenesis, cell division and motility, cytokinesis, and vesicle trafficking [7]. Rab proteins were first described in the yeast Saccharomyces cerevisiae [8,9]. Subsequently, substantial evidence was accumulated to support the role of Rab proteins in vesicle trafficking from yeast to humans [10]. To date, more than 60 distinct Rab proteins have been discovered from various species. The number of Rab proteins varies depending on the species [11]. In humans, 63 Rab proteins were identified, whereas 11, 26, and 52 Rab GTPases were identified in the genomes of S. cerevisiae, Drosophila melanogaster, and Ictalurus punctatus, respectively [5,12,13]. The difference in the number of Rab proteins is mainly caused by gene duplications, leading to the presence of paralogs [5]. Orthologous Rab proteins from various species, as well as their paralogs, are structurally highly conserved [14,15]. In mammals, previous reports indicated that Rab GTPases play important roles in the formation and maturation of the phagosome and the clearance of pathogens in innate immunity [16,17]. In recent years, more Rab proteins have also been found to be involved in crustacean innate immunity, which mainly focused on antiviral immunity and antibacterial activity [18e23]. For example, mRNA expression of the Rab gene in penaeid shrimp Penaeus japonicus (PjRab) was upregulated after white spot syndrome virus (WSSV) infection [18]. The Rab protein in P. japonicus could interact with
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
envelope protein VP466 of WSSV as an intracellular virus recognition protein utilized by the host. Then, the Rab protein could regulate shrimp hemocytic phagocytosis of WSSV by interacting with b-actin and tropomyosin [19]. The GTP-binding protein PmRab7 in Penaeus monodon directly interacts with the WSSV major structural protein VP28, which is involved in systemic infection of WSSV [20]. WSSV or yellow head virus infection is inhibited in P. monodon when PmRab7 is suppressed with doublestranded RNA (dsRNA) [21]. Moreover, phagocytosis against the bacterium Vibrio parahaemolyticus could be inhibited in the shrimp Marsupenaeus japonicus when the Rab gene (PjRab) is silenced by sequence-specific siRNA [22]. After the crabs are challenged by Vibrio anguillarum, the expression levels of EsRab-1 and EsRab-3 in hemocytes are significantly upregulated, indicating that they are involved in crab innate immunity against bacteria [23]. Thus far, systematic analyses of the Rab families have not been reported in Macrobrachium rosenbergii. In this study, we conducted an analysis of the complete set of 11 Rab GTPases in M. rosenbergii. Their orthologies and paralogies were established through phylogenetic analysis. Their tissue distributions and temporal responses to WSSV and bacteria challenge were analyzed using quantitative real-time polymerase chain reaction (qRT-PCR). 2. Materials and methods 2.1. Identification of Rab genes and sequence analysis Eleven expressed sequence tags (ESTs) in M. rosenbergii similar to Rab genes were obtained from hepatopancreas transcriptome data (data unpublished). The 30 -RACE-Ready cDNA was synthesized following the instructions of Clontech SMARTer™ RACE cDNA Amplification Kit from Takara (Dalian, China) with 30 -CDS Primer A. Gene-specific forward primers (MrRab1A-F, MrRab5C-F, MrRab6A-F, MrRab7A-F, MrRab9A-F, MrRab10-F, MrRab11A-F, MrRab14-F, MrRab18-F, MrRab27A-F, and MrRab32-F) were designed based on the ESTs. The 30 fragments of MrRabs were cloned using genespecific forward primers and Universal Primer A Mix. An Advantage 2 PCR Kit from Takara (Dalian, China) was used for gene cloning. PCR reaction was conducted using the following conditions: 5 cycles at 94 C for 30 s and 72 C for 2 min; 5 cycles at 94 C for 30 s, 70 C for 30 s, and 72 C for 2 min; and 20 cycles at 94 C for 30 s, 68 C for 30 s, and 72 C for 2 min. The full lengths of MrRabs were obtained by overlapping the ESTs and 30 fragments. Translations of cDNAs and predictions of the deduced proteins were conducted using ExPASy (http://www.au.expasy.org/). The protein sequences of MrRabs were used in the phylogenetic analysis. Phylogenetic trees were constructed using MEGA software [24]. 2.2. Experimental animals and immune challenge in prawns Adult M. rosenbergii (approximately 15 g each) were purchased from an aquaculture market in Nanjing, Jiangsu Province, China. The prawns were acclimatized under laboratory conditions in freshwater tanks at room temperature (23 ± 2 C) for 1 week before processing. One hundred prawns were utilized for the immune challenge experiment. The prawns were randomly divided into a control group and two experimental groups, namely, the WSSV- and V. parahaemolyticus-challenged groups. Each group contained 30 individuals. In the V. parahaemolyticus-challenged group, approximately 3 107 cells were injected into the abdominal segment of M. rosenbergii using a 1 mL sterile syringe. In the WSSV-challenged group, approximately 3.2 107 copies of WSSV particles were injected into each prawn. The methods of preparation and
121
quantification of the viral inocula were based on a previous paper [25]. Prawns in the control group were injected with the same volume of phosphate-buffered saline (PBS; 0.14 M NaCl, 3 mM KCl, 8 mM Na2HPO4, and 1.5 mM KH2PO4; pH 7.4). The hepatopancreas from the prawns were collected at 2, 6, 12, 24, and 48 h challenge. Hemolymph was collected from healthy prawns (untreated) by mixing 1/10 volume of anticoagulant buffer (0.14 M NaCl, 0.1 M glucose, 30 mM trisodium citrate, 26 mM citric acid, and 10 mM ethylenediaminetetraacetic acid; pH 4.6), after which it was centrifuged immediately at 2000 rpm for 10 min at 4 C to isolate the hemocytes. Other tissues, such as the heart, hepatopancreas, gills, stomach, and intestines, were also collected from untreated prawns for RNA extraction. 2.3. RNA extraction and cDNA synthesis Tissue samples were homogenized with a mortar and pestle in the presence of liquid nitrogen. Total RNA was isolated from the aforementioned tissues using an RNApure High-purity Total RNA Rapid Extraction Kit (Spin-column; Bioteke, Beijing, China) based on the protocol of the manufacturer. RNA concentration was determined by measuring the absorbance at 260 nm on a spectrophotometer. The first-strand cDNA synthesis of different samples for qRT-PCR analysis was obtained using the PrimeScript® First Strand cDNA Synthesis Kit (Takara, Dalian, China) with the Oligo(dT) Primer. The cDNA samples were subsequently used for the determination of Rab gene expression by qRT-PCR. 2.4. Tissue distribution and expression pattern analysis by qRT-PCR qRT-PCR was conducted to investigate the tissue distributions of 11 Rabs at the mRNA level in the heart, hemocytes, hepatopancreas, gills, stomach, and intestines of M. rosenbergii using 11 pairs of gene-specific primers (MrRab1A-RT-F and MrRab1A-RT-R; MrRab5C-RT-F and MrRab5C-RT-R; MrRab6A-RT-F and MrRab6A-RTR; MrRab7A-RT-F and MrRab7A-RT-R; MrRab9A-RT-F and MrRab9ART-R; MrRab10-RT-F and MrRab10-RT-R; MrRab11A-RT-F and MrRab11A-RT-R; MrRab14-RT-F and MrRab14-RT-R; MrRab18-RT-F and MrRab18-RT-R; MrRab27A-RT-F and MrRab27A-RT-R; and MrRab32-RT-F and MrRab32-RT-R). The expression pattern of MrRab genes in the hepatopancreas of M. rosenbergii upon WSSV and V. parahaemolyticus challenge at 2, 6, 12, 24, and 48 h was investigated to study their possible roles in M. rosenbergii innate immunity. qRT-PCR was conducted using 2 SYBR Premix Ex Taq Kit (Takara, Dalian, China). The reaction was performed in a total volume of 10 mL, containing 5 mL of 2 SYBR Premix Ex Taq™, 1 mL cDNA, and 2 mL of each forward and reverse primer (1 mmol/L). The thermal cycling profile used was 95 C for 3 min, 40 cycles of 95 C for 15 s, and 60 C for 30 s. Three replicated experiments were also used to ensure the validity and accuracy of the experimental results. The detailed methods are based on our previous study [26]. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was amplified as internal standardization using the primers MrGAPDH-RT-F and MrGAPDH-RT-R. The primers used in qRT-PCR are presented in Table 1. 3. Results 3.1. Identification of Rab GTPases in M. rosenbergii A total of 11 MrRab GTPase genes were identified from M. rosenbergii (Supplementary Fig S1). Based on the BLASTX results, the 11 Rab genes were named MrRab1A, MrRab5C, MrRab6A, MrRab7A, MrRab9A, MrRab10, MrRab11A, MrRab14, MrRab18, MrRab27A, and MrRab32 respectively. The complete cDNA
122
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
MrRabs have been submitted to GenBank. For detailed information see Table 2.
Table 1 Sequences of the primers used in the study. Primers name
Sequences (50 -30 )
MrRab1A- F MrRab5C-F MrRab6A-F MrRab7A-F MrRab9A-F MrRab10-F MrRab11A-F MrRab14-F MrRab18-F MrRab27A-F MrRab32-F MrRab1A-RT-F UPM Long Short 50 -CDS Primer A SMARTerⅡA oligo 30 -CDS primer A MrRab1A-RT-R MrRab5C-RT-F MrRab5C-RT-R MrRab6A-RT-F MrRab6A-RT-R MrRab7A-RT-F MrRab7A-RT-R MrRab9A-RT-F MrRab9A-RT-R MrRab10-RT-F MrRab10-RT-R MrRab11A-RTF MrRab11A-RTR MrRab14-RT-F MrRab14-RT-R MrRab18-RT-F MrRab18-RT-R MrRab27A-RTF MrRab27A-RTR MrRab32-RT-F MrRab32-RT-R Mr-GAPDH-RTF Mr-GAPDH-RTR
GGGACACGGCTGGTCAAGAACGAT GTCTAGCTCCAATGTACTACC GTACTTGGAGGACAGAACGGTGAGG CTGCTGGTCAAGAGAGATTTC CTCGGAGATGGAGGAGTTGGGAAAT TTCCAAAGGAGAAGGGAGAAGCGATT GAGTTTGCCACCAGAAGCATAGAGG GTAACAAGGTCATACTACCGTGGCGCTG GCTAGCAATTTGGGACACAGC CACAGCATTTTATCGGGATGC CAGCCAACATTATCGAGCGAC GAAACCTCAGCTAAGAATGCTACCA CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC T25VN AAGCAGTGGTATCAACGCAGAGTACXXXXX AAGCAGTGGTATCAACGCAGAGTAC(T)30VN AGCTTCAACAGGAGCACTAGGACTA TAGCTCCAATGTACTACCGGGGT CCTTTTCGTGGCTAAATCTGCTT CGTGATTCTACTGTTGCTGTTGTTG CCCTCTTCTGTGGATACCTGTCTTT AGTGGTGTCACAGTAAAAACGAGGT GCGTCTTGCTTTGTCTTGTTATCAT TGAAAGAAAGGTAACCACTGAAGAA GTCTCAAGCACATCATAAAGGAAGT CTCTTCAGATTTTCAGATGACGCTT TTATTCCCATAGCCCCTCTGTAGTA AGCATAGAGGTGGATGGCAAAAC CTCCCCTGTAGTAGGCTGAAGTG AGAGAATGGCTTGATGTTTGTGG CGACCTGGCTGAGTTGGTTTAT ACAAAATTGACAAGGAGAAAAGAGA AAAGTCCTGGAGTTTGAATGATC GCTTCCTGCTCCTGTTTGATTTG TTCCTTTGCTCGCTGCTCTGAT GGCACTGGCAAGACCTCTATCAT GAACTTTGAGGGCGAAATCCAC TGCCGCCCAGAACATCATT TCGTCTTCGGTGTAGCCCA
3.2. Multiple alignments and phylogenetic analysis Based on the multiple alignment analysis, these 11 Rabs from M. rosenbergii are low conserved (Supplementary Fig. S2). All these 11 Rab proteins have a RAB domain. Phylogenetic tree was constructed using the NJ method to evaluate the molecular evolution relationships of the 11 Rab proteins of M. rosenbergii and other Rab GTPases (Fig. 1). In the phylogenetic tree, 11 MrRabs were clustered into different groups. MrRab1A, together with MmRab1A and MmRab1B from Mus musculus, belongs to one cluster. MrRab5C, together with Rab5 from Litopenaeus vannamei, M. musculus, D. melanogaster, and Anopheles gambiae, belongs to one group. MrRab6A, together with Rab6A and Rab6B from M. japonicus and M. musculus, belongs to one clade. MrRab7A, MrRab9A, Rab7s from P. monodon, Fenneropenaeus chinensis, and L. vannamei, Rab9A and Rab9B from M. musculus were clustered into 1 group. MrRab10 and Rab10 from M. musculus and D. melanogaster belong to 1 cluster. MrRab11A, together with Rab11A and Rab11B from M. musculus, belongs to 1 group. MrRab14 has a close relationship with Rab14 from M. musculus and D. melanogaster. MrRab18, together with Rab18 from Danio rerio and M. musculus, belongs to 1 group. MrRab27A, together with Rab27A and Rab27B from M. musculus, belongs to one group. MrRab32, Rab32 from Culex quinquefasciatus and Helicoverpa armigera and Rab38 from M. musculus belong to 1 group. 3.3. Tissue distributions of the 11 Rab genes qRT-PCR was used to investigate the tissue distributions of 11 MrRab transcripts. Results showed that every MrRab was expressed in all tested tissues. In detail, MrRab6A, MrRab9A, and MrRab32 were mainly expressed in the intestine and hepatopancreas, with lower levels of expressions in the heart, hemocytes, gills, and stomach. The transcripts of MrRab7A, MrRab11A, MrRab18A, and MrRab27 were detected mainly in the intestine and hemocytes. Meanwhile, MrRab1A and MrRab5C were primarily expressed in the intestine, gills, and heart. Other Rabs, including MrRab10 and MrRab14, were mainly expressed in the hemocytes and hepatopancreas, rather than in the intestine (Fig. 2). 3.4. Expression analysis of 11 Rab genes after WSSV or bacterial challenge
sequences of the 11 MrRabs were 910, 1,672, 1,489, 1,130, 1,059, 1,347, 1,220, 769, 958, and 908 bp respectively. These 11 MrRab genes encoded proteins of 206, 212, 211, 205, 210, 203, 204, 215, 206, 216, and 225 amino acids respectively. The sequences of
Table 2 Summary of 11 Rab GTPase genes identified in M. rosenbergii. Species
Gene name
GenBank accession number
M. rosenbergii
MrRab1A MrRab5C MrRab6A MrRab7A MrRab9A MrRab10 MrRab11A MrRab14 MrRab18 MrRab27A MrRab32
KP216755 KP216756 KP216757 KP216758 KP216759 KP216760 KP216761 KP216762 KP216763 KP216764 KP216765
The expression levels of the 11 MrRabs in the hepatopancreas of freshwater prawn upon challenge with WSSV or V. parahaemolyticus were observed using qRT-PCR methods to investigate the roles of Rab genes from M. rosenbergii in anti-WSSV and antibacterial innate immunity. In general, all of the Rab genes (including MrRab1A, MrRab5C, MrRab6A, MrRab7A, MrRab9A, MrRab10, MrRab11A, MrRab14, MrRab18, MrRab27A, and MrRab32) were upregulated in the tested tissue (Fig. 3). After the WSSV challenge, the expressions of all MrRabs (except MrRab11A) in the hepatopancreas showed no significant changes from 2 h to 12 h, reached the highest level at 24 h, and then slightly downregulated at 48 h MrRab11A was initially upregulated at 2 h, reached the highest level at 6 h, and finally declined at 24 h. Compared with the transcripts of MrRabs challenged with WSSV, MrRabs were relatively stable after V. parahaemolyticus challenge. The relative expression levels of MrRabs (except MrRab11A, MrRab14, and MrRab18) were changed at ± 2-fold compared with the blank group. MrRab11A, MrRab14, and MrRab18 reached the highest level at 24, 48, and 6 h (6.89-fold, 3.80-fold, and 3.72-fold; p < 0.05) post
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
123
Fig. 1. Phylogenetic analysis of eleven MrRabs and other representative Rab GTPases.
challenge, respectively. In addition, the transcripts of all MrRabs in the hepatopancreas did not change evidently after PBS challenge from 2 h to 48 h. 4. Discussion In this study, 11 Rab GTPases, designated as MrRab1A, MrRab5C, MrRab6A, MrRab7A, MrRab9A, MrRab10, MrRab11A, MrRab14, MrRab18, MrRab27A, and MrRab32, were identified from the hepatopancreas transcriptome of M. rosenbergii for the first time. As we know, the hepatopancreas is the primary site of production of immune response factors in crustaceans. The hepatopancreas not only initiates humoral immune response in shrimps but also contains highly specialized cells and phagocytes that function in cellular immune response [27,28]. Based on the sequence analysis, we determined that the RAB domain was located in all MrRab proteins. The RAB domain is the common structure of Rab-like small GTPases [29]. Multiple alignments showed that the RAB domains of these 11 MrRabs were not conserved. Different types of Rab proteins are less conserved. Phylogenetic analysis showed that these 11 MrRabs were divided into different groups. It could be speculated that different Rabs of the same species might have different roles. Rab1 can control transport from the ER to the Golgi [30]. Rab5 is involved in the endocytic pathway by regulating early endosome fusion and caveolar vesicle targeting to early endosomes [31e33]. Rab6s in mammals are required for retrograde transport, including transport from the Golgi to the ER (Rab6A and Rab6B) and multidrug resistance regulation (Rab6C) [34e36]. Rab7A facilitates the transport of
the epidermal growth factor receptor complex from the early endosomes to the late endosomes [37,38]. Rab9 mediates lysosomal enzyme trafficking and cycling of molecules from the late endosomes to the trans-Golgi network [39,40]. Rab11 is an important transport regulator in the endocytic pathway [41]. Rab3 can control the Ca2þ-dependent secretion and dense-core vesicle docking to the plasma membrane. Rab27 is the interaction protein of Rab3 [42,43]. So, in the giant freshwater prawns, different Rabs might have diverse function. Tissue distributions of MrRabs were detected at the mRNA level to determine the possible function of the 11 MrRabs in M. rosenbergii. MrRabs showed extensive distribution in different tissues of the shrimp. A relatively higher expression level of the MrRabs was observed in the intestine, hemocytes, and hepatopancreas. Similarly, the PjRab gene from P. japonicus was ubiquitously expressed in all test shrimp tissues, including the hemolymph, hepatopancreas, muscle, gill, heart, and intestine [18]. The mRNA transcripts of EsRab-1 and EsRab-3 from Eriocheir sinensis showed the highest expression levels in the hepatopancreas and marginal expression levels in other tissues, including the hemocytes, muscle, gonad, gills, and heart [23]. The intestine is an organ for digestion and absorption, which will encounter a variety of microbes, including pathogens. Hemocytes are one of the most important tissues involved in crustacean immune response, including phagocytosis [44,45], encapsulation [46], and storage and release of the proPO system [47]. The hepatopancreas, equivalent to the fat body of insects and the liver of mammals, plays an important function in the humoral immune responses of crustaceans. Many immune-related genes have been detected at high transcription
124
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
Fig. 2. Tissue distributions of eleven Rab GTPases in heart, hemocytes, hepatopancreas, gill, stomach and intestine of the healthy M. rosenbergii.
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
Fig. 2. (continued).
125
126
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
Fig. 3. qRT-PCR analysis of eleven MrRabs in the hepatopancreas of M. rosenbergii at 0, 2, 6, 12, 24, and 48 h after WSSV and V. parahaemolyticus challenge. The mRNA levels of MrRabs were analyzed and standardized according to the GAPDH mRNA levels. Asterisks indicate significant differences (*P < 0.05, **P < 0.01, ***P < 0.001) compared with values of the control. Error bars represent ± S.D. of the three independent PCR amplifications and quantifications.
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
Fig. 3. (continued).
127
128
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
Fig. 3. (continued).
levels in the hepatopancreas [48]. Thus, considering that Rab proteins are implicated in phagosome formation and maturation by regulating membrane transport from recycling endosomes to forming the phagocytic cup [49,50], abundant expression of MrRabs in the intestine, hemocytes, and hepatopancreas might be closely related to their biological function in cellular immune response in shrimp. In shrimps, most recent reports have focused only on the Rab GTPases, which are also involved in WSSV infection, but not their effectors. Vibriosis is the major disease caused by bacteria in the genus Vibrio [51]. The outbreaks of this disease have led to high mortality rates of M. rosenbergii. As such, qRT-PCR was conducted to determine the function of these 11 MrRabs during WSSV and V. parahaemolyticus infection. In our study, MrRab mRNA transcripts in the hepatopancreas were significantly expressed at various time points after infection with V. parahaemolyticus or WSSV, which may
indicate their roles in antibacterial and anti-WSSV innate immunity. Transcription of PjRab (Rab6A) from P. japonicus in WSSVresistant shrimp was observed to be significantly upregulated, indicating that the PjRab gene was involved in shrimp immune response against virus infection [18]. By contrast, the Rap GTPase from the Chinese white shrimp F. chinensis was reported to be upregulated upon Vibrio harveyi (bacteria) and WSSV infections, which may indicate its probable roles in anti-WSSV and antibacterial immunity [52]. Moreover, in vitro pull-down assays indicated that Rap GTPases interact with VP28, the envelope protein of WSSV [52]. Considering the RNAi-mediated gene knockdown of Rab7 in P. monodon, we observed that PmRab7 could bind to WSSV via VP28, which interferes with viral binding to the cell surface receptor [20,21]. Depletion of PmTBC1D20, a Rab GTPase-activating protein transcript in the black tiger shrimp P. monodon, by dsRNA
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
interference also led to a decrease in the level of transcripts of three WSSV genes (VP28, ie1, and wsv477) [53]. In this study, different members of Rab GTPases in the giant freshwater prawn M. rosenbergii were identified for the first time. The low conservation of different kinds of Rab GTPases from the giant freshwater prawns indicated that the evolution of gene diversification occured in M. rosenbergii. The MrRab genes were significantly induced by WSSV or bacterial infection, which indicated their roles in innate immunity in M. rosenbergii. Acknowledgments The current study was supported by the National Natural Science Foundation of China (Grant Nos. 31101926), the National Natural Science Foundation of Jiangsu Province (BK20131401), Natural Science Fund of Colleges and universities in Jiangsu Province (13KJB240002), High level talents in Nanjing Normal University Foundation (2012104XGQ0101), the major project of Jiangsu Province University Natural Science (14KJA240002), and the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2014.12.021. References [1] Rink J, Ghigo E, Kalaidzidis Y, Zerial M. Rab conversion as a mechanism of progression from early to late endosomes. Cell 2005;122:735e49. [2] Zerial M, McBride H. Rab proteins as membrane organizers. Nat Rev Mol Cell Biol 2001;2:107e17. [3] Segev N. Ypt and Rab GTPases: insight into functions through novel interactions. Curr Opin Cell Biol 2001;13:500e11. [4] Pfeffer SR. Rab GTPases: specifying and deciphering organelle identity and function. Trends Cell Biol 2001;11:487e91. [5] Wang RJ, Zhang Y, Liu SK, Li C, Sun LY, Bao LS, et al. Analysis of 52 Rab GTPases from channel catfish and their involvement in immune responses after bacterial infections. Dev Comp Immunol 2004;45:21e34. [6] Ohbayashi N, Fukuda M. Role of Rab family GTPases and their effectors in melanosomal logistics. J Biol Chem 2012;151:343e51. [7] Exton JH. Small GTPases minireview series. J Biol Chem 1998;273:19923. [8] Novick P, Field C, Schekman R. Identification of 23 complementation groups required for post-translational events in the yeast secretory pathway. Cell 1980;21:205e15. [9] Salminen A, Novick PJ. Aras-like protein is required for a post-Golgi event in yeast secretion. Cell 1987;49:527e38. [10] Takai Y, Sasaki T, Matozaki T. Small GTP-binding proteins. Physiol Rev 2001;81:153e208. [11] Diekmann Y, Seixas E, Gouw M, Tavares-Cadete F, Seabra MC, Pereira-Leal JB. Thousands of rab GTPases for the cell biologist. PLoS Comput Biol 2011;7: e1002217. [12] Bock JB, Matern HT, Peden AA, Scheller RH. A genomic perspective on membrane compartment organization. Nature 2001;409:839e41. [13] Pereira-Leal JB, Seabra MC. Evolution of the Rab family of small GTP-binding proteins. J Mol Biol 2001;313:889e901. [14] Eoin EK, Conor PH, Bruno G, Mary WM. The Rab family of proteins: 25 years on. Biochem Soc Trans 2012;40:1337e47. [15] Touchot N, Chardin P, Tavitian A. Four additional members of the ras gene superfamily isolated by an oligonucleotide strategy: molecular cloning of YPTrelated cDNAs from a rat brain library. Proc Natl Acad Sci 1987;84:8210e4. [16] Hashim S, Mukherjee K, Raje M, Basu SK, Mukhopadhyay A. Live Salmonella modulate expression of Rab proteins to persist in a specialized compartment and escape transport to lysosomes. J Biol Chem 2000;275:16281e8. [17] Scianimanico S, Desrosiers M, Dermine JF, Meresse S, Descoteaux A, Desjardins M. Impaired recruitment of the small GTPase rab7 correlates with the inhibition of phagosome maturation by Leishmania donovani promastigotes. Cell Microbiol 1999;1:19e32. [18] Wu WL, Zhang XB. Characterization of a Rab GTPase up-regulated in the shrimp Peneaus japonicus by virus infection. Fish Shellfish Immunol 2007;23: 438e45. [19] Wu W, Zong R, Xu J, Zhang X. Antiviral phagocytosis is regulated by a novel Rab-dependent complex in shrimp Penaeus japonicus. J Proteome Res 2007;7: 424e31.
129
[20] Sritunyalucksana K, Wannapapho W, Lo CF, Flegel TW. PmRab7 is a VP28binding protein involved in white spot syndrome virus infection in shrimp. J Virol 2006;80:10734e42. [21] Ongvarrasopone C, Chanasakulniyom M, Sritunyalucksana K, Panyim S. Suppression of PmRab7 by dsRNA inhibits WSSV or YHV infection in shrimp. Mar Biotechnol Ny 2008;10:374e81. [22] Zong R, Wu W, Xu J, Zhang X. Regulation of phagocytosis against bacterium by Rab GTPase in shrimp Marsupenaeus japonicus. Fish Shellfish Immunol 2008;25:258e63. [23] Wang LL, Li L, Wang LL, Yang JL, Wang JJ, Zhou Z, et al. Two Rab GTPases, EsRab-1 and EsRab-3, involved in anti-bacterial response of Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol 2013;35:1007e15. [24] Kumar S, Nei M, Dudley J, Tamura K. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief Bioinform 2008;9: 299e306. [25] Wang S, Zhao XF, Wang JX. Molecular cloning and characterization of the translationally controlled tumor protein from Fenneropenaeus chinensis. Mol Biol Rep 2008;36:1683e93. [26] Huang Y, An L, Hui KM, Ren Q, Wang W. An LDLa domain-containing C-type lectin is involved in the innate immunity of Eriocheir sinensis. Dev Comp Immunol 2014;42:333e44. 2014. [27] Lee SY, Wang R, Soderhall K. A lipopolysaccharide- and b-1,3-glucan binding protein from hemocytes of the freshwater crayfish Pacifastacus leniusculus. Purification, characterization and cDNA cloning. J Biochem 2000;275:1337e43. [28] Sritunyalucksana K, Wongsuebsantati K, Johansson MW, Soderhall K. Peroxinectin, a cell adhesive protein associated with the proPO system from the black tiger shrimp, Penaeus monodon. Dev Comp Immunol 2001;25:353e63. [29] Wu M, Wang T, Loh E, Hong W, Song H. Structural basis for recruitment of RILP by small GTPase Rab7. EMBO J 2005;24:1491e501. [30] Tisdale EJ, Bourne JR, Khosravi-Far R, Der CJ, Balch W. GTP-binding mutants of rab1 and rab2 are potent inhibitors of vesicular transport from the endoplasmic reticulum to the Golgi complex. J Cell Biol 1992;119:749e61. [31] Arnett AL, Bayazitov I, Blaabjerg M, Fang L, Zimmer J, Baskys A. Antisense oligonucleotide against GTPase Rab5b inhibits metabotropic agonist DHPGinduced neuroprotection. Brain Res 2004;1028:59e65. [32] Barbieri MA, Roberts RL, Gumusboga A, Highfield H, Alvarez-Dominguez C, Wells A, et al. Epidermal growth factor and membrane trafficking Egf receptor activation of endocytosis requires Rab5a. J Cell Biol 2000;151:539e50. [33] Pelkmans L, Bürli T, Zerial M, Helenius A. Caveolin-stabilized membrane domains as multifunctional transport and sorting devices in endocytic membrane traffic. Cell 2004;118:767e80. [34] Schoebel S, Blankenfeldt W, Goody RS, Itzen A. High-affinity binding of phosphatidylinositol 4-phosphate by Legionella pneumophila DrrA. EMBO Rep 2010;11:598e604. [35] Schoebel S, Oesterli LK, Blankenfeldt W, Goody RS, Itzen A. RabGDI displacement by DrrA from Legionella is a consequence of its guanine nucleotide exchange activity. Mol Cell 2009;36:1060e72. [36] Suh HY, Lee DW, Lee KH, Ku B, Choi SJ, Woo JS, et al. Structural insights into the dual nucleotide exchange and GDI displacement activity of SidM/DrrA. EMBO J 2009;29:496e504. [37] Feng Y, Press B, Chen W, Zimmerman J, Wandinger-Ness A. Expression and properties of Rab7 in endosome function. Methods Enzymol 2001;329:175e87. [38] Vonderheit A, Helenius A. Rab7 associates with early endosomes to mediate sorting and transport of Semliki forest virus to late endosomes. PLoS Biol 2005;3:e233. [39] Ganley IG, Carroll K, Bittova L, Pfeffer S. Rab9 GTPase regulates late endosome size and requires effector interaction for its stability. Mol Biol Cell 2004;15: 5420e30. [40] Lombardi D, Soldati T, Riederer M, Goda Y, Zerial M, Pfeffer S. Rab9 functions in transport between late endosomes and the trans Golgi network. EMBO J 1993;12:677e82. [41] Wilcke M, Johannes L, Galli T, Mayau V, Goud B, Salamero J. Rab11 regulates the compartmentalization of early endosomes required for efficient transport from early endosomes to the trans-Golgi network. J Cell Biol 2000;151:1207e20. [42] Rupnik M, Kreft M, Nothias F, Grilc S, Bobanovic LK, Johannes L, et al. Distinct role of Rab3A and Rab3B in secretory activity of rat melanotrophs. Am J Physiol Cell Physiol 2007;292:C98e105. [43] Tsuboi T, Fukuda M. Rab3A and Rab27A cooperatively regulate the docking step of dense-core vesicle exocytosis in PC12 cells. J Cell Sci 2006;119:2196e203. € derh€ [44] So all K, Smith VJ, Johansson MW. Exocytosis and uptake of bacteria by isolated haemocyte populations of two crustaceans: evidence for cellular cooperation in the defence reactions of arthropods. Cell Tissue Res 1986;245: 43e9. € derha €ll K. Induction of degranulation and lysis of haemocytes in [45] Smith VJ, So the freshwater crayfish, Astacus astacus by components of the prophenoloxidase activating system in vitro. Cell Tissue Res 1983;233:295e303. €derha €ll K. The 76 kD cell-adhesion factor [46] Kobayashi M, Johansson MW, So from crayfish haemocytes promotes encapsulation in vitro. Cell tissue Res 1990;260:13e8. € derha €ll K. Cellular immunity in crustaceans and the proPO [47] Johansson MW, So system. Parasitol Today 1989;5:171e6. [48] Gross PS, Bartlett TC, Browdy CL, Chapman RW, Warr GW. Immune gene discovery by expressed sequence tag analysis of haemocytes and hepatopancreas in the Pacific White Shrimp, Litopenaeus vannamei, and the Atlantic White Shrimp, L. setiferus. Dev Comp Immunol 2001;25:565e77.
130
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
[49] Duclos S, Desjardins M. Subversion of a young phagosome: the survival strategies of intracellular pathogens. Cell Microbiol 2000;2:365e77. [50] Rupper A, Cardelli J. Regulation of phagocytosis and endo-phagosomal trafficking pathways in Dictyostelium discoideum. BBA-GEN Subj 2001;1525:205e16. [51] Jiravanichpaisal P, Miyazaki T, Limsuwan C. Histopathology, biochemistry, and pathogenicity of Vibrio harveyi infecting black tiger prawn Penaeus monodon. J Aquat Anim Health 1994;6:27e35.
[52] Ren Q, Zhou J, Jia YP, Wang XW, Zhao XF, Wang JX. Cloning and characterization of Rap GTPase from the Chinese white shrimp Fenneropenaeus chinensis. Dev Comp Immunol 2012;36(1):247e52. [53] Yingvilasprasert W, Supungul P, Tassanakajon A. PmTBC1D20, a Rab GTPaseactivating protein from the black tiger shrimp, Penaeus monodon, is involved in white spot syndrome virus infection. Dev Comp Immunol 2014;42: 302e10.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Identification and function of 11 Rab GTPases in giant freshwater prawn Macrobrachium rosenbergii Ying Huang, Qian Ren* Jiangsu Key Laboratory for Biodiversity & Biotechnology and Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 24 October 2014 Received in revised form 15 December 2014 Accepted 16 December 2014 Available online 24 December 2014
Rab GTPases, members of the Ras-like GTPase superfamily, are central elements in endocytic membrane trafficking. However, little is known of the Rab genes in the giant freshwater prawn Macrobrachium rosenbergii. In this study, 11 Rab genes were identified from M. rosenbergii. All MrRabs have a RAB domain. Phylogenetic analysis showed that these 11 MrRabs were divided into different groups. The MrRab genes were ubiquitously expressed in heart, hemocytes, hepatopancreas, gills, stomach, and intestines. Real-time polymerase chain reaction revealed that the MrRab genes were significantly upregulated by white spot syndrome virus (WSSV) in the prawns, indicating that MrRabs might play an important role in innate immune response against WSSV. Moreover, after challenge with Vibrio parahaemolyticus, the expression levels of all MrRabs in the hepatopancreas were also upregulated, which might indicated the involvement of MrRabs in prawns antibacterial immunity. In all, these preliminary results showed that MrRabs were involved in innate immunity of M. rosenbergii. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Macrobrachium rosenbergii Rab GTPases Anti-WSSV Antibacterial Innate immunity
1. Introduction Rab GTPase, a monophyletic clade of the Ras-like small GTPase superfamily (Ras, Rho/Rac/Cdc42, Ran, Sar/Arf, and Rab) with a molecular mass of 20 kDae40 kDa, is well known for its control function in intracellular membrane trafficking in all eukaryotic cells [1e4]. Rab GTPase is an important component of the endomembrane system, which includes the endoplasmic reticulum (ER), Golgi, endosomes, lysosomes, nucleus, plasma membrane, mitochondria, and centrioles [5]. Members in this family function as “molecular switches” that shuttle between a guanosine diphosphate (GDP)-bound inactive conformation (cytosolic localization) and a guanosine triphosphate (GTP)-bound active conformation (membranous localization) [6]. In the GTP-bound state, Rab interacts with various effector proteins that function in the regulation of many key steps in membrane trafficking, including vesicle formation, vesicle motility, membrane remodeling, vesicle docking, membrane fusion, and multiple stages of intracellular transport processes [2,3,7]. Moreover, Rab GTPases are essential for some important biological processes, including growth and
* Corresponding author. Tel.: þ86 25 85891955; fax: þ86 25 85891526. E-mail address: [email protected] (Q. Ren). http://dx.doi.org/10.1016/j.fsi.2014.12.021 1050-4648/© 2014 Elsevier Ltd. All rights reserved.
differentiation, morphogenesis, cell division and motility, cytokinesis, and vesicle trafficking [7]. Rab proteins were first described in the yeast Saccharomyces cerevisiae [8,9]. Subsequently, substantial evidence was accumulated to support the role of Rab proteins in vesicle trafficking from yeast to humans [10]. To date, more than 60 distinct Rab proteins have been discovered from various species. The number of Rab proteins varies depending on the species [11]. In humans, 63 Rab proteins were identified, whereas 11, 26, and 52 Rab GTPases were identified in the genomes of S. cerevisiae, Drosophila melanogaster, and Ictalurus punctatus, respectively [5,12,13]. The difference in the number of Rab proteins is mainly caused by gene duplications, leading to the presence of paralogs [5]. Orthologous Rab proteins from various species, as well as their paralogs, are structurally highly conserved [14,15]. In mammals, previous reports indicated that Rab GTPases play important roles in the formation and maturation of the phagosome and the clearance of pathogens in innate immunity [16,17]. In recent years, more Rab proteins have also been found to be involved in crustacean innate immunity, which mainly focused on antiviral immunity and antibacterial activity [18e23]. For example, mRNA expression of the Rab gene in penaeid shrimp Penaeus japonicus (PjRab) was upregulated after white spot syndrome virus (WSSV) infection [18]. The Rab protein in P. japonicus could interact with
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
envelope protein VP466 of WSSV as an intracellular virus recognition protein utilized by the host. Then, the Rab protein could regulate shrimp hemocytic phagocytosis of WSSV by interacting with b-actin and tropomyosin [19]. The GTP-binding protein PmRab7 in Penaeus monodon directly interacts with the WSSV major structural protein VP28, which is involved in systemic infection of WSSV [20]. WSSV or yellow head virus infection is inhibited in P. monodon when PmRab7 is suppressed with doublestranded RNA (dsRNA) [21]. Moreover, phagocytosis against the bacterium Vibrio parahaemolyticus could be inhibited in the shrimp Marsupenaeus japonicus when the Rab gene (PjRab) is silenced by sequence-specific siRNA [22]. After the crabs are challenged by Vibrio anguillarum, the expression levels of EsRab-1 and EsRab-3 in hemocytes are significantly upregulated, indicating that they are involved in crab innate immunity against bacteria [23]. Thus far, systematic analyses of the Rab families have not been reported in Macrobrachium rosenbergii. In this study, we conducted an analysis of the complete set of 11 Rab GTPases in M. rosenbergii. Their orthologies and paralogies were established through phylogenetic analysis. Their tissue distributions and temporal responses to WSSV and bacteria challenge were analyzed using quantitative real-time polymerase chain reaction (qRT-PCR). 2. Materials and methods 2.1. Identification of Rab genes and sequence analysis Eleven expressed sequence tags (ESTs) in M. rosenbergii similar to Rab genes were obtained from hepatopancreas transcriptome data (data unpublished). The 30 -RACE-Ready cDNA was synthesized following the instructions of Clontech SMARTer™ RACE cDNA Amplification Kit from Takara (Dalian, China) with 30 -CDS Primer A. Gene-specific forward primers (MrRab1A-F, MrRab5C-F, MrRab6A-F, MrRab7A-F, MrRab9A-F, MrRab10-F, MrRab11A-F, MrRab14-F, MrRab18-F, MrRab27A-F, and MrRab32-F) were designed based on the ESTs. The 30 fragments of MrRabs were cloned using genespecific forward primers and Universal Primer A Mix. An Advantage 2 PCR Kit from Takara (Dalian, China) was used for gene cloning. PCR reaction was conducted using the following conditions: 5 cycles at 94 C for 30 s and 72 C for 2 min; 5 cycles at 94 C for 30 s, 70 C for 30 s, and 72 C for 2 min; and 20 cycles at 94 C for 30 s, 68 C for 30 s, and 72 C for 2 min. The full lengths of MrRabs were obtained by overlapping the ESTs and 30 fragments. Translations of cDNAs and predictions of the deduced proteins were conducted using ExPASy (http://www.au.expasy.org/). The protein sequences of MrRabs were used in the phylogenetic analysis. Phylogenetic trees were constructed using MEGA software [24]. 2.2. Experimental animals and immune challenge in prawns Adult M. rosenbergii (approximately 15 g each) were purchased from an aquaculture market in Nanjing, Jiangsu Province, China. The prawns were acclimatized under laboratory conditions in freshwater tanks at room temperature (23 ± 2 C) for 1 week before processing. One hundred prawns were utilized for the immune challenge experiment. The prawns were randomly divided into a control group and two experimental groups, namely, the WSSV- and V. parahaemolyticus-challenged groups. Each group contained 30 individuals. In the V. parahaemolyticus-challenged group, approximately 3 107 cells were injected into the abdominal segment of M. rosenbergii using a 1 mL sterile syringe. In the WSSV-challenged group, approximately 3.2 107 copies of WSSV particles were injected into each prawn. The methods of preparation and
121
quantification of the viral inocula were based on a previous paper [25]. Prawns in the control group were injected with the same volume of phosphate-buffered saline (PBS; 0.14 M NaCl, 3 mM KCl, 8 mM Na2HPO4, and 1.5 mM KH2PO4; pH 7.4). The hepatopancreas from the prawns were collected at 2, 6, 12, 24, and 48 h challenge. Hemolymph was collected from healthy prawns (untreated) by mixing 1/10 volume of anticoagulant buffer (0.14 M NaCl, 0.1 M glucose, 30 mM trisodium citrate, 26 mM citric acid, and 10 mM ethylenediaminetetraacetic acid; pH 4.6), after which it was centrifuged immediately at 2000 rpm for 10 min at 4 C to isolate the hemocytes. Other tissues, such as the heart, hepatopancreas, gills, stomach, and intestines, were also collected from untreated prawns for RNA extraction. 2.3. RNA extraction and cDNA synthesis Tissue samples were homogenized with a mortar and pestle in the presence of liquid nitrogen. Total RNA was isolated from the aforementioned tissues using an RNApure High-purity Total RNA Rapid Extraction Kit (Spin-column; Bioteke, Beijing, China) based on the protocol of the manufacturer. RNA concentration was determined by measuring the absorbance at 260 nm on a spectrophotometer. The first-strand cDNA synthesis of different samples for qRT-PCR analysis was obtained using the PrimeScript® First Strand cDNA Synthesis Kit (Takara, Dalian, China) with the Oligo(dT) Primer. The cDNA samples were subsequently used for the determination of Rab gene expression by qRT-PCR. 2.4. Tissue distribution and expression pattern analysis by qRT-PCR qRT-PCR was conducted to investigate the tissue distributions of 11 Rabs at the mRNA level in the heart, hemocytes, hepatopancreas, gills, stomach, and intestines of M. rosenbergii using 11 pairs of gene-specific primers (MrRab1A-RT-F and MrRab1A-RT-R; MrRab5C-RT-F and MrRab5C-RT-R; MrRab6A-RT-F and MrRab6A-RTR; MrRab7A-RT-F and MrRab7A-RT-R; MrRab9A-RT-F and MrRab9ART-R; MrRab10-RT-F and MrRab10-RT-R; MrRab11A-RT-F and MrRab11A-RT-R; MrRab14-RT-F and MrRab14-RT-R; MrRab18-RT-F and MrRab18-RT-R; MrRab27A-RT-F and MrRab27A-RT-R; and MrRab32-RT-F and MrRab32-RT-R). The expression pattern of MrRab genes in the hepatopancreas of M. rosenbergii upon WSSV and V. parahaemolyticus challenge at 2, 6, 12, 24, and 48 h was investigated to study their possible roles in M. rosenbergii innate immunity. qRT-PCR was conducted using 2 SYBR Premix Ex Taq Kit (Takara, Dalian, China). The reaction was performed in a total volume of 10 mL, containing 5 mL of 2 SYBR Premix Ex Taq™, 1 mL cDNA, and 2 mL of each forward and reverse primer (1 mmol/L). The thermal cycling profile used was 95 C for 3 min, 40 cycles of 95 C for 15 s, and 60 C for 30 s. Three replicated experiments were also used to ensure the validity and accuracy of the experimental results. The detailed methods are based on our previous study [26]. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was amplified as internal standardization using the primers MrGAPDH-RT-F and MrGAPDH-RT-R. The primers used in qRT-PCR are presented in Table 1. 3. Results 3.1. Identification of Rab GTPases in M. rosenbergii A total of 11 MrRab GTPase genes were identified from M. rosenbergii (Supplementary Fig S1). Based on the BLASTX results, the 11 Rab genes were named MrRab1A, MrRab5C, MrRab6A, MrRab7A, MrRab9A, MrRab10, MrRab11A, MrRab14, MrRab18, MrRab27A, and MrRab32 respectively. The complete cDNA
122
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
MrRabs have been submitted to GenBank. For detailed information see Table 2.
Table 1 Sequences of the primers used in the study. Primers name
Sequences (50 -30 )
MrRab1A- F MrRab5C-F MrRab6A-F MrRab7A-F MrRab9A-F MrRab10-F MrRab11A-F MrRab14-F MrRab18-F MrRab27A-F MrRab32-F MrRab1A-RT-F UPM Long Short 50 -CDS Primer A SMARTerⅡA oligo 30 -CDS primer A MrRab1A-RT-R MrRab5C-RT-F MrRab5C-RT-R MrRab6A-RT-F MrRab6A-RT-R MrRab7A-RT-F MrRab7A-RT-R MrRab9A-RT-F MrRab9A-RT-R MrRab10-RT-F MrRab10-RT-R MrRab11A-RTF MrRab11A-RTR MrRab14-RT-F MrRab14-RT-R MrRab18-RT-F MrRab18-RT-R MrRab27A-RTF MrRab27A-RTR MrRab32-RT-F MrRab32-RT-R Mr-GAPDH-RTF Mr-GAPDH-RTR
GGGACACGGCTGGTCAAGAACGAT GTCTAGCTCCAATGTACTACC GTACTTGGAGGACAGAACGGTGAGG CTGCTGGTCAAGAGAGATTTC CTCGGAGATGGAGGAGTTGGGAAAT TTCCAAAGGAGAAGGGAGAAGCGATT GAGTTTGCCACCAGAAGCATAGAGG GTAACAAGGTCATACTACCGTGGCGCTG GCTAGCAATTTGGGACACAGC CACAGCATTTTATCGGGATGC CAGCCAACATTATCGAGCGAC GAAACCTCAGCTAAGAATGCTACCA CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC T25VN AAGCAGTGGTATCAACGCAGAGTACXXXXX AAGCAGTGGTATCAACGCAGAGTAC(T)30VN AGCTTCAACAGGAGCACTAGGACTA TAGCTCCAATGTACTACCGGGGT CCTTTTCGTGGCTAAATCTGCTT CGTGATTCTACTGTTGCTGTTGTTG CCCTCTTCTGTGGATACCTGTCTTT AGTGGTGTCACAGTAAAAACGAGGT GCGTCTTGCTTTGTCTTGTTATCAT TGAAAGAAAGGTAACCACTGAAGAA GTCTCAAGCACATCATAAAGGAAGT CTCTTCAGATTTTCAGATGACGCTT TTATTCCCATAGCCCCTCTGTAGTA AGCATAGAGGTGGATGGCAAAAC CTCCCCTGTAGTAGGCTGAAGTG AGAGAATGGCTTGATGTTTGTGG CGACCTGGCTGAGTTGGTTTAT ACAAAATTGACAAGGAGAAAAGAGA AAAGTCCTGGAGTTTGAATGATC GCTTCCTGCTCCTGTTTGATTTG TTCCTTTGCTCGCTGCTCTGAT GGCACTGGCAAGACCTCTATCAT GAACTTTGAGGGCGAAATCCAC TGCCGCCCAGAACATCATT TCGTCTTCGGTGTAGCCCA
3.2. Multiple alignments and phylogenetic analysis Based on the multiple alignment analysis, these 11 Rabs from M. rosenbergii are low conserved (Supplementary Fig. S2). All these 11 Rab proteins have a RAB domain. Phylogenetic tree was constructed using the NJ method to evaluate the molecular evolution relationships of the 11 Rab proteins of M. rosenbergii and other Rab GTPases (Fig. 1). In the phylogenetic tree, 11 MrRabs were clustered into different groups. MrRab1A, together with MmRab1A and MmRab1B from Mus musculus, belongs to one cluster. MrRab5C, together with Rab5 from Litopenaeus vannamei, M. musculus, D. melanogaster, and Anopheles gambiae, belongs to one group. MrRab6A, together with Rab6A and Rab6B from M. japonicus and M. musculus, belongs to one clade. MrRab7A, MrRab9A, Rab7s from P. monodon, Fenneropenaeus chinensis, and L. vannamei, Rab9A and Rab9B from M. musculus were clustered into 1 group. MrRab10 and Rab10 from M. musculus and D. melanogaster belong to 1 cluster. MrRab11A, together with Rab11A and Rab11B from M. musculus, belongs to 1 group. MrRab14 has a close relationship with Rab14 from M. musculus and D. melanogaster. MrRab18, together with Rab18 from Danio rerio and M. musculus, belongs to 1 group. MrRab27A, together with Rab27A and Rab27B from M. musculus, belongs to one group. MrRab32, Rab32 from Culex quinquefasciatus and Helicoverpa armigera and Rab38 from M. musculus belong to 1 group. 3.3. Tissue distributions of the 11 Rab genes qRT-PCR was used to investigate the tissue distributions of 11 MrRab transcripts. Results showed that every MrRab was expressed in all tested tissues. In detail, MrRab6A, MrRab9A, and MrRab32 were mainly expressed in the intestine and hepatopancreas, with lower levels of expressions in the heart, hemocytes, gills, and stomach. The transcripts of MrRab7A, MrRab11A, MrRab18A, and MrRab27 were detected mainly in the intestine and hemocytes. Meanwhile, MrRab1A and MrRab5C were primarily expressed in the intestine, gills, and heart. Other Rabs, including MrRab10 and MrRab14, were mainly expressed in the hemocytes and hepatopancreas, rather than in the intestine (Fig. 2). 3.4. Expression analysis of 11 Rab genes after WSSV or bacterial challenge
sequences of the 11 MrRabs were 910, 1,672, 1,489, 1,130, 1,059, 1,347, 1,220, 769, 958, and 908 bp respectively. These 11 MrRab genes encoded proteins of 206, 212, 211, 205, 210, 203, 204, 215, 206, 216, and 225 amino acids respectively. The sequences of
Table 2 Summary of 11 Rab GTPase genes identified in M. rosenbergii. Species
Gene name
GenBank accession number
M. rosenbergii
MrRab1A MrRab5C MrRab6A MrRab7A MrRab9A MrRab10 MrRab11A MrRab14 MrRab18 MrRab27A MrRab32
KP216755 KP216756 KP216757 KP216758 KP216759 KP216760 KP216761 KP216762 KP216763 KP216764 KP216765
The expression levels of the 11 MrRabs in the hepatopancreas of freshwater prawn upon challenge with WSSV or V. parahaemolyticus were observed using qRT-PCR methods to investigate the roles of Rab genes from M. rosenbergii in anti-WSSV and antibacterial innate immunity. In general, all of the Rab genes (including MrRab1A, MrRab5C, MrRab6A, MrRab7A, MrRab9A, MrRab10, MrRab11A, MrRab14, MrRab18, MrRab27A, and MrRab32) were upregulated in the tested tissue (Fig. 3). After the WSSV challenge, the expressions of all MrRabs (except MrRab11A) in the hepatopancreas showed no significant changes from 2 h to 12 h, reached the highest level at 24 h, and then slightly downregulated at 48 h MrRab11A was initially upregulated at 2 h, reached the highest level at 6 h, and finally declined at 24 h. Compared with the transcripts of MrRabs challenged with WSSV, MrRabs were relatively stable after V. parahaemolyticus challenge. The relative expression levels of MrRabs (except MrRab11A, MrRab14, and MrRab18) were changed at ± 2-fold compared with the blank group. MrRab11A, MrRab14, and MrRab18 reached the highest level at 24, 48, and 6 h (6.89-fold, 3.80-fold, and 3.72-fold; p < 0.05) post
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
123
Fig. 1. Phylogenetic analysis of eleven MrRabs and other representative Rab GTPases.
challenge, respectively. In addition, the transcripts of all MrRabs in the hepatopancreas did not change evidently after PBS challenge from 2 h to 48 h. 4. Discussion In this study, 11 Rab GTPases, designated as MrRab1A, MrRab5C, MrRab6A, MrRab7A, MrRab9A, MrRab10, MrRab11A, MrRab14, MrRab18, MrRab27A, and MrRab32, were identified from the hepatopancreas transcriptome of M. rosenbergii for the first time. As we know, the hepatopancreas is the primary site of production of immune response factors in crustaceans. The hepatopancreas not only initiates humoral immune response in shrimps but also contains highly specialized cells and phagocytes that function in cellular immune response [27,28]. Based on the sequence analysis, we determined that the RAB domain was located in all MrRab proteins. The RAB domain is the common structure of Rab-like small GTPases [29]. Multiple alignments showed that the RAB domains of these 11 MrRabs were not conserved. Different types of Rab proteins are less conserved. Phylogenetic analysis showed that these 11 MrRabs were divided into different groups. It could be speculated that different Rabs of the same species might have different roles. Rab1 can control transport from the ER to the Golgi [30]. Rab5 is involved in the endocytic pathway by regulating early endosome fusion and caveolar vesicle targeting to early endosomes [31e33]. Rab6s in mammals are required for retrograde transport, including transport from the Golgi to the ER (Rab6A and Rab6B) and multidrug resistance regulation (Rab6C) [34e36]. Rab7A facilitates the transport of
the epidermal growth factor receptor complex from the early endosomes to the late endosomes [37,38]. Rab9 mediates lysosomal enzyme trafficking and cycling of molecules from the late endosomes to the trans-Golgi network [39,40]. Rab11 is an important transport regulator in the endocytic pathway [41]. Rab3 can control the Ca2þ-dependent secretion and dense-core vesicle docking to the plasma membrane. Rab27 is the interaction protein of Rab3 [42,43]. So, in the giant freshwater prawns, different Rabs might have diverse function. Tissue distributions of MrRabs were detected at the mRNA level to determine the possible function of the 11 MrRabs in M. rosenbergii. MrRabs showed extensive distribution in different tissues of the shrimp. A relatively higher expression level of the MrRabs was observed in the intestine, hemocytes, and hepatopancreas. Similarly, the PjRab gene from P. japonicus was ubiquitously expressed in all test shrimp tissues, including the hemolymph, hepatopancreas, muscle, gill, heart, and intestine [18]. The mRNA transcripts of EsRab-1 and EsRab-3 from Eriocheir sinensis showed the highest expression levels in the hepatopancreas and marginal expression levels in other tissues, including the hemocytes, muscle, gonad, gills, and heart [23]. The intestine is an organ for digestion and absorption, which will encounter a variety of microbes, including pathogens. Hemocytes are one of the most important tissues involved in crustacean immune response, including phagocytosis [44,45], encapsulation [46], and storage and release of the proPO system [47]. The hepatopancreas, equivalent to the fat body of insects and the liver of mammals, plays an important function in the humoral immune responses of crustaceans. Many immune-related genes have been detected at high transcription
124
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
Fig. 2. Tissue distributions of eleven Rab GTPases in heart, hemocytes, hepatopancreas, gill, stomach and intestine of the healthy M. rosenbergii.
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
Fig. 2. (continued).
125
126
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
Fig. 3. qRT-PCR analysis of eleven MrRabs in the hepatopancreas of M. rosenbergii at 0, 2, 6, 12, 24, and 48 h after WSSV and V. parahaemolyticus challenge. The mRNA levels of MrRabs were analyzed and standardized according to the GAPDH mRNA levels. Asterisks indicate significant differences (*P < 0.05, **P < 0.01, ***P < 0.001) compared with values of the control. Error bars represent ± S.D. of the three independent PCR amplifications and quantifications.
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
Fig. 3. (continued).
127
128
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
Fig. 3. (continued).
levels in the hepatopancreas [48]. Thus, considering that Rab proteins are implicated in phagosome formation and maturation by regulating membrane transport from recycling endosomes to forming the phagocytic cup [49,50], abundant expression of MrRabs in the intestine, hemocytes, and hepatopancreas might be closely related to their biological function in cellular immune response in shrimp. In shrimps, most recent reports have focused only on the Rab GTPases, which are also involved in WSSV infection, but not their effectors. Vibriosis is the major disease caused by bacteria in the genus Vibrio [51]. The outbreaks of this disease have led to high mortality rates of M. rosenbergii. As such, qRT-PCR was conducted to determine the function of these 11 MrRabs during WSSV and V. parahaemolyticus infection. In our study, MrRab mRNA transcripts in the hepatopancreas were significantly expressed at various time points after infection with V. parahaemolyticus or WSSV, which may
indicate their roles in antibacterial and anti-WSSV innate immunity. Transcription of PjRab (Rab6A) from P. japonicus in WSSVresistant shrimp was observed to be significantly upregulated, indicating that the PjRab gene was involved in shrimp immune response against virus infection [18]. By contrast, the Rap GTPase from the Chinese white shrimp F. chinensis was reported to be upregulated upon Vibrio harveyi (bacteria) and WSSV infections, which may indicate its probable roles in anti-WSSV and antibacterial immunity [52]. Moreover, in vitro pull-down assays indicated that Rap GTPases interact with VP28, the envelope protein of WSSV [52]. Considering the RNAi-mediated gene knockdown of Rab7 in P. monodon, we observed that PmRab7 could bind to WSSV via VP28, which interferes with viral binding to the cell surface receptor [20,21]. Depletion of PmTBC1D20, a Rab GTPase-activating protein transcript in the black tiger shrimp P. monodon, by dsRNA
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
interference also led to a decrease in the level of transcripts of three WSSV genes (VP28, ie1, and wsv477) [53]. In this study, different members of Rab GTPases in the giant freshwater prawn M. rosenbergii were identified for the first time. The low conservation of different kinds of Rab GTPases from the giant freshwater prawns indicated that the evolution of gene diversification occured in M. rosenbergii. The MrRab genes were significantly induced by WSSV or bacterial infection, which indicated their roles in innate immunity in M. rosenbergii. Acknowledgments The current study was supported by the National Natural Science Foundation of China (Grant Nos. 31101926), the National Natural Science Foundation of Jiangsu Province (BK20131401), Natural Science Fund of Colleges and universities in Jiangsu Province (13KJB240002), High level talents in Nanjing Normal University Foundation (2012104XGQ0101), the major project of Jiangsu Province University Natural Science (14KJA240002), and the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2014.12.021. References [1] Rink J, Ghigo E, Kalaidzidis Y, Zerial M. Rab conversion as a mechanism of progression from early to late endosomes. Cell 2005;122:735e49. [2] Zerial M, McBride H. Rab proteins as membrane organizers. Nat Rev Mol Cell Biol 2001;2:107e17. [3] Segev N. Ypt and Rab GTPases: insight into functions through novel interactions. Curr Opin Cell Biol 2001;13:500e11. [4] Pfeffer SR. Rab GTPases: specifying and deciphering organelle identity and function. Trends Cell Biol 2001;11:487e91. [5] Wang RJ, Zhang Y, Liu SK, Li C, Sun LY, Bao LS, et al. Analysis of 52 Rab GTPases from channel catfish and their involvement in immune responses after bacterial infections. Dev Comp Immunol 2004;45:21e34. [6] Ohbayashi N, Fukuda M. Role of Rab family GTPases and their effectors in melanosomal logistics. J Biol Chem 2012;151:343e51. [7] Exton JH. Small GTPases minireview series. J Biol Chem 1998;273:19923. [8] Novick P, Field C, Schekman R. Identification of 23 complementation groups required for post-translational events in the yeast secretory pathway. Cell 1980;21:205e15. [9] Salminen A, Novick PJ. Aras-like protein is required for a post-Golgi event in yeast secretion. Cell 1987;49:527e38. [10] Takai Y, Sasaki T, Matozaki T. Small GTP-binding proteins. Physiol Rev 2001;81:153e208. [11] Diekmann Y, Seixas E, Gouw M, Tavares-Cadete F, Seabra MC, Pereira-Leal JB. Thousands of rab GTPases for the cell biologist. PLoS Comput Biol 2011;7: e1002217. [12] Bock JB, Matern HT, Peden AA, Scheller RH. A genomic perspective on membrane compartment organization. Nature 2001;409:839e41. [13] Pereira-Leal JB, Seabra MC. Evolution of the Rab family of small GTP-binding proteins. J Mol Biol 2001;313:889e901. [14] Eoin EK, Conor PH, Bruno G, Mary WM. The Rab family of proteins: 25 years on. Biochem Soc Trans 2012;40:1337e47. [15] Touchot N, Chardin P, Tavitian A. Four additional members of the ras gene superfamily isolated by an oligonucleotide strategy: molecular cloning of YPTrelated cDNAs from a rat brain library. Proc Natl Acad Sci 1987;84:8210e4. [16] Hashim S, Mukherjee K, Raje M, Basu SK, Mukhopadhyay A. Live Salmonella modulate expression of Rab proteins to persist in a specialized compartment and escape transport to lysosomes. J Biol Chem 2000;275:16281e8. [17] Scianimanico S, Desrosiers M, Dermine JF, Meresse S, Descoteaux A, Desjardins M. Impaired recruitment of the small GTPase rab7 correlates with the inhibition of phagosome maturation by Leishmania donovani promastigotes. Cell Microbiol 1999;1:19e32. [18] Wu WL, Zhang XB. Characterization of a Rab GTPase up-regulated in the shrimp Peneaus japonicus by virus infection. Fish Shellfish Immunol 2007;23: 438e45. [19] Wu W, Zong R, Xu J, Zhang X. Antiviral phagocytosis is regulated by a novel Rab-dependent complex in shrimp Penaeus japonicus. J Proteome Res 2007;7: 424e31.
129
[20] Sritunyalucksana K, Wannapapho W, Lo CF, Flegel TW. PmRab7 is a VP28binding protein involved in white spot syndrome virus infection in shrimp. J Virol 2006;80:10734e42. [21] Ongvarrasopone C, Chanasakulniyom M, Sritunyalucksana K, Panyim S. Suppression of PmRab7 by dsRNA inhibits WSSV or YHV infection in shrimp. Mar Biotechnol Ny 2008;10:374e81. [22] Zong R, Wu W, Xu J, Zhang X. Regulation of phagocytosis against bacterium by Rab GTPase in shrimp Marsupenaeus japonicus. Fish Shellfish Immunol 2008;25:258e63. [23] Wang LL, Li L, Wang LL, Yang JL, Wang JJ, Zhou Z, et al. Two Rab GTPases, EsRab-1 and EsRab-3, involved in anti-bacterial response of Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol 2013;35:1007e15. [24] Kumar S, Nei M, Dudley J, Tamura K. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief Bioinform 2008;9: 299e306. [25] Wang S, Zhao XF, Wang JX. Molecular cloning and characterization of the translationally controlled tumor protein from Fenneropenaeus chinensis. Mol Biol Rep 2008;36:1683e93. [26] Huang Y, An L, Hui KM, Ren Q, Wang W. An LDLa domain-containing C-type lectin is involved in the innate immunity of Eriocheir sinensis. Dev Comp Immunol 2014;42:333e44. 2014. [27] Lee SY, Wang R, Soderhall K. A lipopolysaccharide- and b-1,3-glucan binding protein from hemocytes of the freshwater crayfish Pacifastacus leniusculus. Purification, characterization and cDNA cloning. J Biochem 2000;275:1337e43. [28] Sritunyalucksana K, Wongsuebsantati K, Johansson MW, Soderhall K. Peroxinectin, a cell adhesive protein associated with the proPO system from the black tiger shrimp, Penaeus monodon. Dev Comp Immunol 2001;25:353e63. [29] Wu M, Wang T, Loh E, Hong W, Song H. Structural basis for recruitment of RILP by small GTPase Rab7. EMBO J 2005;24:1491e501. [30] Tisdale EJ, Bourne JR, Khosravi-Far R, Der CJ, Balch W. GTP-binding mutants of rab1 and rab2 are potent inhibitors of vesicular transport from the endoplasmic reticulum to the Golgi complex. J Cell Biol 1992;119:749e61. [31] Arnett AL, Bayazitov I, Blaabjerg M, Fang L, Zimmer J, Baskys A. Antisense oligonucleotide against GTPase Rab5b inhibits metabotropic agonist DHPGinduced neuroprotection. Brain Res 2004;1028:59e65. [32] Barbieri MA, Roberts RL, Gumusboga A, Highfield H, Alvarez-Dominguez C, Wells A, et al. Epidermal growth factor and membrane trafficking Egf receptor activation of endocytosis requires Rab5a. J Cell Biol 2000;151:539e50. [33] Pelkmans L, Bürli T, Zerial M, Helenius A. Caveolin-stabilized membrane domains as multifunctional transport and sorting devices in endocytic membrane traffic. Cell 2004;118:767e80. [34] Schoebel S, Blankenfeldt W, Goody RS, Itzen A. High-affinity binding of phosphatidylinositol 4-phosphate by Legionella pneumophila DrrA. EMBO Rep 2010;11:598e604. [35] Schoebel S, Oesterli LK, Blankenfeldt W, Goody RS, Itzen A. RabGDI displacement by DrrA from Legionella is a consequence of its guanine nucleotide exchange activity. Mol Cell 2009;36:1060e72. [36] Suh HY, Lee DW, Lee KH, Ku B, Choi SJ, Woo JS, et al. Structural insights into the dual nucleotide exchange and GDI displacement activity of SidM/DrrA. EMBO J 2009;29:496e504. [37] Feng Y, Press B, Chen W, Zimmerman J, Wandinger-Ness A. Expression and properties of Rab7 in endosome function. Methods Enzymol 2001;329:175e87. [38] Vonderheit A, Helenius A. Rab7 associates with early endosomes to mediate sorting and transport of Semliki forest virus to late endosomes. PLoS Biol 2005;3:e233. [39] Ganley IG, Carroll K, Bittova L, Pfeffer S. Rab9 GTPase regulates late endosome size and requires effector interaction for its stability. Mol Biol Cell 2004;15: 5420e30. [40] Lombardi D, Soldati T, Riederer M, Goda Y, Zerial M, Pfeffer S. Rab9 functions in transport between late endosomes and the trans Golgi network. EMBO J 1993;12:677e82. [41] Wilcke M, Johannes L, Galli T, Mayau V, Goud B, Salamero J. Rab11 regulates the compartmentalization of early endosomes required for efficient transport from early endosomes to the trans-Golgi network. J Cell Biol 2000;151:1207e20. [42] Rupnik M, Kreft M, Nothias F, Grilc S, Bobanovic LK, Johannes L, et al. Distinct role of Rab3A and Rab3B in secretory activity of rat melanotrophs. Am J Physiol Cell Physiol 2007;292:C98e105. [43] Tsuboi T, Fukuda M. Rab3A and Rab27A cooperatively regulate the docking step of dense-core vesicle exocytosis in PC12 cells. J Cell Sci 2006;119:2196e203. € derh€ [44] So all K, Smith VJ, Johansson MW. Exocytosis and uptake of bacteria by isolated haemocyte populations of two crustaceans: evidence for cellular cooperation in the defence reactions of arthropods. Cell Tissue Res 1986;245: 43e9. € derha €ll K. Induction of degranulation and lysis of haemocytes in [45] Smith VJ, So the freshwater crayfish, Astacus astacus by components of the prophenoloxidase activating system in vitro. Cell Tissue Res 1983;233:295e303. €derha €ll K. The 76 kD cell-adhesion factor [46] Kobayashi M, Johansson MW, So from crayfish haemocytes promotes encapsulation in vitro. Cell tissue Res 1990;260:13e8. € derha €ll K. Cellular immunity in crustaceans and the proPO [47] Johansson MW, So system. Parasitol Today 1989;5:171e6. [48] Gross PS, Bartlett TC, Browdy CL, Chapman RW, Warr GW. Immune gene discovery by expressed sequence tag analysis of haemocytes and hepatopancreas in the Pacific White Shrimp, Litopenaeus vannamei, and the Atlantic White Shrimp, L. setiferus. Dev Comp Immunol 2001;25:565e77.
130
Y. Huang, Q. Ren / Fish & Shellfish Immunology 43 (2015) 120e130
[49] Duclos S, Desjardins M. Subversion of a young phagosome: the survival strategies of intracellular pathogens. Cell Microbiol 2000;2:365e77. [50] Rupper A, Cardelli J. Regulation of phagocytosis and endo-phagosomal trafficking pathways in Dictyostelium discoideum. BBA-GEN Subj 2001;1525:205e16. [51] Jiravanichpaisal P, Miyazaki T, Limsuwan C. Histopathology, biochemistry, and pathogenicity of Vibrio harveyi infecting black tiger prawn Penaeus monodon. J Aquat Anim Health 1994;6:27e35.
[52] Ren Q, Zhou J, Jia YP, Wang XW, Zhao XF, Wang JX. Cloning and characterization of Rap GTPase from the Chinese white shrimp Fenneropenaeus chinensis. Dev Comp Immunol 2012;36(1):247e52. [53] Yingvilasprasert W, Supungul P, Tassanakajon A. PmTBC1D20, a Rab GTPaseactivating protein from the black tiger shrimp, Penaeus monodon, is involved in white spot syndrome virus infection. Dev Comp Immunol 2014;42: 302e10.