Molecular identification and expression profiling of a novel alpha2-macroglobulin gene in giant freshwater prawn (Macrobrachium rosenbergii, De Man)

Agriculture and Natural Resources 51 (2017) 25e35

Contents lists available at ScienceDirect

Agriculture and Natural Resources journal homepage: http://www.journals.elsevier.com/agriculture-andnatural-resources/

Original Article

Molecular identification and expression profiling of a novel alpha2-macroglobulin gene in giant freshwater prawn (Macrobrachium rosenbergii, De Man) Wirot Likittrakulwong,a Uthairat Na-Nakorn,b Supawadee Poompuang,b Skorn Koonawootrittriron,c Prapansak Srisapoomed, * a

Genetic Engineering, Faculty of Graduate School Kasetsart University, Bangkok 10900, Thailand Laboratory of Aquatic Animal Genetics, Department of Aquaculture, Faculty of Fisheries, Kasetsart University, Bangkok 10900, Thailand Department of Animal Science, Faculty of Agriculture, Kasetsart University, Bangkok 10900, Thailand d Laboratory of Aquatic Animal Health Management, Department of Aquaculture, Faculty of Fisheries, Kasetsart University, Bangkok 10900, Thailand b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 13 June 2016 Accepted 15 August 2016 Available online 22 February 2017

A full-length cDNA encoding a novel alpha-2 macroglobulin (Mr-2a2M) gene in giant freshwater prawn was cloned and sequenced using rapid amplification cDNA end techniques. The Mr-2a2M was 5194 bp and comprised a 4560-bp open reading frame (ORF) encoding 1519 amino acid residues. The mature Mr-2a2M protein had a calculated molecular mass of 168.8 kDa and an estimated pI of 5.14. Mr-2a2M contained significantly functional domains, including a bait region, a thiol ester motif and a receptorbinding domain, similar to the a2Ms of other species. Amino acid sequence analysis of a2Ms indicated that Mr-2a2M was most similar to the Chinese white shrimp (Fenneropenaeus chinensis) a2M isoform 2 (Fc-A2M-2), with an identity of 58.8%, and the previously identified giant freshwater prawn Mr-1a2M protein, with an identity of 43.5%. Phylogenetic analysis revealed that Mr-2a2M was more closely related to Fc-A2M-2 than Mr-1a2M, which was placed in a different subminor group. Quantitative real-time reverse-transcription polymerase chain reaction assay illustrated that Mr-2a2M mRNA transcripts were strongly detected in the subcuticular epithelium, heart, midgut and muscle but marginally detected in the hemocytes of normal prawns. Immune response analysis in prawns stimulated with Aeromonas hydrophila clearly indicated that Mr-2a2M was quickly up-regulated to high levels in hemocytes and hepatopancreas after 12 h, in contrast to the expression pattern of Mr-1a2M. This novel a2M gene may have unique, important roles in giant freshwater prawn immune systems that differ significantly from those of the previously identified Mr-1a2M gene. Copyright © 2017, Kasetsart University. Production and hosting by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Keywords: Aeromonas hydrophila Alpha-2 macroglobulin cDNA Giant freshwater prawn Immune responses

Introduction The giant freshwater prawn, Macrobrachium rosenbergii, is an economically important species of aquatic animal in Southeast Asian countries, particularly Thailand with an annual production of approximately 33,000 t, valued at USD 79,096,000 (Na-Nakorn and Jintasataporn, 2012). The major threat to production is white tail disease, which is caused by M. rosenbergii nodavirus (MrNV) and extra small virus (XSV) according to Yoganandhan et al. (2006). Infectious diseases caused by bacteria are also major causes of

* Corresponding author. E-mail address: ffi[email protected] (P. Srisapoome).

disease outbreaks and economic losses in the prawn industry. Pathogenic bacteria for prawns, such as Aeromonas spp. (Lengbumrung et al., 2007), have been reported. A basic knowledge of immunity is essential to develop practical methods of controlling outbreaks of these diseases in culture systems. Crustaceans lack the adaptive immune systems of vertebrates and have only innate immune systems, which protect against pathogens using physical barriers, humoral and cellular components (Sӧderhӓll et al., 1990). Humoral factors play crucial roles in the immune response by inducing the production of specific immune-responsive proteins in response to different pathogens; of these proteins, a2M is one of the most important proteins in the immune systems of vertebrates and invertebrates. a2M is a non-specific protease inhibitor that plays an important function in inhibiting and eliminating

http://dx.doi.org/10.1016/j.anres.2017.02.001 2452-316X/Copyright © 2017, Kasetsart University. Production and hosting by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/).

26

W. Likittrakulwong et al. / Agriculture and Natural Resources 51 (2017) 25e35

dangerous pathogen proteases (Ho et al., 2009). It also acts against infection by opsonizing phagocytosis and is important in regulating the prophenoloxidase activating cascade (Asp
an et al., 1990). To date, a2M molecules have been identified and characterized from several vertebrates, invertebrates and even giant freshwater prawn, M. rosenbergii (Ho et al., 2009). These studies have demonstrated that crustacean a2Ms feature important structural components similar to those of vertebrate a2Ms. However, the immune response of crustacean a2Ms to invading pathogens and their structural genomic information remains to be fully characterized. The aim of this study was to characterize a novel a2M gene (Mr-2a2M) in giant freshwater prawn. The complementary DNA (cDNA) of Mr-2a2M was isolated from hemocytes, and its amino acid and nucleotide sequences were determined to evaluate the evolutionary relationships with a2Ms from other organisms. The expression levels of Mr-2a2M and the previously discovered Mr1a2M in the gills, hepatopancreas and hemocytes of normal prawns and prawns challenged with Aeromonas hydrophila were determined by quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR). The identification of a second a2M gene in the giant prawn genome suggests diversification of specific functions in prawn immune systems.

Biotechnology Information server (http://www.ncbi.nlm.nih.gov/ BLAST). The deduced amino acid sequences of giant freshwater prawn a2M were analyzed using the Expert Protein Analysis System (http://us.expasy.org/). Signal peptides were predicted using the SignalP 3.0 program (http://www.cbs.dtu.dk/services/SignalP/). N-link glycosylation sites were predicted using the NetNGlyc 1.0 Server (http://www.cbs.dtu.dk/services/NetNGlyc/). Phylogenetic analysis The nucleotide and amino acid sequences of a2M in giant freshwater prawn were compared to those of previously identified a2Ms using the Matrix Alignment Tool software (MatGAT), version 2.02 (http://ww3.bergen.edu/faculty/jsmalley/matgat.html). These sequences were retrieved from the NCBI GenBank databases for further analysis using the ClustalW multiple alignment program (http://www.ebi.ac.uk/clustalw/). A phylogenetic tree was created based on the deduced amino acid sequences using the neighborjoining algorithm in the MEGA software (version 5; http://www. megasoftware.net). The reliability of branching was tested using bootstrap re-sampling with 1000 bootstrap-replicates. Tissue distribution analysis of a2M mRNA by quantitative real-time reverse-transcription polymerase chain reaction assay

Materials and methods Cloning and characterization of Mr-2a2M cDNA Adult giant freshwater prawns, M. rosenbergii (approximately 40e50 g), were purchased from a commercial farm in Nakhon Pathom province, Thailand. The prawns were maintained in fiberglass tanks under optimal aeration conditions and fed commercial pellets at 5% body weight twice daily for 2 wk. Hemolymph (0.5 mL) was collected by bleeding from the ventral sinus cavity using a sterile syringe containing 0.5 mL of anticoagulant solution (10% trisodium citrate dihydrate; (C6H5Na3e2H2O) in RPMI 1640 medium plus L-glutamine). The hemocytes in TRIzol reagent were isolated and homogenized using an automatic tissue extractor (MP Biomedicals; Santa Anna, CA, USA) as recommended by the manufacturer's protocol. Total RNA was extracted, and mRNA was purified using an mRNA purification kit (Gibco BRL; Grand Island, NY, USA and GE Healthcare; Waukesha, WI, USA, respectively) according to each manufacturer's protocol. The 50 end ready to use first-stand cDNA, (50 -rapid amplification cDNA end) using the specific primer Mr-2a2M for rapid amplification of cDNA ends (RACE) as shown in Table 1, DNA cloning and sequencing were performed with the same protocol as described by Toe et al. (2012). Nucleotide and protein sequence similarities and identities of the full length of an obtained cDNA were evaluated with the BLAST algorithm (BlastX and BlastN programs) on the National Center for

Adult male and female giant freshwater prawns prepared previously were used for tissue distribution analysis. Samples of 14 tissues (eyestalk, foregut, gills, heart, hepatopancreas, hemocytes, hindgut, midgut, muscle, ovary, subcuticular epithelium, testis, thoracic ganglion and vas deferens) were dissected from these healthy prawns. Approximately 100 mg of each collected tissue preserved in 1 mL of TRIzol reagent was homogenized, and total RNA was extracted as described above. Hemocytes were collected as described previously, and tissues were homogenized in TRIzol reagent (Gibco BRL; Grand Island, NY, USA) using an automatic tissue extractor (MP Biomedicals; Santa Anna, CA, USA). First strand cDNA of each organ was prepared as described in Toe et al. (2012). One microliter of first-strand cDNA from each of the 14 prawn tissues was subjected to qRT-PCR using a SYBR™ Green kit (Stratagene; La Jolla, CA, USA). Each reaction was performed in a final volume of 25 mL containing 1 mL of first-strand cDNA, 12.5 mL of 2X SYBR Green qPCR Master Mix, 9.5 mL of dH2O and 1 mL (10 mM) of each specific primer (Mr-2a2M F1 and Mr-2a2M R1, Table 1). The reactions were performed in triplicate in a MX3005P real-time PCR machine (Stratagene; La Jolla, CA, USA). The expression level of bactin was also quantified using the specific primers b-actin F2 and b-actin R2 (Table 1) with the same protocol as in the Mr-2a2M experiment. The relative expression ratios of the a2M mRNAs were analyzed using the MxPro qPCR software (Stratagene; La Jolla, CA,

Table 1 Specific primers used in the experiments. Primer name

Sequences 50

b-actin F1 b-actin R1 b-actin F2 b-actin R2 Mr-2a2M RACE Mr-2a2M F1 Mr-2a2M R1 Mr-2a2M F2 Mr-2a2M R2

CATCGTTACTAACTGGGACG AGGATTCCATACCCAGGAAG TTCACCATCGGCATTGAGAGGTTC CACGTCGCACTTCATGATGGAGTT GCAGTCTCTACTGCAACAGCATCA GATATGAAGTTGATGGAAA GTGAACTCTGGCTGGTAGTAA TCTTTACTGGAATCTGGTGAGCC TGCCACAACTGTATCCTGGGTAGA

a b

30

nta

Amplicon size

Experimentb

20 20 24 24 24 19 21 24 24

593 bp

4 Kb 154 bp

RT-PCR RT-PCR Real-time PCR Real-time PCR 50 RACE PCR Real-time PCR (F1,R1)

385 bp

Southern blot analysis (F2,R2)

Nucleotide number. RT-PCR ¼ reverse-transcription polymerase chain reaction, RACE ¼ rapid amplification cDNA end.

197 bp

W. Likittrakulwong et al. / Agriculture and Natural Resources 51 (2017) 25e35

USA). The relative copy numbers of the target mRNAs were calculated according to the 2(DDCt) method (Livak and Schmittgen, 2001). The difference in the cycle threshold (Ct) value of the Mr2A2M gene and b-actin (housekeeping gene) was DCT. The relative expression levels of a2M in each tissue were compared to hemocytes as a calibrator. ANOVA was performed to analyze the variations of the relative expression ratios of Mr-2a2M in each tissue. The expression ratios of Mr-2a2M in each organ were determined using Duncan's new multiple range test (DMRT) at a significance level of 0.05.

27

Expression analysis of Mr-1a2M and Mr-2a2M mRNA in the gills, hepatopancreas and hemocytes of prawn challenged with A. hydrophila by quantitative real-time reverse-transcription polymerase chain reaction assay A sample of 72 healthy adult giant freshwater prawns was acclimated in three different fiberglass tanks (24 prawns each) under optimal aeration conditions as previously described for 7 d. During this period, prawns were fed at 7% body weight with a commercial feed twice daily. A single colony of A. hydrophila strain

Fig. 1. Nucleotide (above) and deduced amino acid sequences (below) of giant freshwater prawn Mr-2a2M. The start and stop codons are in bold. The signal peptide is denoted by a single underline. The asterisk indicates the stop codon. The polyadenylation signals (ATTAAA, CATTAAA, and AATAAA) are indicated in bold italic letters. The conserved thioester motif (GCGEQNM) is shown in a gray background. The putative bait region sequence and the receptor-binding domain are indicated by dotted and solid boxes, respectively. Potential N-link glycosylation sites are in boxed italic letters. The full sequence of Mr-2a2M has been submitted to GenBank database under accession number KJ540280.

28

W. Likittrakulwong et al. / Agriculture and Natural Resources 51 (2017) 25e35

AQAH01 which is pathogenic to giant freshwater prawn, was obtained from the Laboratory of Aquatic Animal Health Management, Faculty of Fisheries, Kasetsart University, Bangkok, Thailand. It was subcultured in tryptic soy agar (Merck; Kenilworth, NJ, USA) and used to prepare bacterial stocks in tryptic soy broth (Merck; Kenilworth, NJ, USA). The bacterial stock solution was prepared in 0.85% NaCl to obtain an optical density at 540 nm of 0.75, which corresponds to approximately 1  1012 colony-forming units (CFU) per mL. This stock was used for subsequent experiments. Three experimental groups were used. In group I, the control (no bacterial inoculation) was applied. Experimental prawns were intramuscularly injected with 200 mL of 0.85% NaCl in the 3rd abdominal segment. In groups II and III, all prawns were injected with 200 mL of A. hydrophila solution prepared in 0.85% NaCl

containing 1  106 CFU/mL or 1  109 CFU/mL of pathogenic bacteria, respectively. The gills, hepatopancreas and hemocytes of three prawns from each group were collected at 0 h, 6 h, 12 h, 24 h, 48 h and 96 h to isolate total RNA and perform first-strand cDNA synthesis as previously described. One microgram of first-strand cDNA from each group of prawns collected at various time points was subjected to qRT-PCR using the specific primers pairs QpcrA2M and Qpcr-A2M for Mr-1a2M (Ho et al., 2009) and Mr-2a2M F1 and Mr-2a2M R1 for Mr-2a2M with the same protocol described previously. The control group was used to calibrate the mRNA expression levels of the normal prawns and the A. hydrophila challenge groups. Statistically significant differences between groups at different time points were compared by ANOVA and DMRT, respectively, at a significance level of 0.05.

Fig. 2. Multiple sequence alignment of the amino acid sequences of M. rosenbergii 1a2M (Mr-1a2M, ABK60046) and M. rosenbergii 2a2M (Mr-2a2M, KJ540280). The black-shaded sequences indicate positions that share the same amino acid residues; gray-shaded sequences indicate conserved amino acid substitutions, and light gray-shaded sequences indicate semi-conserved amino acid substitutions. An arrow indicates the amino acids in the corresponding catalytic His position of Mr-2a2M.

W. Likittrakulwong et al. / Agriculture and Natural Resources 51 (2017) 25e35

29

Fig. 3. Multiple alignment of Mr-2a2M with other a2M proteins indicating the conserved domain structure of the bait region (A), thioester motif (B) and receptor binding domain (C). The black-shaded sequences indicate positions that share the same amino acid residues; the gray-shaded sequences indicate conserved amino acid substitutions, and the light gray-shaded sequences indicate semi-conserved amino acid substitutions. Down arrows indicate consensus lysine residues.

Table 2 Comparison of nucleotide and amino acid sequences of Mr-2a2M and a2Ms of other organisms. Common name

Mammal Common chimpanzee Cow Guinea pig Rat House mouse Aves Chicken Amphibian Africa clawed frog Fish Arctic lamprey Common carp Insect Tick Crustaceans Horseshoe crab Chinese white shrimp Chinese white shrimp Signal crayfish Signal crayfish Giant freshwater prawn

Species

Abbreviation

Accession number

Amino acid

Nucleotide

Similarity (%)

Identity (%)

Identity (%)

Pan troglodytes Bos taurus Cavia porcellus Rattus norvegicus Mus musculus

Pt-a2M Bt-a2M Cp-a2M Rn-a2M Mm-a2M

XP_001139819.1 NP_001103265.1 NP_001166523.1 AAA40636.1 M93264

51.4 52.1 51.9 51.0 51.1

30.4 30.2 30.3 29.7 28.7

49.2 48.9 50.1 49.1 49.1

Gallus gallus

Gg-a2M

XP_425514.3

42.4

22.5

47.8

Xenopus laevis

Xl-a2M

AAY98517.1

50.8

29.8

50.5

Lethenteron camtschaticum Cyprinus carpio

Lc-a2M Cc-a2M

BAA85038.1 BAA85038.1

49.4 48.7

28.6 28.2

47.1 49.4

Ornithodoros moubata

Om-a2M

AAN10129.1

53.5

32.7

49.4

Limulus sp. Fenneropenaeus chinensis Fenneropenaeus chinensis Pacifastacus leniusculus Pacifastacus leniusculus Macrobrachium rosenbergii

Lmu a2M Fc-A2M-1 Fc-A2M-2 Pl-A2M1 Pl-A2M2 Mr-1a2M

BAA19844.1 ABP97431 ACU31810.1 HQ596364 HQ596363 ABK60046.1

52.9 62.1 74.3 72.5 66.4 62.0

31.6 40.9 58.8 56.6 47.0 43.4

51.2 51.9 55.9 54.0 54.9 54.4 (continued on next page)

30

W. Likittrakulwong et al. / Agriculture and Natural Resources 51 (2017) 25e35

Table 2 (continued ) Common name

Kuruma shrimp Pacific white shrimp Mud crab Mollusca Scallop Periwinkle Pearls

Species

Abbreviation

Accession number

Amino acid

Nucleotide

Similarity (%)

Identity (%)

Identity (%)

Marsupenaeus japonicus Litopenaeus vannamei Scylla serrata

Mj-a2M Lv-a2M Ss-a2M

BAC99073.1 ABI79454.2 ABD61456.1

62.8 62.7 54.6

41.1 41.4 35.4

51.3 56.2 45.2

Chlamy farreri Littorina littorea Hyriopsis cumingii

Cf-a2M Ll-a2M Hc-a2M

AAR39412.1 KJ596452 ABJ89824.1

48.6 45.3 50.7

28.5 28.4 29.6

43.5 38.0 49.1

Results and discussion Cloning and characterization of the cDNA encoding a second a2M gene from giant freshwater prawn Previous expressed-sequence tag (EST) analyses by the laboratory of Aquatic Animal Health Management, Faculty of Fisheries, Kasetsart University (On-ming et al., 2007) revealed 29 sequences with high homology to “Mr-1a2M”, which was first identified in

63

giant freshwater prawn by Ho et al. (2009). Of these sequences, the EST clone “EB210” (accession no. GH624335) was unique because it exhibited some similarity with other a2M molecules from other organisms. Therefore, the present study sought to reveal novel aspects of the immune system of giant freshwater prawn. Based on comparative analysis of information generated in the present study and by Ho et al. (2009), a full-length cDNA encoding a novel a2M gene in giant freshwater prawn named Mr-2a2M was successfully cloned and characterized using the 50 RACE PCR technique.

Pan troglodytes α2M (Common chimpanzee, XP_001139819.1) Cavia porcellus α2M (Guinea pig, NP_001166523.1)

57 98

Rattus norvegicus α2M (Rat, AAA40636.1)

99

Bos taurus α2M (Cow, NP_001103265.1)

55

Mus musculus α2M (House mouse, M93264) Cyprinus carpio α2M (Common carp, BAA85038.1)

48

Xenopus laevis α2M (Africa clawed frog, AAY98517.1) 93 Lethenteron camtschaticum α2M (Arctic lamprey, BAA02762.1)

58

Gallus gallus α2M (Chicken, XP_425514.3) Ornithodoros moubata α2M (Tick, AAN10129.1)

83

Limulus sp. α2M (Horseshoe crab, BAA19844.1) Macrobrachium rosenbergii Mr-2α2M (Giant freshwater prawn, KJ540280)

84 94

Fenneropenaeus chinensis FcA2M-2(Chinese white shrimp, ACU31810.1) Pacifastacus leniusculus Pl-A2M1 (Signal crayfish, HQ596364)

16

Macrobrachium rosenbergii Mr-1α2M (Giant freshwater, ABK60046.1)

15

76

Pacifastacus leniusculus Pl-A2M2 (Signal crayfish, HQ596363)

57

Scylla serrata α2M (Mud crab, ABD61456.1)

68

Marsupenaeus japonicas α2M (Kuruma shrimp, BAC99073.1) Litopenaeus vannamei α2M (White leg shrimp, ABI79454.2)

99 64

35

74

Fenneropenaeus chinensis FcA2M1 (Chinese white shrimp, ABP97431.1) Penaeus monodon α2M (Giant tiger shrimp, ABC86572.1) Chlamys farreri α2M ( Japanese scallop, AAR39412.1) Littorina littorea α2M (Periwinkle, KJ596452)

56

Hyriopsis cumingii α2M (Pearls, ABJ89824.1)

44

Strongylocentrotus purpuratus C3 (Purple sea urchin, AF025526)

0.4

0.3

0.2

0.1

0.0

Fig. 4. Phylogenetic tree of a2M genes. The values for each internal branch were determined using a neighbor-joining method with 1000 replicates. The common names and accession numbers of each species are provided in brackets after the scientific names.

Relative expression ratio

W. Likittrakulwong et al. / Agriculture and Natural Resources 51 (2017) 25e35

900 800 700 600 500 400 300 200 100 0

31

i h

gh efg

h

def

fg

efg cde

cd

bcd

bc

b a EY

FG

GI

HM

HE

HP

HG

MG MU

OV

SE

TE

TG

VD

Tissue Fig. 5. Expression profiles of Mr-2a2M in various tissues determined by quantitative real-time reverse transcription polymerase chain reaction assay. Columns with different letters indicate significant differences (p < 0.05) and error bars show ±SD. EY ¼ Eyestalk, FG ¼ Foregut, GI ¼ Gills, HM ¼ Hemocytes, HE ¼ Heart, HP ¼ Hepatopancreas, HG ¼ Hindgut, MG ¼ Midgut, MU ¼ Muscle, OV ¼ Ovary, SE ¼ Subcuticular epithelium, TE ¼ Testis, TG ¼ Thoracic ganglion, VD ¼ Vas deferens.

Additionally, the analysis of the sequence of Mr-2a2M revealed interesting and important information about its structure, evolutionary relationships and expression profiles under both normal and bacterial infection conditions. The full-length cDNA encoding a new a2M gene from giant freshwater prawn (Mr-2a2M) was cloned using 50 RACE techniques. The full-length Mr-2a2M cDNA was 5194 bp (GenBank accession no. KJ540280) and includes an open reading frame (ORF) of 4560 bp, a 50 untranslated region (UTR) of 81 bp, a 30 UTR of 653 bp, and a 16-bp poly A tail at its 30 end (Fig. 1). Five putative polyadenylation signals were characterized, consisting of 1 AATAAA, 1 CATTAAA and 3 ATTAAA. Mr-2a2M encodes a protein of 1519 amino acids with a 19amino-acid N-terminal signal peptide. Structural analysis indicated that the mature Mr-2a2M protein has 1500 amino acid residues, a calculated molecular mass of 168.8 kDa, and an estimated pI of 5.14. Six putative N-linked glycosylation sites were identified (Fig. 1). Structurally, there are three different regions in the a2M molecule. The first is the bait region, which is short and located on the surface of the a2m molecule. The bait region is normally cleaved after the binding of a2M to a protease (Ma et al., 2010). The bait region of Mr-2a2M is 37 amino acids longer than Mr-1a2M (Fig. 2) and shares low identity with a2Ms of other species and diverges in both sequence and length. These differences strongly indicate that the a2Ms of giant freshwater prawn vary their bait regions, similar to the a2Ms of Chinese shrimp (Ma et al., 2010) and freshwater crayfish (Wu et al., 2012). The bait region contains a splice variant to enable reaction with a broad spectrum of proteases (Ma et al., 2010; Rattanachai et al., 2004; Armstrong, 2001). Alternative splicing has also been suggested to generate diversity (Ma et al., 2010; Wu et al., 2012). In addition, variation within the bait region of a2M increases the diversity of immune recognition (Ma et al., 2010). Thus, the variation of the bait region may affect the expression response to pathogen infection and pathogen reaction with internal proteases. Additionally, sequence diversity within the bait region may reflect evolutionary pressure to react with proteases produced from various pathogens while avoiding inhibiting various essential proteases of the host (Armstrong and Quigley, 1999). The second region of a2M is a thioester motif encoded by “GCGEQNM”. The covalent binding of this motif to the microbial surface induces phagocytosis or lysis of pathogenic cells (Wu et al., 2012). The thioester motif of Mr-2a2M exhibits high identity to the corresponding regions in other a2Ms (Fig. 3). The thiol ester bond of Mr-2a2M forms between Cys1003 and Gln1006, and several conserved amino acid sequences are located near these residues, suggesting that these amino acids may have important functional

or structural roles in protease entrapment (Lin et al., 2008; Qin et al., 2010) as shown in Figs. 2 and 3. In the catalytic position, Mr-1a2M contains a catalytic serine (Ser), whereas Mr-2a2M contains a catalytic histidine (His) as shown in Figs. 2 and 3. In the Chinese shrimp Fenneropenaeus chinesis, there are multiple forms of a2M (FcA2M-1, FcA2M-2 and FcA2M-3) according to Ma et al. (2010). FcA2M-1 and FcA2M-3 have a catalytic serine (Ser), as in Mr-1a2M, and FcA2M-2 contains a catalytic histidine (His), as in Mr-2a2M. The functional characteristics of these residues may confer opsonic activity (Ma et al., 2010). Additionally, the catalytic His residue increases the reaction rate of covalent binding of the thioester to hydroxyl groups and water (Nonaka, 2000; Mutsuro et al., 2000). Moreover, in vitro mutagenesis of human C3 and C4 has revealed that altering the catalytic His to less nucleophilic residues (Ala, Asn, Ser, and Asp) has similar effects on the substrate specificity of the thioester (Ren et al., 1995; Gadjeva et al., 1998). Finally, the receptor binding domain (RBD), which is located near the C-terminus, functions in binding to the lipoprotein receptor-related protein (LRP). This component is generally a receptor in macrophages, fibroblasts and hepatic cells of higher vertebrates (Bonacci et al., 2007). After entrapping target proteases, the a2M-proteinase complex is cleared via the lysosome system of these cells (Bonacci et al., 2007; Ma et al., 2010). The sequence in the C-terminal region of the RBD of Mr-2a2M is highly conserved among a2Ms (Fig. 3), indicating an essential functional role in binding to cell surface receptors for receptor-mediated endocytosis (Nonaka, 2000). In mammals, the sequence “GFIPLKPTVK” in the Cterminus plays a major role in mammalian receptor binding. The RBD in the C-terminal ends of Fenneropenaeus indicus, Litopenaeus vannamei and Penaeus monodon includes the sequence “GFIPVKDDLK” (Shanthi and Vaseeharan, 2014). Conversely, the sequences in the C-terminal ends of the RBDs of Mr-1a2M and Mr2a2M were slightly differentd“GYIPNKDDLK and GYIPDKADLK”, respectively. In Mr-2a2M, there were eight conserved Lys residues, and four Lys positions were conserved in other crustacean a2Ms. The conserved Lys play a major role in binding to cell surface receptors in the a2Ms of mammals (Nielsen et al., 1996) and crustaceans (Van Leuven et al., 1986; Huang et al., 1986). Additionally, compared with Mr-1a2M, the RBD of Mr-2a2M contained an extra 37 amino acids in the C-terminal region (Fig. 2). This difference in sequence length reflects the specific functional role of this region in binding to specific receptors on the surface membrane of phagocytes. The conservation of the Lys residue and length of the RBD have been suggested to be the results of evolutionary pressure (Huang et al., 1998; Qin et al., 2010).

W. Likittrakulwong et al. / Agriculture and Natural Resources 51 (2017) 25e35

Relative expression ratio

32

16 14 12 10 8 6 4 2 0

(A)

b b aa a

a

Relative expression ratio

0

16 14 12 10 8 6 4 2 0

a

a

3

a a

a

a a

b

a

a b c

6 12 24 Post-injected time (hr)

48

a bb 96

(B)

c

b

a a a

aa a

0

3

a

b

a

6

a

aa a

b a 12

24

a

a b b 48

96

Relative expression ratio

Post-injected time (hr)

16 14 12 10 8 6 4 2 0

(C) b b b a a a 0

a a a

a 3

aaa

a

6 12 24 Post-injected time (hr)

a

a bb

a a a

48

96

Fig. 6. Quantitative real-time reverse transcription polymerase chain reaction analysis of expression of Mr-1a2M of giant freshwater prawns challenged with 1  106 CFU/mL and 1  109 CFU/mL of A. hydrophila in the gills (A), hepatopancreas (B) and hemocytes (C). Data are presented as mean ± SD. Different lowercase letters above each bar indicate significant differences at the same time point (p < 0.05). Black filled bar ¼ 1  109 CFU/mL of A. hydrophila, gray filled bar ¼ 1  106 CFU/mL of A. hydrophila, white filled bar ¼ control.

Comparison analysis of nucleotide and amino acid sequences The Mr-2a2M sequence was compared to other known a2Ms and displayed moderate to low amino acid identities of 58.8%, 56.6%, 47.4%, 41.4% and 41.1% with a2Ms from Chinese white shrimp FcA2M-2, signal crayfish Pl-A2M1, signal crayfish Pl-A2M2, Pacific white shrimp and kuruma shrimp, respectively (Table 2). In addition, Mr-2a2M displayed relatively low nucleotide and amino acid identities to Mr-1a2M of 54.4 and 43.4%, respectively. Phylogenetic analysis of alpha-2 macroglobulin genes Consistent with the above results, phylogenetic analysis revealed that Mr-2a2M is more closely related to Fenneropenaeus

chinensis FcA2M-2 and Pacifastacus leniusculus Pl-A2M1 than to Mr1a2M. However, Mr-1a2M is more closely related to P. leniusculus Pl-A2M2 (Fig. 4). The evolutionary tree also implied two different major clusters of vertebrate and invertebrate a2Ms. This tree clearly demonstrated that the a2Ms of vertebrates diverged before the differentiation of invertebrates investigated in Ma et al. (2010). In the invertebrate cluster, tick and horseshoe crab a2Ms may have diverged first, followed by crustacean a2Ms and finally molluscan a2Ms as the most primitive group (Fig. 4). The current phylogenetic analysis conflicts with that reported by Ho et al. (2009), who examined the evolutionary relationships of a2M genes in crustaceans and observed separate clustering into marine and freshwater clades. With many more sequences, the current tree implies that the a2M gene in invertebrates is not completely differentiated by

W. Likittrakulwong et al. / Agriculture and Natural Resources 51 (2017) 25e35

marine and freshwater characteristics. The upper crustacean a2M subgroup contains the a2Ms of F. chinensis, Scylla serrata and freshwater species (Fig. 4). The other lower subcluster includes a2M members from marine crustaceans. Further analysis with an adequate number of sequences is needed to clarify these results.

subcuticular epithelium, heart, midgut and muscle approximately 785-fold, 592-fold, 572-fold and 564-fold greater than in hemocytes (Fig. 5), indicating that it might have crucial roles in regulating internal proteases of the prawn. However, low expression of Mr-2a2M was observed in the hepatopancreas, ovary and hemocytes. Based on the expression profiles of a2M genes under normal conditions in this experiment and others (Rattanachai et al., 2004; Ma et al., 2010; Wu et al., 2012), crustaceans likely possess at least two functionally different a2Ms. The first group is typically highly expressed in hemocytes to function in immunosurveillance. The other group is absent or expressed at low levels in hemocytes and expressed highly in other tissues to support local immune responses in parts of the crustacean body.

Tissue distribution of Mr-2a2M mRNA expression Previous expression analysis of a2M in giant freshwater prawn under normal conditions indicated that Mr-1a2M was highly expressed in hemocytes, moderately expressed in the hepatopancreas and weakly expressed in the muscles, highgut and foregut (Ho et al., 2009). By comparison, Mr-2a2M is highly expressed in the

Relative expression ratio

33

25

(A)

20 15

b

10

c

5

a a a

aa a

a a a

aa a

a aa

3

6

12

24

a b

c a

0 0

48

96

Relative expression ratio

Post-injected time (hr) 25

(B)

c

20

b

15

c

10 5

a a a

a a a

0

3

a b

a

a a a

a a a

a a a

24

48

96

0 6

12

Relative expression ratio

Post-injected time (hr) 120

b

(C)

100 80

ab

60 40 20 0

a a a 0

a a a

a a a

3

6

a

a a a

a a a

a a a

24

48

96

12

Post-injected time (hr) Fig. 7. Quantitative real-time reverse transcription polymerase chain reaction analysis of expression of Mr-2a2M of giant freshwater prawns challenged with 1  106 CFU/mL and 1  109 CFU/mL of A. hydrophila in the gills (A), hepatopancreas (B) and hemocytes (C). Data are presented as means ± SD. Different lowercase letters above each bar indicate significant differences at the same time point (p < 0.05). Black filled bar ¼ 1  109 CFU/mL of A. hydrophila, gray filled bar ¼ 1  106 CFU/mL of A. hydrophila, white filled bar ¼ control.

34

W. Likittrakulwong et al. / Agriculture and Natural Resources 51 (2017) 25e35

Expression analysis of Mr-1a2M and Mr-2a2M mRNA in giant freshwater prawn infected with A. hydrophila A. hydrophila is a major pathogenic bacterium that can cause serious disease outbreaks in giant freshwater prawn. A. hydrophila is an opportunistic pathogen that results in “black-spot” necrosis and gill obstruction in the prawn (Sung et al., 2000; Sahoo et al., 2007). A. hydrophila can produce many virulence factors, such as hemolysins, cytotoxins, aerolysin-related cytotoxic enterotoxin (Act), proteases, lipases, leucocidins and other endotoxins (Sung and Hong, 1997). These factors affect the prawn via different mechanisms. This bacterium is rapidly circulated to different tissues, such as the gills, heart, hemocytes and hepatopancreas, within 1 h after injection and is rapidly cleared from the circulation system within 12 h after injection (Sahoo et al., 2007). In the present study, Mr-1a2M and Mr-2a2M expression in response to different concentrations of A. hydrophila was investigated in the gills, hepatopancreas and hemocytes. Mr-1a2M was slightly increased in these organs but clearly down-regulated at 48e96 h in the gills and hemocytes and at 6 h, 12 h and 96 h in the hepatopancreas (p < 0.05) as shown in Fig. 6AeC. This result suggested that A. hydrophila oppositely affects the expression of Mr-1a2M in these organs. Conversely, in the hepatopancreas and hemocytes, Mr-2a2M expression levels were strongly induced during the early stages of infection (6 and 12 h; p < 0.05) as shown in Fig. 7B and C. In the gills, Mr-2a2M expression increased in the last stages of infection (48 h and 96 h; p < 0.05) as shown in Fig. 7A. No suppressed expression was observed. These results suggested that Mr-2a2M may have crucial roles in rapidly protecting the prawn from A. hydrophila infection and compensating for the down-regulated effects of Mr-1a2M to scavenge the harmful proteases released from the pathogen. This information is similar to many reports involving, for example, Chinese shrimp (Ma et al., 2010) and the Indian white shrimp, F. indicus (Shanthi and Vaseeharan, 2014). Taken together with the present results, these findings suggest that a2Ms in crustaceans are acute phaseresponse molecules responsible for regulating harmful proteases from pathogens and internal proteases in the crustacean immune system. Notably, the present study observed that Mr-2a2M expression was low in hemocytes under normal conditions but strongly elevated to high expression levels (83.72-fold change and 42.83fold-change; p < 0.05) in only one short period (12 h) in hemocytes after infectious stimulation by A. hydrophila (Fig. 7C). This result suggested that Mr-2a2M is crucial for rapid compensatory effects when Mr-1a2M is suppressed in all tested tissues. Additionally, the different concentrations of injected bacteria (1  106 CFU/mL and 1  109 CFU/mL of A. hydrophila) elicited different patterns of Mr-1a2M and Mr-2a2M expression at various time points. These results indicated that higher concentrations of bacteria more strongly elevate the expression levels of these two a2Ms of giant freshwater prawns than lower concentrations, albeit with different patterns in different organs. Based on the characterization, sequence, phylogenetic, and expression analyses by qRT-PCR under both normal and infectious conditions in the present study, a second a2M gene (Mr-2a2M) has been clearly identified in giant freshwater prawn. Similar to other reported a2Ms in crustaceans, Mr-1a2M and Mr-2a2M acutely responded to pathogenic infection during the early phase of infection. a2Ms in crustaceans crucially function as acute-phase molecules important in pattern recognition protein processing for the rapid regulation of external and internal proteases in the immune system. This information is vital for a greater understanding of the functions, molecular evolution and immunological mechanisms of the a2M gene in crustaceans.

Conflict of interest The authors declare no conflicts of interest. The authors alone are responsible for the content of this manuscript. Acknowledgments This research was supported by the National Science and Technology Development Agency (NSTDA P-10-10779) and a scholarship provided by the Commission on Higher Education in 2007. References Armstrong, P.B., Quigley, J.P., 1999. a2-macroglobulin: an evolutionarily conserved arm of the innate immune system. Dev. Comp. Immunol. 23, 375e390. Armstrong, P.B., 2001. The contribution of proteinase inhibitors to immune defense. Trends Immunol. 22, 47e52. € derha €ll, K., 1990. The effect of endogeneous proteinase inAsp
an, A., Hall, M., So hibitors on the prophenoloxidase activating enzyme, a serine proteinase from crayfish haemocytes. Insect Biochem. 20, 485e492. Bonacci, G.R., C
aceres, L.C., S
anchez, M.C., Chiabrando, G.A., 2007. Activated alpha(2)-macroglobulin induces cell proliferation and mitogen-activated protein kinase activation by LRP-1 in the J774 macrophage-derived cell line. Arch. Biochem. Biophys. 460, 100e106. Gadjeva, M., Dodds, A.W., Taniguchi-Sidle, A., Willis, A.C., Isenman, D.E., Law, S.K., 1998. The covalent binding reaction of complement component C3. J. Immunol. 161, 985e990. Ho, P.Y., Cheng, C.H., Cheng, W., 2009. Identification and cloning of the a2macroglobulin of giant freshwater prawn Macrobrachium rosenbergii and its expression in relation with the molt stage and bacteria injection. Fish. Shellfish Immunol. 26, 459e466. Huang, W., Dolmer, K., Liao, X., Gettins, P.G., Van den Berghe, H., 1986. Localization of basic residues required for receptor binding to the single alpha 2macroglobulin: isolation after limited proteolysis with a bacterial proteinase. J. Biol. Chem. 261, 11369e11373. Huang, W., Dolmer, K., Liao, X., Gettins, P.G., 1998. Localization of basic residues required for receptor binding to the single alpha-helix of the receptor binding domain of human alpha2-macroglobulin. Protein Sci. 7, 2602e2612. Lengbumrung, J., Somsiri, T., Tandavanitj, S., 2007. Motile Aeromonas septicemia infection in giant freshwater prawn, Macrobrachium rosenbergii. Thail. Fish. Gaz. 60, 147e151. Lin, Y.C., Vaseeharan, B., Chen, J.C., 2008. Molecular cloning and phylogenetic analysis on alpha2-macroglobulin (alpha2-M) of white shrimp Litopenaeus vannamei. Dev. Comp. Immunol. 32, 317e329. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402e408. Ma, H., Wang, B., Zhang, J., Li, F., Xiang, J., 2010. Multiple forms of alpha-2 macroglobulin in shrimp Fenneropenaeus chinesis and their transcriptional response to WSSV or Vibrio pathogen infection. Dev. Comp. Immunol. 34, 677e684. Mutsuro, J., Nakao, M., Fujiki, K., Yano, T., 2000. Multiple forms of a2-macroglobulin from a bony fish, the common carp (Cyprinus carpio): striking sequence diversity in functional sites. Immunogenetics 51, 841e855. Na-Nakorn, U., Jintasataporn, O., 2012. Current status and prospects of farming the giant river prawn (Macrobrachium rosenbergii de Man 1879) in Thailand. Aquac. Res. 43, 1015e1022. Nielsen, K.L., Holtet, T.L., Etzerodt, M., Moestrup, S.K., Gliemann, J., SottrupJensen, L., 1996. Identification of residues in alpha2-macroglobulins important for binding to the alpha 2-macroglobulin receptor/low density lipoprotein receptor-related protein. J. Biol. Chem. 271, 12909e12912. Nonaka, M., 2000. Origin and evolution of the complement system. Curr. Top. Microbiol. Immunol. 248, 37e50. On-ming, S., Areechon, N., Thunyanuki, S., Srisapoome, P., 2007. Discovery and sequence analyses of immune-related genes expressed from hemocytes of giant freshwater prawn (Macrobrachium rosenbergii), 183e194. In: Proceedings of 45th Kasetsart University Annual Conference, Fisheries Section. Kasetsart University, Bangkok. Qin, C., Chen, L., Qin, J.G., Zhao, D., Zhang, H., Wu, P., Li, E., Yu, N., 2010. Molecular cloning and characterization of alpha 2-macroglobulin (a2-M) from the haemocytes of Chinese mitten crab Eriocheir sinensis. Fish. Shellfish Immunol. 29, 195e203. Rattanachai, A., Hirono, I., Ohira, T., Takahashi, Y., AoKi, T., 2004. Molecular cloning and expression analysis of a2-macroglobulin in the kuruma shrimp, Marsupenaeus japonicus. Fish. Shellfish Immunol. 16, 599e611. Ren, X.D., Dodds, A.W., Enghild, J.J., Chu, C.T., Law, S.K., 1995. The effect of residue 1106 on the thioester-mediated covalent binding reaction of human complement protein C4 and the monomeric rat alpha-macroglobulin alpha 1 I3. FEBS Lett. 368, 87e91. Sahoo, P.K., Pillai, B.R., Mohanty, J., Kumari, J., Mohanty, S., Mishra, B.K., 2007. In vivo humoral and cellular reactions, and fate of injected bacteria Aeromonas

W. Likittrakulwong et al. / Agriculture and Natural Resources 51 (2017) 25e35 hydrophila in freshwater prawn Macrobrachium rosenbergii. Fish. Shellfish Immunol. 23, 327e340. Shanthi, S., Vaseeharan, B., 2014. Alpha 2 macroglobulin gene and their expression in response to GFP tagged Vibrio parahaemolyticus and WSSV pathogens in Indian white shrimp Fenneropenaeus indicus. Aquaculture 418, 48e54. Sӧderhӓll, K., Aspan, A., Duvic, B., 1990. The proPO-system and associated proteins; role in cellular communication in arthropods. Res. Immunol. 141, 896e907. Sung, H.H., Hong, T.Y., 1997. The Gram-negative bacterial flora in hepatopancreas of giant freshwater prawn (Macrobrachium rosenbergii): antibiotic sensitivities and production of extracellular products. J. Fish. Soc. Taiwan 24, 211e223. Sung, H.H., Hwang, S.F., Tasi, F.M., 2000. Responses of giant freshwater prawn (Macrobrachium rosenbergii) to challenge by two strains of Aeromonas spp. J. Invertebr. Pathol. 76, 278e284.

35

Toe, A., Areechon, N., Srisapoome, P., 2012. Molecular characterization and immunological response analysis of a novel transferrin-like, pacifastin heavy chain protein in giant freshwater prawn, Macrobrachium rosenbergii (De Man, 1879). Fish. Shellfish Immunol. 33, 801e812. Van Leuven, F., Marynen, P., Sottrup-jensen, L., Cassiman, J.J., Van den Berghe, H., 1986. The receptor-binding domain of human alpha 2-macroglobulin. Isolation after limited proteolysis with a bacterial proteinase. J. Biol. Chem. 261, 11369e11373. €derha €ll, I., So €derha €ll, K., 2012. An insect TEP Wu, C., Noonin, C., Jiravanichpaisal, P., So in a crustacean is specific for cuticular tissues and involved in intestinal defense. Insect Biochem. Mol. Biol. 42, 71e80. Yoganandhan, K., Leartvibhas, M., Sriwongpuk, S., Limsuwan, C., 2006. White tail disease of the giant freshwater prawn Macrobrachium rosenbergii in Thailand. Dis. Aquat. Org. 69, 255e258.