Identification and functional analysis of chitinase 7 gene in white-backed planthopper, Sogatella furcifera

    Identification and Functional Analysis of Chitinase 7 Gene in White-backed Planthopper, Sogatella furcifera Chen Chen, Hong Yang, Bin Tang, Wen-Jia Yang, Dao-Chao Jin PII: DOI: Reference:

S1096-4959(17)30044-1 doi:10.1016/j.cbpb.2017.03.002 CBB 10082

To appear in:

Comparative Biochemistry and Physiology, Part B

Received date: Revised date: Accepted date:

27 December 2016 21 March 2017 24 March 2017

Please cite this article as: Chen, Chen, Yang, Hong, Tang, Bin, Yang, Wen-Jia, Jin, Dao-Chao, Identification and Functional Analysis of Chitinase 7 Gene in White-backed Planthopper, Sogatella furcifera, Comparative Biochemistry and Physiology, Part B (2017), doi:10.1016/j.cbpb.2017.03.002

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT

T

Identification and Functional Analysis of Chitinase 7 Gene in White-backed Planthopper, Sogatella furcifera

IP

Chen Chen1, Hong Yang1,2,*, Bin Tang3，Wen-Jia Yang4，Dao-Chao Jin1

Institute of Entomology, Guizhou University, Guiyang, Guizhou, 550025, China; College of Tobacco Science of Guizhou University, Guiyang, Guizhou, 550025, China; 3 Hangzhou Key Laboratory of Animal Adaptation and Evolution, College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou 310036, China; [email protected] (B.T.) 4 Key & Special Laboratory of Guizhou Education Department for Pest Control and Resource Utilization, College of Biology and Environmental Engineering, Guiyang University, Guiyang 550005, China; [email protected] (W.-J.Y.); * Correspondence: [email protected]; Tel.: +86-13985470482 1

Academic Editor: name Received: date; Accepted: date; Published: date

NU

SC R

2

AC

CE P

TE

D

MA

Abstract: Chitinase is used to degrade chitin in insect cuticles and the peritrophic matrix. In this study, the full-length cDNA sequence of a Cht gene (SfCht7) was identified and characterized from the white-black planthopper, Sogatella furcifera. The SfCht7 cDNA was 3148 bp, contained an open reading frame of 2877 bp and encoded 958 amino acids with a predicted molecular weight of 107.9 kDa. Homology analysis indicated that SfCht7 has typical chitinase features include a chitin-binding domain, two catalytic domains and a signal peptide region. Phylogenetic analysis suggested that SfCht7 belonged to the group III chitinases. Quantitative real-time PCR analyses showed that SfCht7 was highly expressed before molting. After injecting SfCht7 double-stranded RNA in the nymph stage, insects exhibited phenotypes of difficulty in molting and wing development. A lethal phenotype was that nymph bodies exuviated from the head but the old cuticle did not detach completely from the body. Another lethal phenotype was that elongated distal wing pads of fifth-instar nymphs with junctions between the thorax and abdomen in the treatment group that were thinner than in the control group, giving a “wasp-waisted” appearance. In another phenotype that was not lethal, nymphs exuviated and old cuticles detached completely from the body, but the wings of adults did not stretch normally. Keywords: Chitinase; Eclosion; Rice planthopper; Sogatella furcifera; Wing extension

1. Introduction Chitin, a β-(1, 4)-linked polymer of N-acetyl-β-D-glucosamine, is distributed widely in fungi, insects, nematodes, algae, protists, sponges, rotifers, arthropods, cuttlefish, brachiopods and mollusks (Merzendorfer, 2013). In insects, chitin is the main structural component of the cuticle, which is a complex exoskeleton. Chitin is also found in the internal structures of many insects, including the inner cuticular linings of the alimentary canal, genital ducts, tracheal system, and the ducts of the various dermal glands. The alimentary canals of most insects contain a chitinous peritrophic matrix (PM), which is an essential component of the insect intestinal tract that surrounds the food bolus and compartmentalizes digestion (Moussian, 2010, Zhu, 2016). As a major component of cuticles that form the exoskeleton, chitin protects insects and helps them maintain shape and limits their growth. To grow and develop, insects must degrade old cuticles and synthesize new ones (Kramer et al., 1993; Kramer and Koga, 1986; Merzendorfer and Zimoch, 2003;

ACCEPTED MANUSCRIPT 2 of 13

AC

CE P

TE

D

MA

NU

SC R

IP

T

Zhu et al., 2008a). Chitin degradation is catalyzed by several hydrolytic enzymes including chitinase, proteinase and lipase (Kramer et al., 1993). In insects, chitinases are involved in digestion processes and molting. Cuticle in insects is the target site of chitinolytic enzymes and its damage affects survival (Hegedus et al., 2009). Insect chitinases are members of the family 18 glycoside hydrolases (GH18) (Kramer and Muthukrishnan, 2005). When insects molt, chitinases are involved in the turnover of the cuticle and PM. Insect chitinases have other functions such as in digestion and immunity, and act as growth factors and regulate abdominal contraction and wing expansion (Arakane and Muthukrishnan, 2010; Zhu et al., 2008b). The first full-length cDNA sequence of an insect chitinase gene was obtained from Manduca sexta (Kramer et al., 1993). Currently, hundreds of chitinase genes are available from different insect species, for example from Ostrinia furnacalis (Lepidoptera), Nilaparvata lugens (Hemiptera), Locusta migratoria (Orthoptera), Anopheles gambiae (Diptera), Chelonas sp. (Hymenoptera), and Lutzomyia longipalpis (Neuroptera) (Krishnan et al., 1994; Li et al., 2015; Ramalho-Ortigao and Traub-Csekö, 2003; Shen and Jacobs-Lorena, 1997; Wu et al., 2013; Xi et al., 2015). Insect chitinases are assigned into eight groups based on sequence homology and phylogenetic analyses (Arakane and Muthukrishnan, 2010; Zhu et al., 2008a). GH18 chitinase and chitinase-like proteins are usually endo-splitting enzymes but also include catalytically inactive proteins, such as endo-β-N-acetylglucosaminidases (ENGases), imaginal disc growth factors (IDGFs), stabilin-1 interacting chitinase-like proteins (SI-CLPs) and chitolectins (Funkhouser & Aronson, 2007). The group III chitinases are encoded by a representative gene in a variety of species. The group III chitinase genes have an ancient origin, deduced from the identification of these genes and their orthologs in a variety of insect species (Arakane and Muthukrishnan, 2010). Experiments on Tribolium castaneum chitinase genes indicate that group III genes function in contracting abdomens and expending elytra (Zhu et al., 2008b). The white-backed planthopper (WBPH), Sogatella furcifera (Horvath), is one of the most destructive rice pests. It causes slow rice growth and putrescence by sucking the rice phloem sap (Liang et al., 2016). S. furcifera transmits the southern rice black-streaked dwarf virus, which belongs in the genus Fijivirus (family Reoviridae) (Zhou, 2008). The virus damaged more than 500,000 ha of rice in 2012 in Vietnam and China (Matsukura et al., 2013). The WBPH has two types of wing dimorphism: short-winged and long-winged. Long-winged adults are good at migrating, while short-winged insects lay more eggs (Ayoade et al., 1999; Denno et al., 1989). Previous studies report using RNA interference (RNAi) technology to control pests by silencing vital genes (Baum et al., 2007). Other studies report double-strand RNAs (dsRNAs) can be absorbed orally by N. lugens to decrease transcript levels of target genes (Chen et al., 2010; Zha et al., 2011). Thus, genetically modified rice that expresses dsRNAs for vital genes might be used to control pests. Therefore, finding sensitive target genes for use in S. furcifera control by RNAi is important. In this paper, we studied the chitinase 7 gene of WBPH (SfCht7), a group III gene. We obtained the full-length cDNA sequence of this gene and profiled its developmental expression patterns. RNAi was used to gain insights into the biological function of SfCht7. Our results showed that SfCht7 was essential for eclosion and wing expansion in S. furcifera. 2. Materials and Methods 2.1. Insects WBPH (S. furcifera) was collected from a rice field in the Hua Xi district, Guizhou, and reared on nontoxic rice, Taichung Native 1 (TN1), at 26 ± 1 °C and 70% humidity with a 16:8 h light: dark cycle for more than three generations. Adults and nymphs were reared in transparent cuvettes without bottoms (height: 30 cm; diameter: 3 cm) at 20 insects per cuvette. 2.2. Sequencing of chitinase 7 cDNA Degenerate primers were designed and used to amplify internal cDNA fragments, obtaining 1563-bp and 789-bp cDNA fragments of chitinase 7. PCR reactions were carried out using the following conditions: initial denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s,

ACCEPTED MANUSCRIPT 3 of 13

annealing at 45 °C for 30 s, elongation at 72 °C for 90 s for 3 cycles; denaturation at 94 °C for 30 s, annealing at 48 °C for 30 s, elongation at 72 °C for 60 s for 28 cycles; elongation at 72 °C for 10 min using Takara (Japan) Taq polymerase. Specific primers for amplification of 3'-ends and 5'-ends were designed using Primer Premier 5.0 (Premier, Canada). Primer sequences are in Table 1. Using

T

SMARTer® RACE kits (Clontech, Mountain View, CA, USA), 3'-RACE (rapid-amplification of cDNA

IP

ends) and 5'-RACE were performed. Total RNA was extracted from 10 third-day fifth-instar nymphs using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). Synthesis of first-strand cDNA and

SC R

PCR amplifications followed the instructions of SMARTer® RACE kits. SeqAmp DNA Polymerase (a SMARTer® RACE kits component) was used to RACE PCR. PCR were: 30 cycles 94 °C for 30 s, 65–70 °C (depending on primers) for 30 s, and 72 °C for 2 min; with extension at 72 °C for 10 min. Overlapping PCR products were purified using E.Z.N.A ® Gel Extraction kits (Omega Bio-Tek,

NU

Norcross, GA, USA) and cloned into linearized pRACE vector (a SMARTer ® RACE 5'/3' kit component), and sequenced by Invitrogen Trading (Shanghai, China). Sequences obtained were

2.3. cDNA and protein sequence analyses

MA

assembled for the full-length SfCht7 cDNA sequence.

AC

CE P

TE

D

The full-length sequence of SfCht7 cDNA was edited using DNAMAN software (Version 7.0, Lynnon BioSoft, California, Canada). Homology searches were performed using the BLAST tool at the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/BLAST). The ORF (open reading frame) of SfCht7 cDNA was identified by ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Characteristics of the protein sequence encoded by the cDNA such as molecular weight, amino acid composition and predicted pI, were analyzed by the ExPASy Proteomics website (http://www.expasy.org). The domain architecture of the amino acid sequences was predicted using the online program SMART (http://smart.embl-heidelberg.de/). Phylogenetic trees were constructed using the software MEGA 5.0 package with NJ (neighbor-joining), ML (Maximum likelihood) and MP (Maximum parsimony) methods. Bootstrap analysis was performed and robustness of each cluster was confirmed in 1000 replications. The SWISS-MODEL program (http://swissmodel.expasy.org//SWISS-MODEL.html) was used to generate homology models of the two catalytic domains of S. furcifera Chitinase 7 (SfCht7). The homology modeling of the first catalytic domain of SfCht7 (86bp-431bp) was performed using acidic mammalian chitinase (PDB entry code 3fy1) (Olland et al., 2009) as the template. The second catalytic domain homology modeling was conducted using the acidic mammalian chitinase (PDB entry code 1hkk) as the template (Rao et al., 2003). 2.4. Developmental-dependent expression of SfCht7 To analyze mRNA in different developmental stages, qPCR (real-time quantitative PCR) was performed on a CFX96TM real-time quantitative PCR system (Bio-Rad, Hercules, CA, USA). The primers for qPCR are shown in Table 1. The standard curve equation of q-SfCht7-F and q-SfCht7-R is Y=-3.4249log(x) + 23.7070 and the value of R2 is 0.9578. The primer efficiency is 95.88 %. The region of the position 1078-1225 in the SfCht7 cDNA sequence was amplified by qPCR. Samples for isolating total RNA were from insects at 12 developmental stages from 1-day-old first-instar nymphs (1L1) to 1-day-old adults (AL). The isolated total RNA was treated with DNase to remove contaminating gDNA. The method was mixing 5 x gDNA Eraser Buffe, gDNA Eraser, RNA and RNase Free H2O following the instruction of PrimeScript® 1st strand cDNA Synthesis kits (Takara, Dalian, China), then put the mixture in PCR equipment at 42 °C for 2 min. Total RNA and purified RNA were quantified by Thermo Scientific NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA,

ACCEPTED MANUSCRIPT 4 of 13

USA), following manufacture's protocols. RNA purity was determined by measuring the absorbance ratio 260/280. The A260/280 ratios were generally between 1.9 and 2.0. 1μg RNA was used to generate cDNAs. PrimeScript® 1st strand cDNA Synthesis kits (Takara) were used to synthesize first-stand cDNA. Samples were collected from insects at 12 developmental stages

T

ranging from 1-day-old first-instar nymphs (1L1) to adults (AL), with three collections for each

IP

developmental stage. Three samples were taken for each developmental stage. The first-instar, second-instar, three-instar and fourth-instar stages last 2 days and the fifth-instar stage lasts 3 days

SC R

at 25 °C. Thus, 12 developmental stages were chosen. S. furcifera 18S ribosome RNA gene (18S) (Yu et al., 2014) was selected as a housekeeping reference gene for normalizing expression between samples. The 20-μl PCR mixtures contained 10-μl iTaqTM Universal SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA), 1-μL template cDNA (1 μg /μl), 1-μL 10-μM of each primer and 7-μL

NU

deionized water. Thermal cycling was: 95 °C for 30 s, 40 cycles of 95 °C for 10 s, 59 °C for 30 s and 65 °C for 5 s. Amplification specificity was confirmed using dissociation curves at the last procedure. Samples were cooled to 65 °C after denaturing and melting curves obtained by automatically △△CT

analyzed according to the 2-

MA

increasing 1.5 °C per 15 s per cycle to 95 °C. The cycle threshold (Ct) value was recorded and method (Pfaffl, 2001). One-way analysis of variance (ANOVA) was

used to analyze significant differences between samples and Duncan’s test was performed for level

TE

2.5. RNAi of chitinase 7 gene (SfCht7)

D

of significance at 0.05 using SPSS 20.0 software.

The region 1195–1629 in the SfCht7 cDNA sequence was used to generate 485-bp dsRNAs against SCht7. The region was well conserved and 707-bp dsRNAs against GFP were generated.

CE P

dsRNAs against SCht7 and GFP were synthesized using TranscriptAid T7 High Yield Transcription Kits (Thermo, Waltham, MA, USA). Primers for dsRNA synthesis of SfCht7 and GFP were designed by Primer 6.0 software and are in Table 1. As negative controls, dsRNAs for GFP were injected. Templates with the T7 RNA promoter were synthesized using the program: 95 °C for 5 min; 5 cycles

AC

of 95 °C for 30 s, 50 °C for 30 s and 72 °C for 1 min; 25 cycles of 95 °C for 30 s, 70 °C for 30 s and 72 °C for 1 min; and 72 °C extension for 10 min. PCR products were purified using E.Z.N.A ® Gel Extraction kits (Omega Bio-Tek). Purified product was used as template to synthesize dsRNA according to the instructions of TranscriptAid T7 High Yield Transcription Kit. The dsRNA synthesized was purified, and the method of purification was as follows. DNase I (2 μl) was added into a PCR tube with 20 μl RNA and incubated at 37°C for 15 min; and then 2μl EDTA was added into the tube and incubated at 65°C for 10 min. At room temperature, the fluid in the PCR tube was transferred into an EP (Eppendorf) tube (1.5 ml), and then 115 μl nuclease-free water and 15 μl 3M sodium acetaet solution were added and mixed. The mixture of water saturated phenol and chloroform was made at the ratio of 1:1. The 150 μl mixture of water saturated phenol and chloroform was added to EP tube, and then 300 μl chloroform was added and mixed. The tube was centrifuged at 12,000 x g at 4°C for 10 min. Upper aqueous phase was transferred into a fresh EP tube (1.5 ml), and added with 400 μl absolute ethyl alcohol and mixed. And then let the tube stand in fridge at -20°C for 2 h. The tube was centrifuged at 7,500 x g at 4°C for 5 min. Then upper aqueous phase was discarded and sediment was air-dried in superclean bench for 15 to 20 min. Nuclease-free (50 μl) water was added into the tube to dissolve the sediment. Because of insect sizes and effects of injections, 1-day-old fifth-instar nymphs were microinjected. Before injecting, a 3% agarose plate

ACCEPTED MANUSCRIPT 5 of 13

and capillary made into microscopic needles by micropipette puller were prepared. Injected nymphs were treated with carbon dioxide for around 5 s until they were unconscious, and put on agarose plates. Before injection, nymphs were adjusted so abdomens were facing upwards. The glass capillaries for Nanoliter 2010 (outer diameter of 1.14mm, inner diameter of 0.53 mm) were

T

used. Microscopic needles were made from glass capillaries using a PUL1000 micropipette puller

IP

(World Precision Instruments, FL, USA). Insects were injected at the conjunction site between the prothorax and the mesothorax (Liu et al., 2010) with 100 ng dsRNAs using a Nanoliter 2010 Injector

SC R

(injection speed, slow = 23 nl/s) (World Precision Instruments). There were 150 insects for three biological replicates. Each biological replicate included fifty insects. Six injected nymphs were

collected for each repetition to evaluate RNAi effects.

NU

Table 1. Primers used in this study Primer Name

Primer Sequence (5'–3')

RT-PCR

SfCht7–F1

GCACNCACRTYATCTTCGC

SfCht7–R1

CGTADACGAAYTGRTTCA

SfCht7–F2

GGCBTTYGGHTCNACTCC

SfCht7–R2

TCCATRTCBAYVGACCA

SfCht7–5–1

GAAGGGAATGGCCGAGTAGATG

SfCht7–5–2

CCATCCTCCAATAGCCAGCAGAG

SfCht7–3–1

3′ RACE

SfCht7–3–2 q– SfCht7–F

D

TCGCCTACAGAAAGGACCAGTG CGGAATGCCAACTTACGGACGC

q– SfCht7–R

CGCAGCATCTCGCACACCTCATAG

q–18S–F

ACAAGTATCAATTGGAGGGCAAGTCTGG

q–18S–R

ATGCACACAGTATACAGGCGTGACAAG

AC

dsRNA

GAGAAGTTGATGATTGGTATGCC

CE P

qPCR

TE

5′ RACE

MA

Purpose

dsCht7–F

GGATCCTAATACGACTCACTATAGGTGGCTT

dsGFP–F

GGATCCTAATACGACTCACTATAGGAAGGG

dsCht7–R

synthesis*

ACTATGAGGTGT GGATCCTAATACGACTCACTATAGGCAGTA

1495 773 698 617 147 250

485

GTGGTCCTCTCG CGAGGAGCTGTTCACCG

dsGFP–R

product bp

GGATCCTAATACGACTCACTATAGGCAGCA

707

GGACCATGTGATCGCGC * Bold at 5’ ends: T7 RNA polymerase promoter of 20 nucleotides; A: adenine; T: thymine; C: cytosine; G:

guanine. 2.6. Data analysis The cDNA sequence of SfCht7 was submitted to the DDBJ/EMBL/GenBank databank under accession number KY290391. Each developmental stage had three biological repeats. ANOVA was used to analyze significant differences between samples and Duncan’s test was performed for level of significance at 0.05 using SPSS 20.0 software (SPSS, Chicago, USA). Significant differences between treatment and control in RNAi experiments were analyzed using t-test.

ACCEPTED MANUSCRIPT 6 of 13

3. Results 3.1. cDNA sequence of SfCht 7 and characterization

MA

NU

SC R

IP

T

The cDNA sequences of Nilaparvata lugens Chitinase 7 (KM217115), Tribolium castaneum Chitinase 7 (NM_001042570), Drosophila melanogaster Chitinase 7 (NM_139511), Spodoptera exigua Chitinase 7 (JQ653039), and Pediculus humanus corporis conserved hypothetical proteins (XM_002425436) were aligned to clarify the conserved regions of chitinase from other insects. Degenerate PCR regions were conserved across group III. Positions 439–1933 and 1883–2655 in the SfCht7 cDNA sequence were obtained using degenerate primers. The sizes of amplimers were different from expected sizes of 1529 bp and 788 bp, with amplified sizes of 1494 bp and 772 bp. The full-length cDNA sequence of SfCht7 (GenBank accession number: KY290391) was 3148 bp. The sequence had a 2877-bp ORF encoding 958 amino acid residues with a predicted molecular weight of 107.92 kDa and a predicted pI of 6.69, plus a 95-bp non-coding region at the 5’-end and a 176-bp non-coding region at the 3’-end (Fig. 1). A polyadenylation signal (AATAAA) was detected 8 bp upstream from the poly-A tail. The deduced protein of SfCht7 seemed to be secreted, as a signal peptide of 24 amino acids was found in the N-terminal region (Fig. 1). The predicted protein contained a chitin-binding domain (amino acids 910–958). Highly conserved structural regions at amino acids 202–210 (FDGLDMDWE) and 629–637 (FNGLDIDWE) confirmed that the protein belonged to GH18. Multiple protein alignments illustrated that the chitinase 7 of WBPH (SfCht7) had homology to known and predicted chitinase homologs in

D

different insect species. SfCht7 had 96% identity with chitinase from N. lugens, and 77% with

TE

chitinases from O. furnacalis, T. castaneum and S. exiqua. SfCht7 did not contain N-glycosylation sites and contained 67 possible phosphorylation sites (Table 2). According to the results of phylogenetic trees, insect chitinase-like proteins were classified into 10 groups: I–VIII,

CE P

endo-β-acetylglucosaminidase and imaginal disc growth factors. Five groups (I−V)were previously described in D. melanogaster (Zhu et al., 2008a), and another five groups (VI−VIII, SI-CLP and ENGase) have been reported in Acyrthosiphon pisum (Nakabachi et al., 2010). SfCht7 belonged to the group III chitinases. Homology modeling showed that the both the catalytic domains of SfCht7

AC

probably had (βα)8 TIM barrel structures and an additional a-helix was not present (Fig. 3).

Table 2. Possible phosphorylation sites of SfCht7

Phosphorylation site numbers *Thr, threonine; Ser, serine and Tyr, tyrosine.

Thr

Ser

Tyr

20

34

13

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

MA

NU

SC R

IP

T

7 of 13

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

MA

NU

SC R

IP

T

8 of 13

ACCEPTED MANUSCRIPT

MA

NU

SC R

IP

T

9 of 13

AC

CE P

TE

D

Figure: 1. Full-length nucleotide and amino acid sequences of the SfCht7 gene. The start codon is indicated with bold, the stop codon is indicated with bold and an asterisk, the coded amino acid sequence is in one-letter code under the nucleotide sequence, the AATAAA-box is highlighted in green, the predicted signal peptide is underlined, the conserved GH18 signature sequence is double underlined, the putative signal catalytic domain is shaded, and the chitin-binding domain has a black background.

Maximum likelihood tree

Neighbor Joining tree

Maximum Parsimony tree

Figure: 2. Phylogenetic trees of chitinase-like proteins from seven insect species. The trees were generated using MEGA5 software with ML, NJ and MP methods. Bootstrap analyses of 1000

ACCEPTED MANUSCRIPT 10 of 13

MA

NU

SC R

IP

T

replicates were performed and bootstrap values represented in cladograms. Amino acid sequences coded by chitinase-like genes from different insect species were chosen for analysis. The following insect chitin synthase sequences were used: Apis mellifera (Am), Drosophila melanogaster (Dm), Nilaparvata lugens (Nl), Pediculus humanus corporis (Ph), Tribolium castaneum (Tc), Ostrinia furnacalis (Of), Spodoptera exigua (Se). Sequences (GenBank accession numbers) used were: AmCLP (XP_006570737.1), AmENGase (XP_006558113.1), AmGB17733 (XP_006570346.1), BmCLP (XP_004925076.1), BmENGase (XP_004922019.1), DmCht2 (NP_477298.2), DmCht3 (NP_001036422.1), DmCht4 (NP_524962.2), DmCht5 (NP_650314.1), DmCht6 (NP_001245599.1), DmCht7 (NP_647768.3), DmCht8 (NP_611542.2), DmCht9 (NP_611543.3), DmCht11 (NP_572361.1), DmIDFG1 (NP_477258.1), DmIDFG2 (NP_477257.2), DmIDFG3 (NP_477256.1), DmIDFG4 (NP_511101.2), NlCht2 (AJO25037.1), NlCht4 (AJO25039.1), NlCht5 (AJO25040.1), NlCht6 (AJO25041.1), NlCht7 (AJO25042.1), NlCht8 (AJO25043.1), NlCht10 (AJO25045.1), NlENGase (AJO25057.1), PhCLP (XP_002428757.1), TcCht6 (AAW67572.1), TcCht7 (NP_001036035.1), TcCht8 (NP_001038094.1), TcCht10 (NP_001036067.1). OfCht (AGX32025), SeCht7 (AFM38213.1), TcIDGF2(ABG47451.1), TcIDGF4(ABG47452.1), TcENGase (XP_008197368.1), TcCLP (KYB29493.1), Ph_PHUM257700 (XP_002426510.1), Ph_PHUM262090 (XP_002426602.1), Ph_PHUM262080 (XP_002426601.1), Ph_PHUM203740 (XP_002425481.1), Ph_PHUM175040 (XP_002425126.1), Ph_PHUM035560 (XP_002423089.1), PhENGase (XP_002423894.1), DmIDGF5 (NP_611321.3), DmIDGF6 (NP_477081.1), Am_GB12784 (XP_006572082.1), Am_GB15345 (XP_016770372.1), Am_GB11870 (XP_396925.3).

B

AC

CE P

TE

D

A

Figure 3. Homology modelings of two catalytic domains for S. furcifera chitinase 7 (SfCht7). SWISS-MODEL program was used to generate models. A. First catalytic domain (86–431 bp). Homology modeling of the first catalytic domains was conducted using acidic mammalian chitinase (PDB entry code 3fy1) (Olland et al., 2009) as the template. B. Second catalytic domain (519–859 bp). Acidic mammalian chitinase (PDB entry code 1hkk) was used as the template (Rao et al., 2003).

3.2 Developmental expression patterns of SfCht7 The expression profile of SfCht7 was determined by qPCR during different developmental stages, including in nymphs and adults of different ages (Fig. 4). SfCht7 was consistently expressed in the tested stages, suggesting that it might function in all stages. The gene was highly expressed in day 3 fifth-instar nymphs and newly emerged adults (before and after eclosion). Relative transcript levels of the gene significantly increased before each molting and quickly decreased afterward, with the exception of eclosion. Expression incrementally increased before eclosion and did not decrease afterward. Expression of SfCht7 was highest in 3-day-old fifth-instar nymphs. Lowest expression was in 1-day-old first-instar nymphs.

ACCEPTED MANUSCRIPT

NU

SC R

IP

T

11 of 13

MA

Figure 4. Developmental expression profiles of SfCht7. Letters above bars indicate significant differences (ANOVA, Duncan’s test, p < 0.05). Error bars represent standard errors (n = 3). Descriptions of developmental stages (for example, 1L1) are in Table 3.

D

Table 3. The description of the developmental stages Abbreviation

Explication

Abbreviation

Explication

day-1 first-instar nymph

4L1

day-1 fourth-instar nymph

1L2

day-2 first-instar nymph

4L2

day-2 fourth-instar nymph

2L1

day-1 second-instar nymph

5L1

day-1 fifth-instar nymph

day-2 second-instar nymph

5L2

day-2 fifth-instar nymph

day-1 third-instar nymph

5L3

day-3 fifth-instar nymph

day-2 third-instar nymph

AL

day-1 Adult

3L1

AC

3L2

CE P

2L2

TE

1L1

3.3. Silencing of SfCht7 by RNAi To determine the function of SfCht7, dsRNA against SfCht7 (dsCht7) were injected into 1-day-old fifth-instar nymphs. Compared with the control group that received dsRNA against green fluorescent protein (GFP) gene (dsGFP), expression of SfCht7 dropped by 89% after dsCht7 injection, indicating that expression of the target gene was inhibited (Fig. 5). Three phenotypes (P1-P3) were observed after injecting dsCht7. P1 and P2 were lethal. In P1, old cuticles split open, but nymphs were unable to molt completely (Fig. 6). In P2 old cuticles did not split and the distal wing pads of five-instar nymphs elongated and junctions between the thorax and abdomen in the treatment group were thinner than in the control group. In P3, although nymphs were able to molt and become adults, the wings of adults were abnormal. Injection of dsCht7 resulted in 28.49% of nymphs dying and 58.29% with abnormal phenotypes (Fig. 7). Of 58.29% of abnormal nymphs, the proportion of P1, P2 and P3 were 14.18%, 8.85% and 35.52% respectively (Figure 8A). The percent in P1 was 24.95%, in P2 14.63% and in P3 60.42% (Figure 8B). Abnormal nymphs injected with dsGFP were 4.72%.

ACCEPTED MANUSCRIPT

SC R

IP

T

12 of 13

CE P

TE

D

MA

NU

Figure 5. Relative expression levels of SfCht7 after treatment with dsRNA against SfCht7 and GFP. RNAi efficiency was determined by real-time quantitative PCR after injection (n = 6). Six injected nymphs were collected from each repetition to evaluate RNAi effects. dsGFP: dsGFP injection, dsCHT7: dsCHT7 injection. Error bars represent standard errors (n = 3). Three biological replicates were used for t-tests. At 72 h after dsRNA injection, expression was significantly decreased compared with controls, **p < 0.01, t-test.

AC

Figure 6. Three abnormal phenotypes of Sogatella furcifera after injection of SfCht7 dsRNA on first-day fifth-instar nymphs. After dsRNA injection, three phenotypes appeared (P1, P2, P3). P1 and P2 were lethal. In P1, old cuticles were split open, but nymphs were unable to molt completely. In P2, old cuticles were not split and distal wing pads of five-instar nymphs elongated. Junctions between the thorax and abdomen in the treatment group were thinner than in the control group. In P3, although nymphs were able to molt and become adults, the wings of adults were abnormal.

ACCEPTED MANUSCRIPT 13 of 13

NU

SC R

IP

T

Figure 7. Mortality rate and total abnormal rate after treatment with dsRNA against SfCht7 and GFP. A: mortality rate; B: total abnormal rate; dsGFP: dsGFP injection; dsCHT7: dsCHT7 injection. Error bars represent standard errors (n = 3). Three biological replicates were used for t-tests.

MA

Figure 8. Abnormal rate and relative rate of three phenotypes of S. furcifera injected with dsCht7. A: abnormal rate; B: relative rate; p1, p2, p3: three types of phenotypes. Error bars represent standard errors (n = 3).

4. Discussion

AC

CE P

TE

D

The functional characterization of chitinases has been applied to eco-friendly pest management. For example, Penicillium ochrochloron chitinase reduces successful pupation and increases larval and pupal mortality and adult emergence in Helicoverpa armigera (Patil and Jadhav, 2015). Based on sequence homology and phylogenetic analyses, insect chitinases are assigned into eight groups (Arakane and Muthukrishnan, 2010; Zhu et al., 2008a). The group III chitinase TcCHT7 (DQ659247) may be involved in tissue differentiation (Zhu et al., 2008b). To explore the biological function of the group III chitinase of S. furcifera (Horváth), we cloned the full-length cDNA sequence of the gene by rapid amplification of cDNA ends (RACE) and designated it SfCht7. The gene encoded a 958-amino acid protein with one chitin-binding domain, two catalytic domains and a signal peptide region. These features were consistent with the characteristics of group III genes in other insect species (Arakane and Muthukrishnan, 2010). The deduced protein of SfCht7 seemed to be secreted, as a signal peptide of 24 amino acids was found in the N-terminal region. The result differs from TcCHT7 which is not a secreted protein. However, similar to TcCHT7, SfCht7 exhibited an abnormal wing expansion phenotype (Zhu et al., 2008b). Enzymatic activity depends on small differences in the amino acid sequences in the catalytic domain (Zhu et al., 2007). Homology modeling showed that both of the catalytic domains of SfCht7 had a (ba)8 TIM barrel structure as expected. Thus, we speculate that the two catalytic domains of SfCht7 may both have enzymatic activity. Phylogenetic analysis of chitinase-like proteins from seven insect species showed a close relationship between SfCht7 and the chitinase 7 gene of N. lugens (NlCht7). We concluded that SfCht7 belonged to the group III chitinases. In this paper, we investigated the expression profiles of SfCht7 in different development stages using quantification real-time PCR. This technology has been applied to N. lugens and Laodelphax striatellus (Hemiptera: Delphacidae) (Wang et al., 2012). Our results showed that SfCht7 was expressed in five different nymph instars (first, second, third, fourth and fifth) and newly emerged adults (< 24 h). It was highly expressed in day 3 fifth-instar nymphs and newly emerged adults (before and after eclosion). High levels of expression of SfCht7 before eclosion were similar to studies in Anopheles gambiae Cht7 (AgCht7) and Drosophila Cht7. AgCht7 showed varied levels of expression in embryos (eggs), four larval instars (first, second, third and fourth), pupae and adults, but the highest expression level was in pupae. Drosophila Cht7 also shows strong upregulation in pupae. Transcripts of the target gene increased prior to molting. A previous study of L. migratoria showed

ACCEPTED MANUSCRIPT 14 of 13

AC

CE P

TE

D

MA

NU

SC R

IP

T

that the two chitinase 5 genes, LmCht5-1 and LmCht5-2, increased before each molting. A chitinase gene from Bactrocera dorsalis (BdCht2) (JN100105) had dramatically higher expression during larval-pupal and pupal-adult transitions than during other stages (Yang et al., 2013). Xi et al. (2015) found that the transcript levels of NlCht7 (KM217115) peaked periodically during molting in the fourth and fifth instars. NlCht7 was highly expressed in the integument. These results suggest that the gene is associated with molting in N. lugens. Expression of SfCht7 increased before eclosion, but did not decrease immediately after eclosion. This result was different from the study in N. lugens. NlCht7 is rarely expressed in the adult stage. Although NlCht7 was rarely expressed in adults, the study in T. castaneum shows that the group III gene TcCHT7 is expressed during most developmental stages, including penultimate instar larvae, last instar larvae, pharate pupae, pupae and adults, and this gene had high expression in the pupal and adult stages. TcCHT7 may be important in tissue differentiation according to RNAi results (Zhu et al., 2008b). These results show that SfCht7 may be involved in functions other than molting. The tissue-specific expression of Cht7 in N. lugens, A. gambiae and Drosophila was clear. NlCht7 was highly expressed in the integument. AgCht7 appeared to be expressed only in the foregut and carcass, and was predominantly expressed in the carcass. Drosophila Cht7 is broadly expressed in cuticle-forming tissues. Thus, we hypothesized that SfCht7 would be highly expressed in the integument. The true tissue-specific expression pattern of SfCht7 needs be confirmed by further experiments. To examine the biological function of SfCht7, dsRNA was synthesized and injected into fifth-instar nymphs. Silencing of SfCht7 affected nymphs’ ecdysis, causing lethal phenotypes. Some nymphs injected with dsRNA were able to molt without mortality. However, these adults had abnormal wings, failing to extend their wings normally. These results are consistent with a report on the T. castaneum chitinase 7 gene (TcCHT7) (Zhu et al., 2008b). The report found that dsRNA against TcCHT7 interferes with wing expansion, indicating that this gene may be important in tissue differentiation (Zhu et al., 2008b). We thus hypothesize that SfCht7 may have a significant role in tissue differentiation. Although TcCht7 knockdown mutants do not interfere with molting and show only wing phenotypes (Zhu et al., 2008b), studies in Drosophila show that Cht7 is essential for molting in several cuticle-forming tissues. Organ-specific knockdown of DmCht7 in cuticle-forming organs results in clear cuticle defects and characteristic cuticle phenotypes such as double cuticles, pupal lethality and eclosion defects in which adult flies are trapped inside the pupal cuticle. Additional phenotypes are disturbed epidermal cuticle formation and cuticle barrier defects in larvae (Pesch et al., 2016b). Eclosion defects in Drosophila are similar to the lethal phenotypes, P1 and P2 in which the adult WBPHs are trapped inside the old cuticle. The study in N. lugens shows that NlCht7 is required for molting. After injecting dsRNA against NlCht7, insects exhibited two lethal phenotypes. The first was old cuticles of nymphs split from the nota and attached to abdomens. The second was bodies became extended and slender without splitting. These lethal phenotypes suggest that NlCht7 is important in old cuticle degradation (Xi et al., 2015). The lethal phenotypes in S. furcifera (p1 and p2) are consistent with these lethal phenotypes. Thus, SfCht7 may be important in old cuticle degradation. Pesch et al. (2016a) proposes a new working model: that Cht enzymatic activity might be required for cuticle shedding and also for assembly of newly synthesized cuticles. This model could also be correct for Dm and Sf Cht7. We thus propose that SfCht7 may not contribute to cuticle shedding and assembly of newly synthesized cuticles. The development of wings in insects is regulated by multiple genes (Brisson et al., 2010; Peng et al., 2012). After dsCht7 injection, S. furcifera nymphs achieved the nymph-adult transition, while adults had abnormal wings. Ren et al. (2005) report that the expression of Drosophila ortholog DmCht7 (CG1869) encoding a group III chitinase increases considerably in wing discs from 24 to 40 h during the pupal stage. Expression of SfCht7 in wing discs may have also increased considerably. The expression of wingless, which is important for growth of wings discs, also increases considerably in wing discs from 24 to 40 h during the pupal stage (Ren et al. , 2005). Yu et al. (2014) found that the wingless gene (Wg) is involved in the development and growth of wings in S. furcifera, using RNAi. After ingesting an artificial diet with 100 ng/μL dsWg, nymphs were able to molt to become adults, but the adults had shrunken or unfolded wings on their backs instead of smooth and folded wings.

ACCEPTED MANUSCRIPT 15 of 13

This kind of abnormal phenotype is similar to p3 in our paper. Thus, we hypothesize that SfCht7 may also affect multiple genes regulating wing development. The importance of SfCht7 in controlling wing development needs be confirmed by further experiments. 5. Conclusions

MA

NU

SC R

IP

T

In summary, the chitinase 7 gene is present in S. furcifera. This study cloned the full-length sequence of SfCht7 and investigated its molecular characterization, developmental expression pattern, and function in S. furcifera. Phylogenetic analysis showed a close relationship between SfCht7 and NlCht7 and illustrated that the putative SfCht7 belonged to group III chitinases. Developmental analysis of SfCht7 suggested that transcripts increased before molting, which showed that SfCht7 may be involved in degradation of chitin during S. furcifera molting. We also investigated the gene function using RNAi and found that it was important in cuticle turnover during molting. The gene may also function in development in the early adult stage because some nymphs injected with dsRNA were able to molt but had abnormal wings. The functional mechanism of the gene is not clear and needs further investigation.

Author Contributions: Hong Yang and Bin Tang conceived and designed the experiments. Chen Chen performed the experiments, contributed to data analysis, and wrote the paper. Bin Tang and Wen-Jia Yang provided guidance of the experiments. Hong Yang, Wen-Jia Yang and Dao-Chao Jin contributed to manuscript revisions. All authors read and approved the manuscript.

CE P

TE

Chitinase Sogatella furcifera chitinase 7 gene rapid-amplification of cDNA ends open reading frame chitin-bingding domain double-strand RNA peritrophic matrix white-backed planthopper RNA interference National Center for Biotechnology Information green fluorescent protein

AC

CHT SfCht7 RACE ORF CBD dsRNA PM WBPH RNAi NCBI GFP

D

Abbreviations

Conflicts of Interest: The authors declare no conflict of interest.

Acknowledgments: This work was supported by the National Natural Science Foundation of China (31560522), the Provincial Key Project for Agricultural Science and Technology of Guizhou (NY20133006 and NY20103064) and the Innovation Team Program for Systematic and Applied Acarology ([2014]33).

References Arakane, Y., Muthukrishnan, S., 2010. Insect chitinase and chitinase-like proteins. Cell Mol. Life Sci. 67, 201-216. Ayoade, O., Morooka, S., Tojo, S., 1999. Enhancement of short wing formation and ovarian growth in the genetically defined macropterous strain of the brown planthopper, Nilaparvata lugens. J Insect Physiol. 45, 93-100. Baum, J.A., Bogaert, T., Clinton, W., Heck, G.R., Feldmann, P., Ilagan, O., Johnson, S., Plaetinck, G., Munyikwa, T., Pleau, M., 2007. Control of coleopteran insect pests through RNA interference. Nat. Biotechnol. 25, 1322-1326.

ACCEPTED MANUSCRIPT 16 of 13

AC

CE P

TE

D

MA

NU

SC R

IP

T

Brisson, J.A., Ishikawa, A., Miura, T., 2010. Wing development genes of the pea aphid and differential gene expression between winged and unwinged morphs. (Special Issue: The aphid genome.). Insect Mol. Biol. 19, 63-73. Chen, J., Zhang, D., Yao, Q., Zhang, J., Dong, X., Tian, H., Zhang, W., 2010. Feeding-based RNA interference of a trehalose phosphate synthase gene in the brown planthopper, Nilaparvata lugens. Insect Mol. Biol. 19, 777-786. Denno, R.F., Olmstead, K.L., McCLOUD, E., 1989. Reproductive cost of flight capability: a comparison of life history traits in wing dimorphic planthoppers. Ecol. Entomol. 14, 31-44. Funkhouser, J.D., Aronson, N.N. Jr., 2007. Chitinase family GH18: evolutionary insights from the genomic history of a diverse protein family. BMC Evol Biol. 7, 96. Hegedus, D., Erlandson, M., Gillott, C., Toprak, U., 2009. New insights into peritrophic gypsy moth (Lepidoptem: Lymantriidae) by chitinases. J. Econ. Entomol. 80, 1113–1116. Kramer, K.J., Corpuz, L., Choi, H.K., Muthukrishnan, S., 1993. Sequence of a cDNA and expression of the gene encoding epidermal and gut chitinases of Manduca sexta. Insect Biochem. Mol. Biol. 23, 691-701. Kramer, K.J., Koga, D., 1986. Insect chitin: physical state, synthesis, degradation and metabolic regulation. Insect Biochem. 16, 851-877. Kramer, K. J., Muthukrishnan, S., 2005. 4.3 – Chitin Metabolism in Insects. Comprehensive Molecular Insect Science. 4, 111-144. Krishnan, A., Nair, P.N., Jones, D., 1994. Isolation, cloning, and characterization of new chitinase stored in active form in chitin-lined venom reservoir. J.Biol.Chem. 269, 20971-20976. Li, D., Zhang, J., Wang, Y., Liu, X., Ma, E., Sun, Y., Li, S., Zhu, K.Y., Zhang, J., 2015. Two chitinase 5 genes from Locusta migratoria: molecular characteristics and functional differentiation. Insect Biochem. Mol. Biol. 58, 46-54. Liang, Z.Q., Song, S.Y., Liang, S.K., Wang, F.H., 2016. Analysis of Differential Proteins in Two Wing-Type Females of Sogatella furcifera (Hemiptera: Delphacidae). J. Insect Sci. 16, 35. Liu, S., Ding, Z., Zhang, C., Yang, B., Liu, Z., 2010. Gene knockdown by intro-thoracic injection of double-stranded RNA in the brown planthopper, Nilaparvata lugens. Insect Biochem. Mol. Biol. 40, 666–671. Matsukura, K., Towata, T., Sakai, J., Onuki, M., Okuda, M., Matsumura, M., 2013. Dynamics of Southern rice black-streaked dwarf virus in rice and implication for virus acquisition. Phytopathology. 103, 509-512. Merzendorfer, H., 2013. Insect-Derived Chitinases. Adv. Biochem. Eng. Biotechnol. 136, 19-50. Merzendorfer, H., Zimoch, L., 2003. Chitin metabolism in insects: structure, function and regulation of chitin synthases and chitinases. J. Exp. Biol. 206, 4393-4412. Moussian, B., 2010. Recent advances in understanding mechanisms of insect cuticle differentiation. Insect Biochem. Mol. Biol. 40, 363-375. Nakabachi, A., Shigenobu, S., Miyagishima, S., 2010. Chitinase-like proteins encoded in the genome of the pea aphid, Acyrthosiphon pisum. Insect Mol Biol. 19, 175-185. Olland, A.M., Strand, J., Presman, E., Czerwinski, R., McCarthy, D.J., Krykbaev, R., Schlingmann, G., Chopra, R., Lin L., Fleming, M., Kriz, R., Stahl, M., Somers, W., Fitz, L., Mosyak, L., 2009. Triad of polar residues implicated in pH specificity of acidic mammalian chitinase. Protein Science. 18, 569-578. Patil, N.S., Jadhav, J.P., 2015. Significance of Penicillium ochrochloron chitinase as a biocontrol agent against pest Helicoverpa armigera. Chemosphere. 128, 231-235. Peng, J., Zhang, C., An, Z.F., Yu, J.L., Liu, X.D., 2012. Genetic analysis of wing-form determination in three species of rice planthoppers (Hemiptera:Delphacidae). Acta Entomol. Sin. 55, 971-980. Pesch, Y.Y., Riedel, D., Behr, M., 2016a. Drosophila Chitinase 2 is expressed in chitin producing organs for cuticle formation. Arthropod Structure & Development. Pesch, Y.Y., Riedel, D., Patil, K.R., Loch, G., Behr, M., 2016b. Chitinases and Imaginal disc growth factors organize the extracellular matrix formation at barrier tissues in insects. Scientific Reports. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 29, e45-e45.

ACCEPTED MANUSCRIPT 17 of 13

Ramalho-Ortigao, J., Traub-Csekö, Y., 2003. Molecular characterization of Llchit1, a midgut chitinase cDNA from the leishmaniasis vector Lutzomyia longipalpis. Insect Biochem. Mol. Biol. 33, 279-287.

Rao, F.V, Houston, D.R, Boot, R.G., Aerts, J.M.F.G., Sacuda, S., Aalten, D.M.F.V., 2003. Crystal structures of allosamidin derivatives in complex with human macrophage chitinase. Journal of

T

Biological Chemistry. 278, 20110-20116.

AC

CE P

TE

D

MA

NU

SC R

IP

Ren, N., Zhu, C., Lee, H., Adler, P.N., 2005. Gene expression during Drosophila wing morphogenesis and differentiation. Genetics. 171, 625-638. Shen, Z., Jacobs-Lorena, M., 1997. Characterization of a novel gut-specific chitinase gene from the human malaria vector Anopheles gambiae. J. Biol. Chem. 272, 28895-28900. Wang, Y., Fan, H.W., Huang, H.J., Xue, J., Wu, W.J., Bao, Y.Y., Xu, H.J., Zhu, Z.R., Cheng, J.A., Zhang, C.X., 2012. Chitin synthase 1 gene and its two alternative splicing variants from two sap-sucking insects, Nilaparvata lugens and Laodelphax striatellus (Hemiptera: Delphacidae). Insect Biochem. Mol. Biol. 42, 637-646. Wu, Q., Liu, T., Yang, Q., 2013. Cloning, expression and biocharacterization of OfCht5, the chitinase from the insect Ostrinia furnacalis. Insect Sci. 20, 147-157. Xi, Y., Pan, P.L., Ye, Y.X., Yu, B., Xu, H.J., Zhang, C.X., 2015. Chitinase-like gene family in the brown planthopper, Nilaparvata lugens. Insect Mol. Biol. 24, 29-40. Yang, W.J., Xu, K.K., Zhang, R.Y., Wei, D., Wang, J.J., 2013. Transcriptional regulation of a chitinase gene by 20-hydroxyecdysone and starvation in the oriental fruit fly, Bactrocera dorsalis. Int. J. Biol. Sci. 14, 20048-20063. Yu, J.L., An, Z.F., Liu, X.D., 2014. Wingless gene cloning and its role in manipulating the wing dimorphism in the white-backed planthopper, Sogatella furcifera. BMC. Mol. Biol. 15, 1-9. Zha, W., Peng, X., Chen, R., Du, B., Zhu, L., He, G., 2011. Knockdown of midgut genes by dsRNA-transgenic plant-mediated RNA interference in the hemipteran insect Nilaparvata lugens. PLoS One. 6, e20504. Zhou, G., Wen, J., Cai, D., Li, P., Xu, D., Zhang, S., 2008. Southern rice black-streaked dwarf virus: A new proposed Fijivirus species in the family Reoviridae. Chinese Sci. Bull. 53, 3677-3685. Zhu, K.Y, Merzendorfer, H., Zhang, W., Zhang, Z., Muthukrishnan S., 2016. Biosynthesis, turnover, and functions of chitin in insects. Annual review of entomology. 61, 177-196. Zhu, Q., Arakane, Y., Banerjee, D., Beeman, R.W., Kramer, K.J., Muthukrishnan, S., 2008a. Domain organization and phylogenetic analysis of the chitinase-like family of proteins in three species of insects. Insect Biochem. Mol. Biol. 38, 452-466. Zhu, Q., Arakane, Y., Beeman, R.W., Kramer, K.J., Muthukrishnan, S., 2008b. Functional specialization among insect chitinase family genes revealed by RNA interference. Proc. Natl. Acad. Sci. U S A. 105, 6650-6655. © 2016 by the authors. Submitted for possible open access publication under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).