RNAi mediated knockdown of the ryanodine receptor gene decreases chlorantraniliprole susceptibility in Sogatella furcifera

Pesticide Biochemistry and Physiology 108 (2014) 58–65

Contents lists available at ScienceDirect

Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest

RNAi mediated knockdown of the ryanodine receptor gene decreases chlorantraniliprole susceptibility in Sogatella furcifera Yao Yang, Pin-Jun Wan, Xing-Xing Hu, Guo-Qing Li ⇑ Education Ministry Key Laboratory of Integrated Management of Crop Diseases and Pests, College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China

a r t i c l e

i n f o

Article history: Received 30 October 2013 Accepted 26 December 2013 Available online 4 January 2014 Keywords: Sogatella furcifera Ryanodine receptor Double-stranded RNA Chlorantraniliprole Mortality

a b s t r a c t The diamide insecticides activate ryanodine receptors (RyRs) to release and deplete intracellular calcium stores from the sarcoplasmic reticulum of muscles and the endoplasmic reticulum of many types of cells. They rapidly interrupt feeding of the target pest and eventually kill the pest due to starvation. However, information about the structure and function of insect RyRs is still limited. In this study, we isolated a 15,985 bp full-length cDNA (named SfRyR) from Sogatella furcifera, a serious rice planthopper pest throughout Asia. SfRyR encodes a 5140-amino acid protein, which shares 78–97% sequence identities with other insect homologues, and less than 50% identities with Homo sapiens RyR1–3. All hallmarks of the RyR proteins are conserved in SfRyR. In the N-terminus, SfRyR has a MIR domain, two RIH domains, three SPRY domains, four copies of RyR repeated domain and a RIH-associated domain. In the C-terminus, SfRyR possesses two consensus calcium ion-binding EF-hand motifs, and six transmembrane helices. Temporal and spatial expression analysis showed that SfRyR was widely found in all development stages including egg, first through fifth instar nymphs, macropterous adult females and males. On day 2 fifthinstar nymphs, SfRyR was ubiquitously expressed in the head, thorax and abdomen. Dietary ingestion of dsSfRyR1 and dsSfRyR2 significantly reduced the mRNA level of SfRyR in the treated nymphs by 77.9% and 81.8% respectively, and greatly decreased chlorantraniliprole-induced mortality. Thus, our results suggested that SfRyR gene encoded a functional RyR that mediates chlorantraniliprole toxicity to S. furcifera. Ó 2014 Elsevier Inc. All rights reserved.

1. Introduction Ryanodine receptors (RyRs) are a distinct class of intracellular calcium (Ca2+) release channels that regulate the entry of Ca2+ into the cytosol from the intracellular organelles, including the sarcoplasmic reticulum of muscles and the endoplasmic reticulum of neurons and many other cell types. In mammals, three RyR isoforms (RyR1, RyR2 and RyR3) have been identified, which are encoded by separate genes [1]. RyR1 and RyR2 are mainly expressed in skeletal and cardiac tissues, respectively, whereas RyR3 is widely found in different tissues, with relatively high level in brain and some skeletal muscles [2–4]. The anthranilic diamides chlorantraniliprole and cyantraniliprole, and the phthalic diamide flubendiamide, are a novel class of insecticides that activate ryanodine receptors (RyRs) to release and deplete intracellular Ca2+ stores in many types of cells. The diamides provide rapid plant protection through feeding cessation in the target pest and eventual death due to starvation [5–7]. This has prompted studies on insect RyRs. Up to now, several RyR genes have been documented in hemipteran Nilaparvata lugens [8], lepi⇑ Corresponding author. Fax: +86 25 84395248. E-mail address: [email protected] (G.-Q. Li). 0048-3575/$ - see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.pestbp.2013.12.004

dopteran Bombyx mori [9], Plutella xylostella [10–12], Cnaphalocrocis medinalis [13], Ostrinia furnacalis [14], Helicoverpa armigera [15] and Pieres rapae [16], and dipteran Drosophila melanogaster [6,17]. Moreover, DmRyR from D. melanogaster has been functionally characterized by expressing it in CHO cells [18] and in a Spodoptera frugiperda cell line (Sf9) [19], respectively. However, the exact binding sites in RyR for the diamide insecticides have not yet been well identified. Flubendiamide mainly incorporates into the transmembrane domain (amino acid (aa) 4111–5084) of BmRyR in B. mori, while the N-terminus (aa 183– 290) is a structural requirement for flubendiamide-induced activation. HEK cells expressing either D183–290 mutants or chimeric RyRs where aa 4111–5084 are replaced with the rabbit RyR2 counterpart sequence, fail to produce Ca2+ mobilization in the presence of flubendiamide [9]. For DmRyR in D. melanogaster, a short segment of the C-terminal transmembrane region (aa 4610–4655) has been found to be critical to diamide insecticide sensitivity [20]. In P. xylostella, high levels of diamide cross-resistance strains collected from Philippines and Thailand [21] and from China [22] are associated with a target-site mutation (G4946E) in the C-terminal membrane-spanning domain of the RyR. These results indicate three distinct regions of the insect RyRs are critical to diamide insecticide sensitivity: one region lies near the N-terminus (aa

Y. Yang et al. / Pesticide Biochemistry and Physiology 108 (2014) 58–65

183–290, B. mori) and two are located within the C-terminus transmembrane region (aa 4610–4655 from Drosophila and aa 4946 from P. xylostella). The white-backed planthopper Sogatella furcifera is a rice pest that causes serious damage to rice plants by sucking the phloem sap, blocking the phloem vessels, and acting as a virus vector. The most common management strategy to control the planthopper is chemical treatments. However, this inevitably leads to the development of insecticide resistance, insect resurgence, and serious environmental pollution [23–27]. The novel diamides are potential insecticides to cope with S. furcifera resistance. In order to well understand the mode of action and the resistance mechanism of the novel diamide insecticides, here we isolated a full-length RyR cDNA (named as SfRyR) from S. furcifera. Since dietary ingestion of double-stranded RNA (dsRNA) effectively knocked down target genes in planthoppers [28–30], our second goal in the present paper was to study the influence of SfRyR-dsRNA on susceptibility of S. furcifera nymphs to chlorantraniliprole. Our results suggest that SfRyR encodes a functional RyR that mediates chlorantraniliprole toxicity to S. furcifera. 2. Materials and methods 2.1. Insect culture S. furcifera adults were reared routinely on rice (Oryza sativa) variety Taichung Native 1, using a protocol described previously [30]. In our laboratory, the eggs hatched into nymphs within 7 days. Nymphs went through 5 instars, with the average periods of the first-, second-, third-, fourth- and fifth-instar stages of 2.5, 2.0, 2.0, 3.0 and 3.0 days, respectively. 2.2. Cloning and sequencing of full-length SfRyR cDNA Total RNA was extracted and first-strand cDNA was synthesized according to the method reported recently [30]. Moreover, the 50 and 30 -RACE Ready cDNA were synthesized following the manufacturer’s instructions using the SMARTer RACE cDNA amplification kit (Takara Bio., Dalian, China). Experimental approaches for isolation of the full-length SfRyR comprise three steps. Firstly, the annotated RyR protein (GenBank: BAA41471) from D. melanogaster [6,17] were used for TBLASTN searches of S. furcifera transcriptome data obtained previously [30] to identify candidate unigenes at a cutoff E-value of 1.05. In total, 13 sequences were obtained. Specific primer pairs based on these RyR-like EST sequences (S01–S13) were used to authenticate the RyR fragments (Table 1, Fig. 1). Secondly, five pairs of primers (Table 1) were designed to amplify five overlapping cDNA fragments (G01–G05). Finally, 50 - and 30 -RACE were amplified using gene-specific primers (GSP and Nested GSP) (Table 1, Fig. 1) and the universal primers in the SMART™ RACE kit, with the components and the thermal cycling conditions according to the manufacturer’s protocols. The PCR products were cloned into pGEM-T easy vector (Promega Corp., Madison, WI, USA), and sequenced at both strands. cDNA sequence assembling and multiple sequence alignment were performed with DNAMAN (DNAMAN 5.2.2, Lynnon BioSoft). Open reading frame (ORF) were predicted using the EditSeq program of DNAStar (http://www.dnastar.com). The domain predictions were performed by InterProscan (http://www.ebi.ac.uk/Tools/pfa/ iprscan/), MotifScan (http://myhits.isb-sib.ch/cgi-bin/motif_scan) and ScanProsite (http://prosite.expasy.org/scanprosite/). Transmembrane domains were predicted using TMHMM 2.0 (www.cbs.dtu.dk/services/TMHMM). The hydropathy profile of the consensus amino acid sequence was analyzed using the web-

site (http://web.expasy.org/cgi-bin/protscale/protscale.pl). resulting sequence was submitted to GenBank (KF734669).

59

The

2.3. Multiple sequence alignment and phylogenetic analysis The RyR sequences of different species were retrieved from National Center for Biotechnology Information (http:// www.ncbi.nlm.nih.gov/Genbank/index.html), and were respectively aligned with the predicted SfRyR using ClustalW2.1 [31]. The alignment was used to construct the maximum-likelihood (ML) trees using RAxML version 8.1 [32] to select the best-fitting model (JTT + c, with empirical frequency) after estimated by ProtTest [33]. The reliability of ML tree topology was evaluated by bootstrapping sampling of 1000 replicates. 2.4. Bioassays using dsRNA and chlorantraniliprole The same method described recently [30] was used to amplify two fragments of SfRyR (SfRyR1 and SfRyR2) with the length of 336 bp and 451 bp respectively, and an enhanced green fluorescent protein gene egfp fragment with the length of 414 bp, using pEASYT3 vector (TransGen Biotech. Co., Beijing, China) and specific primers (Table 1) conjugated with the T7 RNA polymerase promoter (taatacgactcactataggg). The PCR products were purified using Wizard H SV Gel and PCR Clean-Up System (Promega) and used as templates for dsRNA synthesis using the T7 Ribomax TM Express RNAi System (Promega). The synthesized dsRNAs (dsSfRyR1, dsSfRyR2 or dsegfp) were individually isopropanol precipitated, resuspended in nuclease-free water, and quantified by a spectrophotometer (NanoDrop TM 1000, Thermo Fisher Scientific, USA) at 260 nm. The dsRNA stocks can be stored for several weeks at 70 °C until use. Dietary dsRNA-introducing procedure previously reported [30] was used, with glass cylinders (12 cm in length and 2.8 cm in internal diameter) as feeding chambers. Twenty first-instar nymphs were carefully transferred into each chamber and pre-reared for 1 day to the second-instar stage, on an artificial diet documented previously [34] between two layers of stretched Parafim M (Pechiney Plastic Packaging Company, Chicago, IL, USA) that was placed at both ends of the chamber. And then, the twenty individuals were transferred to a new chamber containing control diet, or the diet containing dsegfp, dsSfRyR1 or dsSfRyR2 at the concentration of 0.5 mg/ml according to the previously reported data [28– 30]. Each treatment was replicated 9 times, and a total of 720 nymphs were treated. Fresh diet was provided daily. After continuously ingested normal, dsegfp-, dsSfRyR1- and dsSfRyR2-contained diets for 3 days, three replicates for each treatment (20  3 nymphs, a total of 240 nymphs) were used to extract total RNA. The other 6 replicates for each treatment (20  6 nymphs, a total of 480 nymphs) were used to determine the susceptibility to chlorantraniliprole. Since the LC50 value of chlorantraniliprole was approximately 20 lg/mL for the third instar nymphs and adults of S. furcifera [35], and 26.9 and 35. 5 lg/mL to the third instar nymphs and adults of N. lugens [36], chlorantraniliprole in acetone was mixed with the diet to get the final concentration of 20 lg/mL diet in the present paper. The same amount of acetone was mixed with the diet as control. There were eight treatments: (1) nymphs previously on normal diet and then on acetone-contained diet; (2) nymphs previously on dsegfp-contained diet and then on acetone-contained diet; (3) nymphs previously on dsSfRyR1-contained diet and then on acetone-contained diet; (4) nymphs previously on dsSfRyR2-contained diet and then on acetone-contained diet; (5) nymphs previously on normal diet and then on chlorantraniliprole-contained diet; (6) nymphs previously on dsegfp-contained diet and then on chlorantraniliprolecontained diet; (7) nymphs previously on dsSfRyR1-contained diet

60

Y. Yang et al. / Pesticide Biochemistry and Physiology 108 (2014) 58–65

Table 1 Primers used in RT-PCR, and 50 -and 30 -RACE, synthesizing dsRNA, and performing qRT-PCR. Fragment name

cDNA position

Forward sequence (50 –30 )

Reverse sequence (50 –30 )

RT-PCR and RACE S01 S02 S03 S04 S05 S06 S07 S08 S09 S10 S11 S12 S13 G01 G02 G03 G04 G05 50 GSP-1 50 NGSP-1 30 GSP 30 NGSP

1980–2832 3766–4028 3966–5090 5073–6103 5965–6980 6939–7892 8714–9885 9789–10,150 11,231–12,039 12,330–12,854 13,082–13,976 13,905–14,384 14,356–15,369 2796–3853 7797–8848 9962–11,464 11,755–12,432 12,664–13,201 2259 2088 15156 15,344

TTTGTGGGACGTGTTGTT CGATTTTCGAGAATACTGAG CGGTGGCAGGAGATAAGA TCAACCACTCTGCCACTT AACATCGCAAGGGTCTACT ACATCTCACGAAATGGTTG AGAGCGTTACAAGGAGCC TATGGCGGTGACTTGTTAT CAGTTATCGGTCGGTTGT TTGTGGGACGCTGTTGGA GAACTTCTGCGAGGATGC CATCGGGCAGTGAGTTTT ATGGACTTTACATAGCCGAACA CAACTTGCTGTCCAAACTC AGCGTTGTTCTGTTCTTGG TTTCCCAGTTGCCTTCCT ATGGAGTTCCCAGTGATATG AGATGGAACAACAGAAGAGC

GAGCGAGAATGGTTTTGA GCGTGGTTTGGTCTGCTT AAGTGGCAGAGTGGTTGAG CCAACGAAATCAATGCTG GCACAGGAACCTACAGCA CGCTCTTAAATCGGGTAG CATGAGTTAGCGTAGCGTC GCATCATTGTGCGTCTTAT TGAATCGGAATAGGGTGC CCTCGGTTCATTGGGCAT ACAAAAGGCGAGAACCAG TTCAGGCTGTTCGGCTAT AGCAGTCACCAACAGGGA TTGAGACAAGGCGGAGTA ATAGCATTGGGCTTGGAC TTGCCCTCATCCACCTCT GGTTCAGAAGTTCCTTGAGTAG TCAGATATGTAGGTGTAGGC CGCCTTTTCTTATGAATGGCTCGG ATCCGATTCTCAAGTGCGGTGTCA

Synthesizing dsRNA SfRyR1 SfRyR2 egfp Performing the qPCR SfRyR RPL9 ARF

AACTGCTTCATTTGCGGCATCGGA GGACTTCTTCCCTGTTGGTGACTGC

2825–3160 8511–8961

taatacgactcactatagggTCTCGCTCTCGGCTACTA taatacgactcactatagggTACAATCCACAGCCCATC taatacgactcactatagggAAGTTCAGCGTGTCCG

taatacgactcactatagggGTTCTGACCGTTTCACTTG taatacgactcactatagggGAGCATTCTCAGCTAAAC taatacgactcactatagggCACCTTGATGCCGTTC

2585–2687

GCCAACACCTGTGGATACTT TGTGTGACCACCGAGAACAACTCA CACAATATCACCGACTTTGGGATTC

CTTGTTCATGGCCCACATTTC ACGATGAGCTCGTCCTTCTGCTTT CAGATCAGACCGTCCGTACTCTC

Fig. 1. Cloning strategy for the isolation of SfRyR cDNA sequence. Experimental approaches for isolation of the full-length SfRyR comprise three steps. Firstly, 13 candidate unigenes (S01–S13) were identified from Sogatella furcifera transcriptome data. The 13 SfRyR fragments were authenticated by specific primer pair. Secondly, five pairs of primers were designed to amplify five overlapping cDNA fragments (G01–G05). Finally, 50 - and 30 -RACE were amplified using antisense and sense gene-specific primers.

and then on chlorantraniliprole-contained diet; (8) nymphs previously on dsSfRyR2-contained diet and then on chlorantraniliprolecontained diet. Each treatment was replicated 3 times. After 5 days treatment, the mortality was recorded.

2.6. Data analysis The data were given as means ± SE, and were analyzed by ANOVAs followed by the Tukey–Kramer test, using SPSS for Windows (SPSS, Chicago, IL, USA).

2.5. Real-time quantitative PCR (qPCR) Total RNA samples were prepared from the eggs, the first through fifth instar nymphs (N1–N5), macropterous adult females (F) and males (M), from the head, thorax and abdomen of day 2 fifth-instar nymphs, and from nymphs subjected to 3 days of dsRNA exposure, using SV Total RNA Isolation System Kit (Promega). Each sample contained 5–10 nymphs and repeated in biological triplicate. Putative mRNA abundance of SfRyR in each nymphal sample was estimated by qPCR, using internal control gene ADPribosylation factor (ARF) and ribosomal protein RPL9 (primers of SfRyR, ARF and RPL9 were listed in Table 1) according to the method described recently [30]. All experiments were repeated in technical triplicate. Data were analyzed by the 2DDCt method [37], using the geometric mean of ARF and RPL9 for normalization according to the strategy described previously [37,38].

3. Results 3.1. Cloning of SfRyR cDNA Totally, twenty overlapping cDNA clones of S. furcifera were amplified, and they were spliced together to make a 15,985 bp full-length cDNA (named SfRyR) (Fig. 1). Compiled full-length SfRyR cDNA sequence contains a 15,387 bp ORF, and encodes a 5128amino acid protein with a calculated molecular mass of 579.14 kDa and an isoelectric point (pI) of 5.36. Amino acid sequence alignment shows that S. furcifera SfRyR shares high amino acid identity with other published insect RyR homologues. Of the RyR-like proteins, those from N. lugens and Laodelphax striatella share the greatest identity (97%) with SfRyR.

Y. Yang et al. / Pesticide Biochemistry and Physiology 108 (2014) 58–65

Those from Bemisia tabaci, Acyrthosiphon pisum, Pediculus humanus corporis, Harpegnathos saltator, Bombus impatiens, Bombus terrestris, Megachile rotundata, Apis mellifera, Apis florea, Nasonia vitripennis, Ostrinia furnacalis, Chilo suppressalis, Spodoptera exigua, C. medinalis, B. mori, P. xylostella and P. rapae followed, with identities from 80% to 84%. Those from dipteran species such as Aedes aegypti, Ceratitis capitata and D. melanogaster have 78–79% identities with S. furcifera SfRyR. However, identities of S. furcifera SfRyR with Homo sapiens RyR1–3 were less than 50%. To investigate the evolutionary relationships among RyR sequences, a phylogenetic analysis was performed based on the amino acid sequences of twenty insects, one nematode and three mammalian RyRs (Fig. 2). The phylogenetic tree showed that the RyRs from twenty insects formed a bigger cluster, and the three mammalian RyRs formed a smaller one. These two clusters were well segregated from each other, and also from the Caenorhabditis elegans RyR. Among insect cluster, the RyR-like proteins formed Lepidoptera clade, Diptera clade, Coleoptera clade, Hemiptera clade and Hymenoptera clade. Within the Hemiptera clade, S. furcifera SfRyR was first grouped with that from L. striatella, with 92% of bootstrap value, and then the two and that from N. lugens joined together to form planthopper sub-clade, supporting by 100% of bootstrap value. The planthopper sub-clade was then clustered with that from A. pisum, with 100% of bootstrap value (Fig. 2).

3.2. Primary domains of SfRyR Analysis of the amino acid sequence indicated that the conserved domains in the N-terminus of S. furcifera SfRyR had a MIR (protein Mannosyltransferase, inositol 1,4,5-trisphosphate receptor (IP3R) and RyR) domain at amino acid positions 211–385, two RIH (RyR and IP3R Homology) domains (residues 440–646 and 2222–2448), three SPRY (SPla and RyR) domains (residues 576–801, 1080–1213, and 1472–1684), four copies of RyR (RyR repeated) domain (residues 852–943, 964–1056, 2829–2921 and 2950–3036) and a RIH-associated domain (3989–4111) (Fig. 3A–C).

61

In the C-terminus, two EF-hand domains were located between amino acids 4169–4249 and 4190–4217 (Fig. 3A). Moreover, SfRyR contained six hydrophobic transmembrane domains (TM1-TM6) lying respectively between amino acids 4448–4468, 4638–4658, 4739–4757, 4877–4897, 4925–4947 and 5007–5027 (Fig. 3A, Table 2). The hydropathy profile analysis further revealed that the six transmembrane domains were corresponding to six highly hydrophobic regions (Fig. 4). Moreover, similar to known divergent regions DR1 and DR2 in vertebrate RyRs [39], two regions of S. furcifera SfRyR (residues 4370–4720 and 1302–1524) showed lower identities with the corresponding regions in other insect RyR homologues (Fig. 3D and E), and were defined as insect divergent region 1 (IDR1) and IDR2, respectively in N. lugens [8]. 3.3. Analysis of SfRyR amino acid sequence Important modulator-binding sites were identified in S. furcifera SfRyR amino acid sequence when compared to other reported RyRs (Fig. 3A). A consensus sequence, Y[GAST][VG][KTQSN], for the putative adenine ring binding domain [40], was found at amino acid positions 1085–1088 of SfRyR sequence. Three possible nucleotide binding sites, identified on the basis of the consensus GXGXXG motif [41], were located at amino acid positions 2750– 2755, 3980–3985 and 4671–4676 in the SfRyR sequence. Moreover, the sequence motif, GXRXGGGXGD, which constitutes part of the pore-forming segments of the Ca2+ release channels [42], was also highly conserved in SfRyR (residues 4977–4986), suggesting that S. furcifera SfRyR is likely to form a functional Ca2+-selective channel. 3.4. Temporal and spatial transcript profiles The mRNA levels of S. furcifera SfRyR were measured in egg, first through fifth instar nymphs, macropterous adult females and males. ANOVA analysis revealed that the expression levels in fourth- and fifth-instar nymphs, and in macropterous males were

Fig. 2. A phylogenetic tree of the RyR family. Unrooted phylogenetic trees were constructed by the maximum-likelihood method based on the protein sequence alignments. RyR proteins originate from Sogatella furcifera (S_fur), Laodelphax striatella (L_str, AFK84959), Nilaparvata lugens (N_lug, AGW82429), Acyrthosiphon pisum (A_pis, XP_003246190), Tribolium castaneum (T_cas, EEZ99829), Dendroctonus ponderosae (D_pon, ENN70900), Plutella xylostella (P_xyl, AFW97408), Spodoptera exigua (S_exi, AFC36359), Chilo suppressalis (C_sup, AFN70719), Cnaphalocrocis medinalis (C_med, AFI80904), Ostrinia furnacalis (O_fur, AGH68757), Bombus impatiens (B_imp, XP_003484552), B. terrestris (B_ter, XP_003393894), Apis mellifera (A_mel, XP_392217), Megachile rotundata (M_rot, XP_003701507), Harpegnathos saltator (H_sal, EFN78897), Nasonia vitripennis (N_vit, XP_003425568), Drosophila melanogaster (D_mel, NP_476992), Aedes aegypti (A_aeg, XP_001657320), Anopheles gambiae (A_gam, XP_318561), Caenorhabditis elegans (C_ele, BAA08309) and Homo sapiens (H_sapRyR1, EAW56797.1; H_sapRyR2, EAW70071.1; H_sapRyR3, NP_001027.3) respectively. The percentiles of bootstrap values (1000 replicates) are indicated. The scale bar represents the amino acid divergence.

62

Y. Yang et al. / Pesticide Biochemistry and Physiology 108 (2014) 58–65

Fig. 3. Conserved structural domains (A) and amino acid sequence alignments of SPRY (B), RYR (C), IDR1 (insect divergent region 1, D) and IDR2 (E) of Sogatella furcifera (Sf) RyR. Identical and similar amino acids are shaded. Gaps have been introduced to permit alignment. RyR sequences of Nilaparvata lugens (NlIDR, AGW82429) Cnaphalocrocis medinalis (CmIDR, AFI80904), Plutella xylostella (PxIDR, AET099964) and Drosophila melanogaster (DmIDR, BAA41471) were obtained from GenBank database.

Table 2 Positions of possible transmembrane helices. Number

Original position

Terminal position

Length

Orientation

Sequence

TM1 TM2 TM3 TM4 TM5 TM6

4448 4638 4739 4877 4925 5007

4468 4658 4757 4897 4947 5027

21 21 19 21 23 21

Outside–inside Inside–outside Outside–inside Inside–outside Outside–inside Inside–outside

IFFYKFYYSGFSVSVVLRYFG YNIKYVALVLAFCINFILLFY AAMLHSLVSLAMLIAYYHL FLYSIMYFIFSILGNFNNFFF LALTVMLLTIIVYIYTVIAFNFF FFFFVIVILLAIIQGLIIDAF

Y. Yang et al. / Pesticide Biochemistry and Physiology 108 (2014) 58–65

63

3.5. Effect of dsSfRyR on SfRyR expression and chlorantraniliprole tolerance

Fig. 4. Hydropathy profile of the C-terminus SfRyR amino acids. The vertical axis indicates the hydropathy index, and the horizontal axis indicates the amino acid residue numbers. The positions of the predicted transmembrane segments were indicated by the arrows.

After 3 days of continuous ingestion of dsSfRyR1 and dsSfRyR2, the mRNA level of SfRyR in the treated S. furcifera nymphs significantly reduced by 77.9% and 81.8% respectively, comparing to that in control nymphs. However, dsegfp ingestion did not alter SfRyR gene expression in nymphs (Fig. 6A). Three days of continuous ingestion of dsRNA did not kill the nymphs. When S. furcifera nymphs previously fed on normal, dsegfp-, dsSfRyR1-, and dsSfRyR2-contained diets and then on acetone-contained diet, the mortalities were 9.5%, 8.0%, 9.0% and 11.0% respectively. No significant difference was found among them. When the nymphs were first fed on normal, dsegfp- and dsSfRyR1-, and dsSfRyR2-contained diets for 3 days and then on chlorantraniliprole-contained diet for 5 days, the mortalities were 40.5%, 48.2%, 22.1% and 25.3% respectively, with the former two significantly higher than the latter two. Therefore, ingestion of dsSfRyR greatly decreased chlorantraniliprole-induced mortality in S. furcifera (Fig. 6B).

4. Discussion As the target of the novel diamide insecticides, insect RyRs have been documented in several hemipteran, lepidopteran and dipteran insect species in recent years [6,8,10–17]. However, information about the structure and function of insect RyRs is still limited. In the present paper, a putative ryanodine receptor gene SfRyR was cloned in S. furcifera. Amino acid sequence alignment shows

Fig. 5. Relative expression levels of SfRyR in different developmental stages (A), and in the head, thorax and abdomen of fifth-instar nymphs (B). Total RNA was extracted from egg, whole bodies of first- to fifth-instar nymphs (N1–N5), and macropterous female and male adults (F and M). Three biological replicates were conducted, and the mean ± SE (n = 3) was calculated to measure the relative transcript levels using the 2DDCt method. The relative expression levels were the ratios of relative copy numbers in individuals of specific developmental stage or specific body part to that in Eggs or abdomen. The columns represent averages with vertical bars indicating SE. The averages topped with the same letters are not statistically different at P = 0.05.

significantly higher than those expressed in eggs, first, second and third instars, and macropterous females (Fig. 5A). The expression levels of SfRyR were also determined in the head, thorax and abdomen of day 2 fifth-instar nymphs. SfRyR clearly had significantly higher transcript levels in the head and thorax than that in the abdomen (Fig. 5B).

Fig. 6. Effects of dietary introduction of dsSfRyR on the relative SfRyR (A) transcript level and nymph performance (B). The nymphs were continuously exposed to dsRNA for 3 days. A group of the treated nymphs were used to test the relative transcript level of SfRyR. Three biological replicates were conducted, and the mean ± SE (n = 3) was calculated to measure the relative transcript levels using the 2DDCt method. The relative expression levels were the ratios of relative copy numbers in individuals of specific treatment to that in control. Another group of dsRNA-ingested nymphs were fed on chlorantraniliprole-contained diet for 5 days. The mortality was evaluated after 5 days treatment. The columns represent averages with vertical bars indicating SE. The averages topped with the same letters are not statistically different at P = 0.05.

64

Y. Yang et al. / Pesticide Biochemistry and Physiology 108 (2014) 58–65

that SfRyR shares 78–97% sequence identities with other insect homologues. However, SfRyR sequence differs quite markedly from its mammalian counterparts (less than 50% identities with H. sapiens RyR1–3). The phylogenetic result indicates that SfRyR is distantly related to other insect RyRs, while is well segregated from three mammalian and one C. elegans RyRs. From genome data, only one isoform of RyR gene is found in D. melanogaster, Anopheles gambiae B. mori, Ap. mellifera, Ae. aegypti, Culex quinquefasciatus, Pediculus humanus humanus and Tribolium castaneum. These results indicate that S. furcifera SfRyR and other insect RyRs are the orthologous genes that have evolved from a common ancestral gene. All insect RyRs have a large N-terminal cytoplasmic domain modulating the gating of the channel pore located in the C-terminus. In the N-terminus, S. furcifera SfRyR had a MIR domain, two RIH domains, three SPRY domains, four copies of RyR repeated domain and a RIH-associated domain. In mammalian RyRs, the MIR domain has been suggested to have a ligand transferase function; the RIH domain may form the IP3 binding site in combination with the MIR domain in IP3Rs [43], and the SPRY domain is generally known to mediate protein–protein interactions [44,45]. In the C-terminus, SfRyR possessed two EF-hand domains and six hydrophobic transmembrane domains. These structural characters suggested that SfRyR may constitute a functional Ca2+ release channel, similar to Drosophila and mammalian RyRs [18,46]. Temporal and spatial expression analysis showed that SfRyR was widely expressed in all development stages including egg, first through fifth instar nymphs, macropterous adult females and males. The expression levels in fourth- and fifth-instar nymphs, and in macropterous males were significantly higher than those expressed in eggs, first, second and third instars, and macropterous females. In day 2 fifth-instar nymphs, SfRyR clearly had significantly higher transcript levels in the head and thorax than that in the abdomen. In N. lugens, NlRyR was expressed at all developmental stages including eggs, first to fifth instar nymphs, brachypterous and macropterous adults, with significantly higher mRNA expression level in macropterous adult females [8]. In the adult of P. rapae, the relative expression levels of PrRyR in head, thorax, abdomen and leg were 6.5, 26.7, 2.3 and 23 times of that in antennae [16]. In O. furnacalis, OfRyR showed high expression level in adult and pupae and the lowest in egg [14]. In H. armigera, HaRyR was significantly lowly expressed in eggs than that in third instar larvae, pupae and adults, and was highly expressed in head compared with thorax and abdomen of the third instar larvae [15]. In P. xylostella, PxRyR showed no significant difference of the mRNA expression levels between eggs and other developmental stages as well as head and other tissues [10]. Therefore, we could deduce that the temporal and spatial transcript profiles of RyR varied in different insect species. In this study, we tested whether dsSfRyR ingestion affects chlorantraniliprole sensitivity to in S. furcifera. We found that dietary ingestion of dsSfRyR1 and dsSfRyR2 significantly reduced the mRNA level of SfRyR in the treated nymphs by 77.9% and 81.8% respectively, and greatly decreased chlorantraniliprole-induced mortality in S. furcifera. Consistent with the result, deletion mutation of RyR gene unc-68 in C. elegans resulted in insensitivity to ryanodine-induced paralytic effects [47,48]. Moreover, P. xylostella PxRyR gene was slightly down-regulated in the low- and medium-level resistance populations with 6- and 35-fold resistance to chlorantraniliprole, and was significantly down-regulated in the high-level resistance population with 1750-fold resistance to chlorantraniliprole [49]. Thus, our results suggested that SfRyR gene encoded a functional RyR that mediates chlorantraniliprole toxicity to S. furcifera. Moreover, the result also indicated a possible resistance mechanism to the diamide insecticides. By down-regulation of RyR gene, an insect pest can slow the release and depletion of intracellular Ca2+ stores from the sarcoplasmic reticulum of

muscles and the endoplasmic reticulum of many cell types when induced by RyR activators, and consequently enhances resistance level to the diamide insecticides. Providing that only one isoform of RyR gene is found in insect species, down-regulation of SfRyR in S. furcifera is expected to result in a fitness cost. However, our laboratory observation did not find any negative effects of dsSfRyR ingestion on nymphal movement. We will carry out further experiments to test the negative effects of dsSfRyR on ecdysis, and on adult behaviors such as copulation, food foraging and oviposition. Acknowledgments This research was supported by the National Basic Research Program of China (973 Program, No. 2010CB126200) and the National Natural Sciences Foundation of China (31360442). We thank Drs Z. Han, and S. Dong of our laboratory for useful discussions during the course of this research. References [1] D. Rossi, V. Sorrentino, Molecular genetics of ryanodine receptors Ca2+-release channels, Cell Calcium 32 (2002) 307–319. [2] M. Inui, A. Saito, S. Fleischer, Isolation of the ryanodine receptor from cardiac sarcoplasmic reticulum and identity with the feet structures, J. Biol. Chem. 262 (1987) 15637–15642. [3] F. Zorzato, J. Fujii, K. Otsu, M. Phillips, N. Green, F. Lai, G. Meissner, D. MacLennan, Molecular cloning of cDNA encoding human and rabbit forms of the Ca2+ release channel (ryanodine receptor) of skeletal muscle sarcoplasmic reticulum, J. Biol. Chem. 265 (1990) 2244–2256. [4] G. Giannini, A. Conti, S. Mammarella, M. Scrobogna, V. Sorrentino, The ryanodine receptor/calcium channel genes are widely and differentially expressed in murine brain and peripheral tissues, J. Cell Biol. 128 (1995) 893–904. [5] G. Lahm, D. Cordova, J. Barry, New and selective ryanodine receptor activators for insect control, Bioorg. Med. Chem. 17 (2009) 4127–4133. [6] D.B. Sattelle, D. Cordova, T.R. Cheek, Insect ryanodine receptors: molecular targets for novel pest control chemicals, Invertebr. Neurosci. 8 (2008) 107– 119. [7] U. Ebbinghaus-Kintscher, P. Luemmen, N. Lobitz, T. Schulte, C. Funke, R. Fischer, T. Masaki, N. Yasokawa, M. Tohnishi, Phthalic acid diamides activate ryanodine-sensitive Ca2+ release channels in insects, Cell Calcium 39 (2006) 21–33. [8] J. Wang, Z. Xie, J. Gao, Y. Liu, W. Wang, L. Huang, J. Wang, Molecular cloning and characterization of a ryanodine receptor gene in brown planthopper (BPH), Nilaparvata lugens (Stål), Pest Manag. Sci. (2013), http://dx.doi.org/ 10.1002/ps.3616. [9] K. Kato, S. Kiyonaka, Y. Sawaguchi, M. Tohnishi, T. Masaki, N. Yasokawa, Y. Mizuno, E. Mori, K. Inoue, I. Hamachi, Molecular characterization of flubendiamide sensitivity in the lepidopterous ryanodine receptor Ca2+ release channel, Biochemistry 48 (2009) 10342–10352. [10] X. Wang, S. Wu, Y. Yang, Y. Wu, Molecular cloning, characterization and mRNA expression of a ryanodine receptor gene from diamondback moth, Plutella xylostella, Pestic. Biochem. Physiol. 102 (2012) 204–212. [11] L. Sun, L. Cui, C. Rui, X. Yan, D. Yang, H. Yuan, Modulation of the expression of ryanodine receptor mRNA from Plutella xylostella as a result of diamide insecticide application, Gene 511 (2012) 265–273. [12] L. Guo, B. Tang, W. Dong, P. Liang, X. Gao, Cloning, characterisation and expression profiling of the cDNA encoding the ryanodine receptor in diamondback moth, Plutella xylostella (L.) (Lepidoptera: Plutellidae), Pest Manag. Sci. 68 (2012) 1605–1614. [13] J.-J. Wang, Y. Li, Z. Han, Y. Zhu, Z. Xie, J. Wang, Y. Liu, X. Li, Molecular characterization of a ryanodine receptor gene in the rice leaffolder, Cnaphalocrocis medinalis (Guenée), PLoS ONE 7 (2012) e36623. [14] L. Cui, D. Yang, X. Yan, C. Rui, Z. Wang, H. Yuan, Molecular cloning, characterization and expression profiling of a ryanodine receptor gene in Asian corn borer, Ostrinia furnacalis (Guenée), PLoS ONE 8 (2013) e75825. [15] J. Wang, Y. Liu, J. Gao, Z. Xie, L. Huang, W. Wang, J. Wang, Molecular cloning and mRNA expression of a ryanodine receptor gene in the cotton bollworm, Helicoverpa armigera, Pestic. Biochem. Physiol. 107 (2013) 327–333. [16] S. Wu, F. Wang, J. Huang, Q. Fang, Z. Shen, G. Ye, Molecular and cellular analyses of a ryanodine receptor from hemocytes of Pieres rapae, Dev. Comp. Immunol. 41 (2013) 1–10. [17] H. Takeshima, M. Nishi, N. Iwabe, T. Miyata, T. Hosoya, I. Masai, Y. Hotta, Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster, FEBS Lett. 337 (1994) 81–87. [18] X. Xu, M.B. Bhat, M. Nishi, H. Takeshima, J. Ma, Molecular cloning of cDNA encoding a Drosophila ryanodine receptor and functional studies of the carboxyl-terminal calcium release channel, Biophys. J . 78 (2000) 1270–1281.

Y. Yang et al. / Pesticide Biochemistry and Physiology 108 (2014) 58–65 [19] D. Cordova, E. Benner, M. Sacher, J. Rauh, J. Sopa, G. Lahm, T. Selby, T. Stevenson, L. Flexner, S. Gutteridge, Anthranilic diamides: a new class of insecticides with a novel mode of action, ryanodine receptor activation, Pestic. Biochem. Physiol. 84 (2006) 196–214. [20] Y. Tao, S. Gutteridge, E.A. Benner, L. Wu, D.F. Rhoades, M.D. Sacher, M.A. Rivera, J. Desaeger, D. Cordova, Identification of a critical region in the Drosophila ryanodine receptor that confers sensitivity to diamide insecticides, Insect Biochem. Mol. Biol. 43 (2013) 820–828. [21] B. Troczka, C.T. Zimmer, J. Elias, C. Schorn, C. Bass, T. Davies, L.M. Field, M.S. Williamson, R. Slater, R. Nauen, Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor, Insect Biochem. Mol. Biol. 42 (2012) 873–880. [22] L. Guo, Y. Wang, X. Zhou, Z. Li, S. Liu, L. Pei, X. Gao, Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole, Pest Manag. Sci. (2013), http:// dx.doi.org/10.1002/ps.3651. [23] L. Wang, Y. Zhang, Z. Han, Y. Liu, J. Fang, Cross-resistance and possible mechanisms of chlorpyrifos resistance in Laodelphax striatellus (Fallén), Pest Manag. Sci. 66 (2010) 1096–1100. [24] S. Sanada-Morimura, S. Sakumoto, R. Ohtsu, A. Otuka, S.-H. Huang, D. Van Thanh, M. Matsumura, Current status of insecticide resistance in the small brown planthopper, Laodelphax striatellus, in Japan, Taiwan, and Vietnam, Appl. Entomol. Zool. 46 (2011) 65–73. [25] Y. Zhang, S. Li, L. Wang, J. Zi, P. He, J. Fang, Overexpression of carboxylesterase1 and mutation (F439H) of acetylcholinesterase-1 are associated with chlorpyrifos resistance in Laodelphax striatellus, Pestic. Biochem. Physiol. 106 (2013) 8–13. [26] Y. Zhang, H. Guo, Q. Yang, S. Li, L. Wang, G. Zhang, J. Fang, Overexpression of a P450 gene (CYP6CW1) in buprofezin-resistant Laodelphax striatellus (Fallén), Pestic. Biochem. Physiol. 104 (2012) 277–282. [27] T. Nakao, M. Hama, N. Kawahara, K. Hirase, Fipronil resistance in Sogatella furcifera: molecular cloning and functional expression of wild-type and mutant RDL GABA receptor subunits, J. Pestic. Sci. 37 (2012) 37–44. [28] J. Chen, D. Zhang, Q. Yao, J. Zhang, X. Dong, H. Tian, W. Zhang, Feeding-based RNA interference of a trehalose phosphate synthase gene in the brown planthopper, Nilaparvata lugens, Insect Mol. Biol. 19 (2010) 777–786. [29] P. He, J. Zhang, N.-Y. Liu, Y.-N. Zhang, K. Yang, S.-L. Dong, Distinct expression profiles and different functions of odorant binding proteins in Nilaparvata lugens Stål, PLoS ONE 6 (2011) e28921. [30] S. Jia, P.-J. Wan, L.-T. Zhou, L.-L. Mu, G.-Q. Li, Molecular cloning and RNA interference-mediated functional characterization of a Halloween gene spook in the white-backed planthopper Sogatella furcifera, BMC Mol. Biol. 14 (2013) 19. [31] M.A. Larkin, G. Blackshields, N.P. Brown, R. Chenna, P.A. McGettigan, H. McWilliam, F. Valentin, I.M. Wallace, A. Wilm, R. Lopez, J.D. Thompson, T.J. Gibson, D.G. Higgins, Clustal W and Clustal X version 2.0, Bioinformatics 23 (2007) 2947–2948.

65

[32] A. Stamatakis, RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models, Bioinformatics 22 (2006) 2688–2690. [33] D. Darriba, G.L. Taboada, R. Doallo, D. Posada, ProtTest 3: fast selection of bestfit models of protein evolution, Bioinformatics 27 (2011) 1164–1165. [34] Q. Fu, Z. Zhang, C. Hu, F. Lai, Z. Sun, A chemically defined diet enables continuous rearing of the brown planthopper, Nilaparvata lugens, (Stål) (Homoptera: Delphacidae), Appl. Entomol. Zool. 36 (2001) 111–116. [35] H. Yang, Z. Wang, D.-C. Jin, Sublethal effects of chlorantraniliprole on the experimental populations of the white-backed planthopper, Sogatella furcifera (Hemiptera: Delphacidae), Acta Entomol. Sinica 55 (2012) 1161–1167. [36] H. Yang, Z. Wang, D.-C. Jin, Sublethal effect of chlorantraniliprole on the experimental population of non-target insect Nilaparvata lugens, Chin. J. Appl. Ecol. 24 (2013) 549–555. [37] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucleic Acids Res. 29 (2001) e45. [38] J. Vandesompele, K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, F. Speleman, Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes, Genome Biol. 3 (2002) [RESEARCH0034]. [39] V. Sorrentino, P. Volpe, Ryanodine receptors: how many, where and why?, Trends Pharmacol Sci. 14 (1993) 98–103. [40] Y. Ogawa, Role of ryanodine receptors, Crit. Rev. Biochem. Mol. Biol. 29 (1994) 229–274. [41] R.K. Wierenga, W.G. Hol, Predicted nucleotide-binding properties of p21 protein and its cancer-associated variant, Nature 302 (1983) 842–844. [42] M. Zhao, P. Li, X. Li, L. Zhang, R.J. Winkfein, S.W. Chen, Molecular identification of the ryanodine receptor pore-forming segment, J. Biol. Chem. 274 (1999) 25971–25974. [43] C.P. Ponting, Novel repeats in ryanodine and IP3 receptors and protein Omannosyltransferases, Trends Biochem. Sci. 25 (2000) 47–50. [44] J.-S. Woo, H.-Y. Suh, S.-Y. Park, B.-H. Oh, Structural basis for protein recognition by B30. 2/SPRY domains, Mol. Cell 24 (2006) 967–976. [45] Y. Cui, H.-S. Tae, N.C. Norris, Y. Karunasekara, P. Pouliquin, P.G. Board, A.F. Dulhunty, M.G. Casarotto, A dihydropyridine receptor a1s loop region critical for skeletal muscle contraction is intrinsically unstructured and binds to a SPRY domain of the type 1 ryanodine receptor, Int. J. Biochem. Cell Biol. 41 (2009) 677–686. [46] G. Meissner, Regulation of mammalian ryanodine receptors, Front. Biosci. 7 (2002) 2072–2080. [47] E.B. Maryon, R. Coronado, P. Anderson, Unc-68 encodes a ryanodine receptor involved in regulating C. elegans body-wall muscle contraction, J. Cell Biol. 134 (1996) 885–893. [48] E.B. Maryon, B. Saari, P. Anderson, Muscle-specific functions of ryanodine receptor channels in Caenorhabditis elegans, J. Cell Sci. 111 (1998) 2885–2895. [49] Q. Lin, F. Jin, Z. Hu, H. Chen, F. Yin, Z. Li, X. Dong, D. Zhang, S. Ren, X. Feng, Transcriptome analysis of chlorantraniliprole resistance development in the diamondback moth Plutella xylostella, PLoS ONE 8 (2013) e72314.