- Email: [email protected]
Knockdown of the GABA receptor RDL genes decreases abamectin susceptibility in the rice stem borer, Chilo suppressalis
Pesticide Biochemistry and Physiology xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest
Knockdown of the GABA receptor RDL genes decreases abamectin susceptibility in the rice stem borer, Chilo suppressalis Xiangkun Meng, Xuemei Yang, Nan Zhang, Heng Jiang, Huichen Ge, Minxuan Chen, Kun Qian, ⁎ Jianjun Wang College of Horticulture and Plant Protection, Yangzhou University, Yangzhou 225009, China
A R T I C LE I N FO
A B S T R A C T
Keywords: RDL subunits mRNA expression RNA interference Abamectin susceptibility
The γ-aminobutyric acid (GABA) receptor is a primary neurotransmitter receptor in both vertebrate and invertebrate nervous systems. Multiple RDL subunits have been found in insects including the rice stem borer, Chilo suppressalis, however, comparative characterization of duplicated RDL genes in insects is still limited. In this study, comparison of the genomic sequences and the cDNA sequences revealed that both CsRDL1 and CsRDL2 consisted of 10 exons and 9 introns, and their exon-intron boundaries occur in the same position with respect to the coding sequences. Expression profiling showed that both CsRDL1 and CsRDL2 were predominantly expressed in nervous system, and had low expression levels in the gut and integument. The transcript level of CsRDL2 dramatically increased from the prepupae to late pupae and were much higher than that of CsRDL1 in adult stages. Notably, dietary ingestion of dsRDL1 and dsRDL2 significantly decreased the larval susceptibility to abamectin. These results suggest that CsRDL1 and CsRDL2 might play both physiological roles in development and toxicological roles in action of abamectin in C. suppressalis.
1. Introduction The ionotropic γ-aminobutyric acid (GABA) receptor (GABAR) belongs to the Cys-loop ligand-gated ion channel (Cys-loop LGIC) superfamily. As a primary neurotransmitter receptor in both vertebrate and invertebrate nervous systems, GABAR mediates rapid inhibitory neurotransmission by regulating the flow of chloride ions (Hosie et al., 1997). In insect, the ionotropic GABA receptors were the principal targets of several insecticides, including the cyclodienes dieldrin, the phenylpyrazoles fipronil, meta-diamides broflanilide and the isoxazolines fluralaner (Buckingham et al., 2017; Nakao, 2017; Casida and Durkin, 2015). The binding studies revealed that the macrocyclic lactones such as ivermectin and milbemectin also target on insect GABARs (Nakao et al., 2015). In addition, the neonicotinoid imidacloprid was recently reported to act as an antagonist of insect RDL expressed in Xenopus laevis oocytes (Taylor-Wells et al., 2015; Taylor-Wells et al., 2017). While large diversity of ionotropic GABAR subunits have been identified in vertebrates, only four subunits including the RDL (resistant to dieldrin), LCCH3 (ligand-gated chloride channel homolog 3), GRD (the GABA and glycine-like receptor of Drosophila) and CG8916 have been discovered in insects (Sheng et al., 2018; Wei et al., 2017), among
⁎
which RDL has attracted extensive attention because of its role in target site- mediated insecticide resistance (Nakao, 2017; Nakao et al., 2011; Nakao et al., 2012; Zhang et al., 2016). Analyses of insect genome sequences showed a single RDL encoding gene in Drosophila melanogaster, Musca domestica, Apis mellifera, and Tribolium castaneum (Jones and Sattelle, 2006; Jones and Sattelle, 2007; Scott et al., 2014; Del Villar and Jones, 2018), while two RDL genes were found in Acyrthosiphon pisum and Plutella xylostella and three in Bombyx mori (Del Villar and Jones, 2018; Yuan et al., 2010; Yu et al., 2010). Furthermore, four RDL variants generated by alternative splicing of exon 3 (exon 3a, exon 3b) and exon 6 (exon 6a, exon 6b) have been found in various insects (Jones and Sattelle, 2007; Del Villar and Jones, 2018; Wei et al., 2015; Buckingham et al., 2005; Jones et al., 2010). The rice stem borer, Chilo suppressalis (Walker) (Lepidoptera: Crambidae) is one of the most damaging rice pests in China (He et al., 2013). The use of insecticides is the primary strategy employed to control C. suppressalis, and the macrocyclic lactone, abamectin, showed potent insecticidal activity against C. suppressalis (He et al., 2013; Huang et al., 2017). Our previous identification of CsRDL1 and CsRDL2 in C. suppressalis by database search prompted us to characterize the expression and biological function of these two genes. Given that a recent study has reported the cloning and heterogenous expression of
Corresponding author. E-mail address: [email protected] (J. Wang).
https://doi.org/10.1016/j.pestbp.2018.11.017 Received 16 October 2018; Received in revised form 21 November 2018; Accepted 27 November 2018 0048-3575/ © 2018 Published by Elsevier Inc.
Please cite this article as: Meng, X., Pesticide Biochemistry and Physiology, https://doi.org/10.1016/j.pestbp.2018.11.017
Pesticide Biochemistry and Physiology xxx (xxxx) xxx–xxx
X. Meng et al.
2.4. RNA interference
CsRDL1 and CsRDL2 (Sheng et al., 2018), in this study, the role of CsRDL1 and CsRDL2 in abamectin toxicity was investigated using RNA interference (RNAi). Additionally, both genomic structure and expression profiles of CsRDL1 and CsRDL2 were comparatively analyzed.
The dsRNA of CsRDLs and EGFP (enhanced green fluorescent protein, supplied by professor Zewen Liu in Nanjing Agricultural University, China) were synthesized and purified with gene specific primers (Table 2) using TranscriptAid T7 High Yield Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions. The synthesized dsRNA were diluted in DEPC water with a concentration of 3 μg/μL, and stored at −80 °C until use. Oral delivery of dsRNA method was performed as previously described with slight modification (Xiang et al., 2017; Wang et al., 2017). The third instar larvae were starved for 5 h and then fed on the fresh artificial diet containing 20 μg/g of dsRNA for 12, 24, 36, 48, 60, and 72 h. The artificial diet containing DEPC water and dsEGFP was used as blank and negative control. A total of 30 larvae were used as a treatment and each treatment repeated three times. Larvae were collected at different times post-feeding, and three larvae were collected as a sample.
2. Materials and methods 2.1. Insect and insecticide The C. suppressalis larvae were collected from a suburb of Yangzhou (32.39°N, 119.42°E) and reared on an artificial diet in incubator at 28 ± 1 °C, 70 ± 5% relative humidity and 16 h light/8 h dark photoperiod without exposure to any pesticides for more than five years. Technical grade abamectin (93.7% active ingredient) was supplied by Nantong Liannong pesticide formulation Co. Ltd. (Nantong, Jiangsu, China). 2.2. Structure analysis of insect RDL genomic sequences
2.5. Toxicity bioassay
The genomic and cDNA sequences of insect RDLs were identified from the whole genome shotgun database (WGS) of NCBI (https:// www.ncbi.nlm.nih.gov/) and the InsectBase (http://www.insectgenome.com/) (Yin et al., 2014) (Table 1), and were manually aligned to locate the exon-intron boundaries. Sequence alignment was performed using CLUSTALW and DNAMAN with the default settings (Thompson et al., 1994). The genomic structures were constructed using IBS 1.0 software (Liu et al., 2015).
The toxicity bioassays were performed as previously described (Huang et al., 2016). The artificial diet containing a final concentrations of 20 μg/g dsRDL and 0.15 mg/L abamectin (LC50 concentration determined by preliminary experiment) was used for the bioassays (ABA + dsRDL). Artificial diet containing 0.15 mg/L abamectin and 20 μg/g dsEGFP or equal volumes of DEPC water were used as the controls (ABA + dsEGFP, ABA). The artificial diet without insecticide or dsRNA was used as blank (CK). A total of 30 third instar larvae were used as a treatment and each treatment repeated three times. Mortalities were recorded at 36 and 72 h post-feeding. Larvae showing no sign of movement when gently touched with a brush were scored as dead.
2.3. Reverse transcription quantitative PCR (RT-qPCR) Total RNAs were extracted from the whole body in different developmental stages (such as the larvae, pupae and adults) or specific tissues (including brain, nerve cord, foregut, midgut, hindgut, fat body, integument, hemolymph, ovary and malpighian tubule) in third instar larvae using the MiniBEST Universal RNA Extraction Kit (Takara, Dalian, China), and 1 μg of total RNA was used to synthesize the cDNA template using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, Dalian, China) according to the manufacturer's instructions. Specific primers for CsRDLs and housekeeping gene EF-1α (Hui et al., 2011) (Table 2) were employed for the determination of gene expressions using the TB Green™ Premix Ex Taq™ (TaKaRa, Dalian, China). Briefly, a 20 μL PCR reaction volume contains 10 μL TB Premix EX Taq™ II (2×), 2 μL diluted cDNA template with a concentration of 200 ng/μL, 0.8 μL (10 μM) of each primer and 6.4 μL diethylpyrocarbonate (DEPC) treated water. The PCR reaction was performed using a CFX96 RealTime PCR Detection System (Bio-Rad Laboratories, Inc., Hercules, CA, USA) with a condition of 95 °C for 30 s, 40 cycles of 95 °C for 5 s and 60 °C for 30 s, and a final melting curve analysis was performed. The relative gene expressions were calculated using the 2−ΔΔCT method and normalized to EF-1α in the same sample (Pfaffl, 2001). Means and standard error were obtained from the average of three independent sample sets.
2.6. Data analysis All data were expressed as the means ± standard error (SE). Statistical analysis was performed by one-way ANOVA (ANOVA, SPSS v.10.0; SPSS Inc., Chicago, IL), and comparisons of the means were made using Tukey's test (P < .05). 3. Results 3.1. Genomic structures of CsRDLs The genomic structures of RDLs in C. suppressalis and other insects were predicted by comparing the cDNA sequences with the genomic sequences retrieved from contigs in the whole genome shotgun databases. The results showed that, similar to B. mori, both CsRDL1 and CsRDL2 comprise 10 exons and 9 introns, and their exon-intron boundaries occur in the same position with respect to the coding sequences. However, RDLs in D. melanogaster and T. castaneum were split into 9 exons (Fig. 1). The 5′ donor and 3′ acceptor site sequences in insect RDLs were in agreement with the GT/AG consensus sequence (Yuan et al., 2010).
Table 1 Sources of cDNA and genomic DNA sequences of insect RDLs. RDLs
cDNA sequences
Genomic DNA sequences
3.2. Spatial and temporal expression of CsRDLs
C. suppressalis RDL1
KX856969
C. suppressalis RDL2
KX856970
B. mori RDL1 B. mori RDL2 B. mori RDL3 D. melanogaster RDL1 T. castaneum RDL1
NM_001099824 NM_001195700 NM_001195701 NM_001274688 XM_015984596
contig234745 (ANCD01234741.1), csug220386 csug7960, csug190194, contig220763 (ANCD01220759.1) NW_004582015 BABH01006866, BABH01006867 BABH01040612 NT_037436 NW_015451027
The mRNA expression levels of CsRDL1 and CsRDL2 in different tissues of third larvae were determined. The results showed that both of CsRDL1 and CsRDL2 were predominantly expressed in brain and nerve cord, slightly expressed in gut and integument, but had undetectable expression level in hemolymph, ovary and malpighian tubule (Fig. 2A). Notably, the expression levels of CsRDL2 in foregut, midgut, fat body and integument were much higher than CsRDL1. Temporal expression profiling of CsRDL1 and CsRDL2 in different 2
Pesticide Biochemistry and Physiology xxx (xxxx) xxx–xxx
X. Meng et al.
Table 2 The primers used in this study. Description
Primer name
Sequence (5′ to 3′)
Primers for CsRDLs qPCR
CsRDL1 F CsRDL1 R CsRDL2 F CsRDL2 R EF-1α F EF-1α R dsRDL1 F dsRDL1 R dsRDL2 F dsRDL2 R dsEGFP F dsEGFP R
GGCGTCACCATGTATGTGCTCT CCCACCGATAAGGTTTCCACTC ATAACTTTGCGCTCGTGGTTGC GTCCTCCGTAATTTGGCCTCACT TGAACCCCCATACAGCGAATCC TCTCCGTGCCAACCAGAAATAGG TAATACGACTCACTATAGGGCACCATGCGGGACATCCGATAC TAATACGACTCACTATAGGGAAACTTGCGAAGACCATGACGA TAATACGACTCACTATAGGGACCGATCCAAGGTTGGCATAT TAATACGACTCACTATAGGGGCGAGTAGTTTCCTGTGGTGAGA TAATACGACTCACTATAGGGCCTCGTGACCACCCTGACCTAC TAATACGACTCACTATAGGGCACCTTGATGCCGTTCTTCTGC
Primers for dsRNA synthesis
Fig. 1. Genomic structures of RDLs from C. suppressalis, B. mori, D. melanogaster and T. castaneum.
Fig. 2. The mRNA expression levels of CsRDL1 and CsRDL2 in C. suppressalis. (A) The relative CsRDLs gene expression in different tissues of C. suppressalis. (B) The relative CsRDLs gene expression in different developmental stages of C. suppressalis. *Significant difference by one-way ANOVA test (P < 0.05).
3.3. RNAi of CsRDLs and the effect on larvae susceptibility to abamectin
developmental stages of C. suppressalis revealed that the mRNA expression of CsRDLs gradually decreased during larvae development from 1st instar to 6th instar and prepupae (Fig. 2B). The expression level of CsRDL2 dramatically increased in the late pupae stage and held a relative high expression level in adult stages, while CsRDL1 maintained a low expression level in all pupae and adult stages.
Oral delivery of dsRNA was used for the RNAi of CsRDLs. The expression levels of CsRDL1 were significantly reduced by 27.4% and 44.5% at 24 h and 36 h post-feeding of dsRDL1 respectively, when compared to the larvae treated with dsEGFP (Fig. 3A). The transcript levels of CsRDL2 in dsRDL2 treatment were reduced by 28.3% and 42.5% at 12 h and 24 h post-feeding respectively, and the maximum 3
Pesticide Biochemistry and Physiology xxx (xxxx) xxx–xxx
X. Meng et al.
Fig. 3. RNAi of CsRDLs gene in larvae of C. suppressalis. (A) The relative CsRDL1 gene expression induced by RNAi through oral delivery of dsRDL1. (B) The relative CsRDL2 gene expression induced by RNAi through oral delivery of dsRDL2.
found in some lepidoptera insects, such as two RDL genes in P. xylostella and three in B. mori, (Yuan et al., 2010; Yu et al., 2010). Recently, two RDL genes, CsRDL1 and CsRDL2, were identified from C. suppressalis (Sheng et al., 2018). In the present study, comparison of the genomic sequences and the cDNA sequences of seven RDLs from four insects showed that, similar to RDLs in P. xylostella (Yuan et al., 2010), the two C. suppressalis RDLs and the three B. mori RDLs consisted of 10 exons and nine introns, while nine exons and eight introns were identified in the RDLs of T. castaneum and D. melanogaster (Buckingham et al., 2005). The similar genomic structures of multiple RDLs in lepidoptera insects suggest the recent occurrence of gene duplication. Theoretically, gene expression pattern was related to its physiological roles. In order to explore the potential physiological roles of CsRDL1 and CsRDL2 in C. suppressalis, their expression profiles were extensively studied. Both CsRDL1 and CsRDL2 were predominantly expressed in the nervous tissues and showed low expression levels in gut and integument. Interestingly, the transcript levels of CsRDL1 decreased from larval to adult stages, while the transcript levels of CsRDL2 dramatically increased from prepupa to late pupae stages and showed high expression level in adult stages. These results indicated that in addition to the neural transmission function, CsRDLs may have multiple physiological roles in C. suppressalis, as has been reported in D. melanogaster that the RDL can modulate olfactory associative learning and aggression (Liu et al., 2007; Yuan et al., 2014). Abamectin belongs to the avermectin subfamily of macrocyclic lactones and has been widely used for the control of pests (Lasota and Dybas, 1991). Heterologous expression and binding studies suggested that in addition to targeting insect glutamate-gated chloride channels (GluCls), which is another member of Cys-loop LGIC superfamily, the abamectin also acts on RDL (Nakao et al., 2015; Wolstenholme and Rogers, 2005; Meng et al., 2018; Xu et al., 2016). However, the role of RDL in abamectin toxicity has rarely been studied in vivo. A recent study reported that the knockdown of TcRDL decreased acaricidal activity of abamectin in Tetranychus cinnabarinus (Xu et al., 2016). In consistence with this finding, we found that the dietary ingestion of dsRDL1 and dsRDL2 significantly decreased the larval susceptibility to abamectin. It has been reported that the insecticides fipronil and fluralaner displayed similar IC50 values in inhibiting GABA activated currents in oocytes injected with either CsRDL1 or CsRDL2 (Sheng et al., 2018). Further electrophysiological experiments are needed to confirm the role of CsRDL1 and CsRDL2 in the toxicology of abamectin.
Fig. 4. The survival rates of larvae treated with 0.15 mg/L abamectin. CK: no treatment; ABA: 0.15 mg/L abamectin; ABA + dsEGFP: 0.15 mg/L abamectin +20 μg/g dsEGFP; ABA + dsRDL1: 0.15 mg/L abamectin +20 μg/g dsRDL1; ABA + dsRDL2: 0.15 mg/L abamectin +20 μg/g dsRDL2. *Significant difference by one-way ANOVA test (P < 0.05).
interference efficiency was observed at 36 h post-feeding with an interference efficiency of 52.9% (Fig. 3B). The effects of CsRDLs on larval susceptibility to abamectin were investigated by the feeding of artificial diet containing both dsRDL and abamectin. The results revealed that the susceptibilities of larvae to abamectin decreased when the CsRDLs were knockdown (Fig. 4). The mortalities of dsEGFP treated larvae to abamectin were 44.4% and 62.2% at 36 h and 72 h post-feeding respectively, while the mortalities of dsRDL2 treated larvae to abamectin were 17.4% and 32.5% at 36 h and 72 h post-feeding respectively. No significant difference of mortalities was found among the dsRDL1 and the control treatments at 36 h post-feeding, while the mortality of dsRDL1 treated larvae was decreased at 72 h post-feeding with a mortality of 52.1% (Fig. 4). 4. Discussion Insect RDLs have been widely studied since the first discovery of RDL in D. melanogaster (Ffrench-Constant et al., 1991). While only a single RDL gene was found in D. melanogaster, M. domestica, A. mellifera, and T. castaneum (Jones and Sattelle, 2006; Jones and Sattelle, 2007; Scott et al., 2014; Del Villar and Jones, 2018), multiple RDL genes were 4
Pesticide Biochemistry and Physiology xxx (xxxx) xxx–xxx
X. Meng et al.
Acknowledgements
646–652. Nakao, T., Hama, M., Kawahara, N., Hirase, K., 2012. Fipronil resistance in Sogatella furcifera: Molecular cloning and functional expression of wild-type and mutant RDL GABA receptor subunits. J. Pestic. Sci. 37, 37–44. Nakao, T., Banba, S., Hirase, K., 2015. Comparison between the modes of action of novel meta-diamide and macrocyclic lactone insecticides on the RDL GABA receptor. Pestic. Biochem. Physiol. 120, 101–108. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res. 29, 2002–2007. Scott, J.G., Warren, W.C., Beukeboom, L.W., Bopp, D., Clark, A.G., Giers, S.D., Hediger, M., Jones, A.K., Kasai, S., Leichter, C.A., Li, M., Meisel, R.P., Minx, P., Murphy, T.D., Nelson, D.R., Reid, W.R., Rinkevich, F.D., Robertson, H.M., Sackton, T.B., Sattelle, D.B., Thibaud-Nissen, F., Tomlinson, C., van de Zande, L., Walden, K.K.O., Wilson, R.K., Liu, N., 2014. Genome of the house fly, Musca domestica L., a global vector of diseases with adaptations to a septic environment. Genome Biol. 15. Sheng, C.W., Jia, Z.Q., Ozoe, Y., Huang, Q.T., Han, Z.J., Zhao, C.Q., 2018. Molecular cloning, spatiotemporal and functional expression of GABA receptor subunits RDL1 and RDL2 of the rice stem borer Chilo suppressalis. Insect Biochem. Mol. Biol. 94, 18–27. Taylor-Wells, J., Brooke, B.D., Bermudez, I., Jones, A.K., 2015. The neonicotinoid imidacloprid, and the pyrethroid deltamethrin, are antagonists of the insect Rdl GABA receptor. J. Neurochem. 135, 705–713. Taylor-Wells, J., Hawkins, J., Colombo, C., Bermudez, I., Jones, A.K., 2017. Cloning and functional expression of intracellular loop variants of the honey bee (Apis mellifera) RDL GABA receptor. Neurotoxicology 60, 207–213. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Wang, X.Y., Du, L.X., Liu, C.X., Gong, L., Han, L.Z., Peng, Y.F., 2017. RNAi in the striped stem borer, Chilo suppressalis, establishes a functional role for aminopeptidase N in Cry1Ab intoxication. J. Invertebr. Pathol. 143, 1–10. Wei, Q., Wu, S.F., Niu, C.D., Yu, H.Y., Dong, Y.X., Gao, C.F., 2015. Knockdown of the ionotropic gamma-aminobutyric acid receptor (GABAR) Rdl gene decreases fipronil susceptibility of the small brown planthopper, Laodelphax striatellus (Hemiptera: Delphacidae). Arch. Insect Biochem. 88, 249–261. Wei, Q., Wu, S.F., Gao, C.F., 2017. Molecular characterization and expression pattern of three GABA receptor-like subunits in the small brown planthopper Laodelphax striatellus (Hemiptera: Delphacidae). Pestic. Biochem. Physiol. 136, 34–40. Wolstenholme, A.J., Rogers, A.T., 2005. Glutamate-gated chloride channels and the mode of action of the avermectin/milbemycin anthelmintics. Parasitology 131, S85–S95. Xiang, M., Zhang, L., Lu, Y., Tang, Q., Liang, P., Shi, X., Song, D., Gao, X., 2017. A Pglycoprotein gene serves as a component of the protective mechanisms against 2tridecanone and abamectin in Helicoverpa armigera. Gene 627, 63–71. Xu, Z., Wu, Q., Xu, Q., He, L., 2016. Functional analysis reveals glutamate-gated chloride and γ-amino butyric acid channels as targets of avermectins in the carmine spider mite. Toxicol. Sci. 155, 258–269. Yin, C.L., Liu, Y., Liu, J., Xiao, H., Huang, S., Lin, Y., Han, Z., Li, F., 2014. ChiloDB: a genomic and transcriptome database for an important rice insect pest Chilo suppressalis. Database 15, 92–108. Yu, L.L., Cui, Y.J., Lang, G.J., Zhang, M.Y., Zhang, C.X., 2010. The ionotropic gammaaminobutyric acid receptor gene family of the silkworm, Bombyx mori. Genome 53, 688–697. Yuan, G., Gao, W., Yang, Y., Wu, Y., 2010. Molecular cloning, genomic structure, and genetic mapping of two Rdl-orthologous genes of gaba receptors in the diamondback moth, Plutella xylostella. Arch. Insect Biochem. 74, 81–90. Yuan, Q., Song, Y., Yang, C.H., Jan, L.Y., Jan, Y.N., 2014. Female contact modulates male aggression via a sexually dimorphic GABAergic circuit in Drosophila. Nat. Neurosci. 17, 81–88. Zhang, Y.X., Meng, X.K., Yang, Y.X., Li, H., Wang, X., Yang, B.J., Zhang, J.H., Li, C., Millar, N.S., Liu, Z.W., 2016. Synergistic and compensatory effects of two point mutations conferring target-site resistance to fipronil in the insect GABA receptor RDL. Sci. Rep. 6.
This work was supported by National Natural Science Foundation of China (31701807, 31572000), Jiangsu Province Science Foundation for Youths (BK20170491) and the Key Laboratory of Biology, Genetics and Breeding of Special Economic Animals & Plants,Ministry of Agriculture,P.R. China (Y2018PT14). References Buckingham, S.D., Biggin, P.C., Sattelle, B.M., Brown, L.A., Sattelle, D.B., 2005. Insect GABA receptors: Splicing, editing, and targeting by antiparasitics and insecticides. Mol. Pharmacol. 68, 942–951. Buckingham, S.D., Ihara, M., Sattelle, D.B., Matsuda, K., 2017. Mechanisms of action, resistance and toxicity of insecticides targeting GABA receptors. Curr. Med. Chem. 24, 2935–2945. Casida, J.E., Durkin, K.A., 2015. Novel GABA receptor pesticide targets. Pestic. Biochem. Physiol. 121, 22–30. Del Villar, S.G., Jones, A.K., 2018. Cloning and functional characterisation of the duplicated RDL subunits from the pea aphid, Acyrthosiphon pisum. Int. J. Mol. Sci. 19. Ffrench-Constant, R.H., Mortlock, D.P., Shaffer, C.D., MacIntyre, R.J., Roush, R.T., 1991. Molecular cloning and transformation of cyclodiene resistance in Drosophila: an invertebrate gamma-aminobutyric acid subtype a receptor locus. Proc. Natl. Acad. Sci. U. S. A. 88, 7209–7213. He, Y., Zhang, J., Gao, C., Su, J., Chen, J., Shen, J., 2013. Regression analysis of dynamics of insecticide resistance in field populations of Chilo suppressalis (Lepidoptera: Crambidae) during 2002-2011 in China. J. Econ. Entomol. 106, 1832–1837. Hosie, A.M., Aronstein, K., Sattelle, D.B., Ffrench-Constant, R.H., 1997. Molecular biology of insect neuronal GABA receptors. Trends Neurosci. 20, 578–583. Huang, L., Lu, M., Han, G., Du, Y., Wang, J., 2016. Sublethal effects of chlorantraniliprole on development, reproduction and vitellogenin gene (CsVg) expression in the rice stem borer, Chilo suppressalis. Pest Manag. Sci. 72, 2280–2286. Huang, S., Chen, Q., Qin, W., Sun, Y., Qin, H., 2017. Resistance monitoring of four insecticides and a description of an artificial diet incorporation method for Chilo suppressalis (Lepidoptera: Crambidae). J. Econ. Entomol. 110, 2554–2561. Hui, X.M., Yang, L.W., He, G.L., Yang, Q.P., Han, Z.J., Li, F., 2011. RNA interference of ace1 and ace2 in Chilo suppressalis reveals their different contributions to motor ability and larval growth. Insect Biochem. Molec. 20, 507–518. Jones, A.K., Sattelle, D.B., 2006. The cys-loop ligand-gated ion channel superfamily of the honeybee, Apis mellifera. Invertebr. Neurosci. 6, 123–132. Jones, A.K., Sattelle, D.B., 2007. The cys-loop ligand-gated ion channel gene superfamily of the red flour beetle, Tribolium castaneum. BMC Genomics 8. Jones, A.K., Bera, A.N., Lees, K., Sattelle, D.B., 2010. The cys-loop ligand-gated ion channel gene superfamily of the parasitoid wasp, Nasonia vitripennis. Heredity 104, 247–259. Lasota, J.A., Dybas, R.A., 1991. Avermectins, a novel class of compounds: implications for use in arthropod pest control. Annu. Rev. Entomol. 36, 91–117. Liu, X., Krause, W.C., Davis, R.L., 2007. GABA(a) receptor RDL inhibits Drosophila olfactory associative learning. Neuron 56, 1090–1102. Liu, W., Xie, Y., Ma, J., Luo, X., Nie, P., Zuo, Z., Lahrmann, U., Zhao, Q., Zheng, Y., Zhao, Y., Xue, Y., Ren, J., 2015. IBS: an illustrator for the presentation and visualization of biological sequences. Bioinformatics 31, 3359–3361. Meng, X.K., Xie, Z.J., Zhang, N., Ji, C.H., Dong, F., Qian, K., Wang, J.J., 2018. Molecular cloning and characterization of GABA receptor and GluCl subunits in the western flower thrips, Frankliniella occidentalis. Pestic. Biochem. Physiol. 150, 33–39. Nakao, T., 2017. Mechanisms of resistance to insecticides targeting RDL GABA receptors in planthoppers. Neurotoxicology 60, 293–298. Nakao, T., Kawase, A., Kinoshita, A., Abe, R., Hama, M., Kawahara, N., Hirase, K., 2011. The A2'N mutation of the RDL gamma-aminobutyric acid receptor conferring fipronil resistance in Laodelphax striatellus (Hemiptera: Delphacidae). J. Econ. Entomol. 104,
5
Contents lists available at ScienceDirect
Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest
Knockdown of the GABA receptor RDL genes decreases abamectin susceptibility in the rice stem borer, Chilo suppressalis Xiangkun Meng, Xuemei Yang, Nan Zhang, Heng Jiang, Huichen Ge, Minxuan Chen, Kun Qian, ⁎ Jianjun Wang College of Horticulture and Plant Protection, Yangzhou University, Yangzhou 225009, China
A R T I C LE I N FO
A B S T R A C T
Keywords: RDL subunits mRNA expression RNA interference Abamectin susceptibility
The γ-aminobutyric acid (GABA) receptor is a primary neurotransmitter receptor in both vertebrate and invertebrate nervous systems. Multiple RDL subunits have been found in insects including the rice stem borer, Chilo suppressalis, however, comparative characterization of duplicated RDL genes in insects is still limited. In this study, comparison of the genomic sequences and the cDNA sequences revealed that both CsRDL1 and CsRDL2 consisted of 10 exons and 9 introns, and their exon-intron boundaries occur in the same position with respect to the coding sequences. Expression profiling showed that both CsRDL1 and CsRDL2 were predominantly expressed in nervous system, and had low expression levels in the gut and integument. The transcript level of CsRDL2 dramatically increased from the prepupae to late pupae and were much higher than that of CsRDL1 in adult stages. Notably, dietary ingestion of dsRDL1 and dsRDL2 significantly decreased the larval susceptibility to abamectin. These results suggest that CsRDL1 and CsRDL2 might play both physiological roles in development and toxicological roles in action of abamectin in C. suppressalis.
1. Introduction The ionotropic γ-aminobutyric acid (GABA) receptor (GABAR) belongs to the Cys-loop ligand-gated ion channel (Cys-loop LGIC) superfamily. As a primary neurotransmitter receptor in both vertebrate and invertebrate nervous systems, GABAR mediates rapid inhibitory neurotransmission by regulating the flow of chloride ions (Hosie et al., 1997). In insect, the ionotropic GABA receptors were the principal targets of several insecticides, including the cyclodienes dieldrin, the phenylpyrazoles fipronil, meta-diamides broflanilide and the isoxazolines fluralaner (Buckingham et al., 2017; Nakao, 2017; Casida and Durkin, 2015). The binding studies revealed that the macrocyclic lactones such as ivermectin and milbemectin also target on insect GABARs (Nakao et al., 2015). In addition, the neonicotinoid imidacloprid was recently reported to act as an antagonist of insect RDL expressed in Xenopus laevis oocytes (Taylor-Wells et al., 2015; Taylor-Wells et al., 2017). While large diversity of ionotropic GABAR subunits have been identified in vertebrates, only four subunits including the RDL (resistant to dieldrin), LCCH3 (ligand-gated chloride channel homolog 3), GRD (the GABA and glycine-like receptor of Drosophila) and CG8916 have been discovered in insects (Sheng et al., 2018; Wei et al., 2017), among
⁎
which RDL has attracted extensive attention because of its role in target site- mediated insecticide resistance (Nakao, 2017; Nakao et al., 2011; Nakao et al., 2012; Zhang et al., 2016). Analyses of insect genome sequences showed a single RDL encoding gene in Drosophila melanogaster, Musca domestica, Apis mellifera, and Tribolium castaneum (Jones and Sattelle, 2006; Jones and Sattelle, 2007; Scott et al., 2014; Del Villar and Jones, 2018), while two RDL genes were found in Acyrthosiphon pisum and Plutella xylostella and three in Bombyx mori (Del Villar and Jones, 2018; Yuan et al., 2010; Yu et al., 2010). Furthermore, four RDL variants generated by alternative splicing of exon 3 (exon 3a, exon 3b) and exon 6 (exon 6a, exon 6b) have been found in various insects (Jones and Sattelle, 2007; Del Villar and Jones, 2018; Wei et al., 2015; Buckingham et al., 2005; Jones et al., 2010). The rice stem borer, Chilo suppressalis (Walker) (Lepidoptera: Crambidae) is one of the most damaging rice pests in China (He et al., 2013). The use of insecticides is the primary strategy employed to control C. suppressalis, and the macrocyclic lactone, abamectin, showed potent insecticidal activity against C. suppressalis (He et al., 2013; Huang et al., 2017). Our previous identification of CsRDL1 and CsRDL2 in C. suppressalis by database search prompted us to characterize the expression and biological function of these two genes. Given that a recent study has reported the cloning and heterogenous expression of
Corresponding author. E-mail address: [email protected] (J. Wang).
https://doi.org/10.1016/j.pestbp.2018.11.017 Received 16 October 2018; Received in revised form 21 November 2018; Accepted 27 November 2018 0048-3575/ © 2018 Published by Elsevier Inc.
Please cite this article as: Meng, X., Pesticide Biochemistry and Physiology, https://doi.org/10.1016/j.pestbp.2018.11.017
Pesticide Biochemistry and Physiology xxx (xxxx) xxx–xxx
X. Meng et al.
2.4. RNA interference
CsRDL1 and CsRDL2 (Sheng et al., 2018), in this study, the role of CsRDL1 and CsRDL2 in abamectin toxicity was investigated using RNA interference (RNAi). Additionally, both genomic structure and expression profiles of CsRDL1 and CsRDL2 were comparatively analyzed.
The dsRNA of CsRDLs and EGFP (enhanced green fluorescent protein, supplied by professor Zewen Liu in Nanjing Agricultural University, China) were synthesized and purified with gene specific primers (Table 2) using TranscriptAid T7 High Yield Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions. The synthesized dsRNA were diluted in DEPC water with a concentration of 3 μg/μL, and stored at −80 °C until use. Oral delivery of dsRNA method was performed as previously described with slight modification (Xiang et al., 2017; Wang et al., 2017). The third instar larvae were starved for 5 h and then fed on the fresh artificial diet containing 20 μg/g of dsRNA for 12, 24, 36, 48, 60, and 72 h. The artificial diet containing DEPC water and dsEGFP was used as blank and negative control. A total of 30 larvae were used as a treatment and each treatment repeated three times. Larvae were collected at different times post-feeding, and three larvae were collected as a sample.
2. Materials and methods 2.1. Insect and insecticide The C. suppressalis larvae were collected from a suburb of Yangzhou (32.39°N, 119.42°E) and reared on an artificial diet in incubator at 28 ± 1 °C, 70 ± 5% relative humidity and 16 h light/8 h dark photoperiod without exposure to any pesticides for more than five years. Technical grade abamectin (93.7% active ingredient) was supplied by Nantong Liannong pesticide formulation Co. Ltd. (Nantong, Jiangsu, China). 2.2. Structure analysis of insect RDL genomic sequences
2.5. Toxicity bioassay
The genomic and cDNA sequences of insect RDLs were identified from the whole genome shotgun database (WGS) of NCBI (https:// www.ncbi.nlm.nih.gov/) and the InsectBase (http://www.insectgenome.com/) (Yin et al., 2014) (Table 1), and were manually aligned to locate the exon-intron boundaries. Sequence alignment was performed using CLUSTALW and DNAMAN with the default settings (Thompson et al., 1994). The genomic structures were constructed using IBS 1.0 software (Liu et al., 2015).
The toxicity bioassays were performed as previously described (Huang et al., 2016). The artificial diet containing a final concentrations of 20 μg/g dsRDL and 0.15 mg/L abamectin (LC50 concentration determined by preliminary experiment) was used for the bioassays (ABA + dsRDL). Artificial diet containing 0.15 mg/L abamectin and 20 μg/g dsEGFP or equal volumes of DEPC water were used as the controls (ABA + dsEGFP, ABA). The artificial diet without insecticide or dsRNA was used as blank (CK). A total of 30 third instar larvae were used as a treatment and each treatment repeated three times. Mortalities were recorded at 36 and 72 h post-feeding. Larvae showing no sign of movement when gently touched with a brush were scored as dead.
2.3. Reverse transcription quantitative PCR (RT-qPCR) Total RNAs were extracted from the whole body in different developmental stages (such as the larvae, pupae and adults) or specific tissues (including brain, nerve cord, foregut, midgut, hindgut, fat body, integument, hemolymph, ovary and malpighian tubule) in third instar larvae using the MiniBEST Universal RNA Extraction Kit (Takara, Dalian, China), and 1 μg of total RNA was used to synthesize the cDNA template using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, Dalian, China) according to the manufacturer's instructions. Specific primers for CsRDLs and housekeeping gene EF-1α (Hui et al., 2011) (Table 2) were employed for the determination of gene expressions using the TB Green™ Premix Ex Taq™ (TaKaRa, Dalian, China). Briefly, a 20 μL PCR reaction volume contains 10 μL TB Premix EX Taq™ II (2×), 2 μL diluted cDNA template with a concentration of 200 ng/μL, 0.8 μL (10 μM) of each primer and 6.4 μL diethylpyrocarbonate (DEPC) treated water. The PCR reaction was performed using a CFX96 RealTime PCR Detection System (Bio-Rad Laboratories, Inc., Hercules, CA, USA) with a condition of 95 °C for 30 s, 40 cycles of 95 °C for 5 s and 60 °C for 30 s, and a final melting curve analysis was performed. The relative gene expressions were calculated using the 2−ΔΔCT method and normalized to EF-1α in the same sample (Pfaffl, 2001). Means and standard error were obtained from the average of three independent sample sets.
2.6. Data analysis All data were expressed as the means ± standard error (SE). Statistical analysis was performed by one-way ANOVA (ANOVA, SPSS v.10.0; SPSS Inc., Chicago, IL), and comparisons of the means were made using Tukey's test (P < .05). 3. Results 3.1. Genomic structures of CsRDLs The genomic structures of RDLs in C. suppressalis and other insects were predicted by comparing the cDNA sequences with the genomic sequences retrieved from contigs in the whole genome shotgun databases. The results showed that, similar to B. mori, both CsRDL1 and CsRDL2 comprise 10 exons and 9 introns, and their exon-intron boundaries occur in the same position with respect to the coding sequences. However, RDLs in D. melanogaster and T. castaneum were split into 9 exons (Fig. 1). The 5′ donor and 3′ acceptor site sequences in insect RDLs were in agreement with the GT/AG consensus sequence (Yuan et al., 2010).
Table 1 Sources of cDNA and genomic DNA sequences of insect RDLs. RDLs
cDNA sequences
Genomic DNA sequences
3.2. Spatial and temporal expression of CsRDLs
C. suppressalis RDL1
KX856969
C. suppressalis RDL2
KX856970
B. mori RDL1 B. mori RDL2 B. mori RDL3 D. melanogaster RDL1 T. castaneum RDL1
NM_001099824 NM_001195700 NM_001195701 NM_001274688 XM_015984596
contig234745 (ANCD01234741.1), csug220386 csug7960, csug190194, contig220763 (ANCD01220759.1) NW_004582015 BABH01006866, BABH01006867 BABH01040612 NT_037436 NW_015451027
The mRNA expression levels of CsRDL1 and CsRDL2 in different tissues of third larvae were determined. The results showed that both of CsRDL1 and CsRDL2 were predominantly expressed in brain and nerve cord, slightly expressed in gut and integument, but had undetectable expression level in hemolymph, ovary and malpighian tubule (Fig. 2A). Notably, the expression levels of CsRDL2 in foregut, midgut, fat body and integument were much higher than CsRDL1. Temporal expression profiling of CsRDL1 and CsRDL2 in different 2
Pesticide Biochemistry and Physiology xxx (xxxx) xxx–xxx
X. Meng et al.
Table 2 The primers used in this study. Description
Primer name
Sequence (5′ to 3′)
Primers for CsRDLs qPCR
CsRDL1 F CsRDL1 R CsRDL2 F CsRDL2 R EF-1α F EF-1α R dsRDL1 F dsRDL1 R dsRDL2 F dsRDL2 R dsEGFP F dsEGFP R
GGCGTCACCATGTATGTGCTCT CCCACCGATAAGGTTTCCACTC ATAACTTTGCGCTCGTGGTTGC GTCCTCCGTAATTTGGCCTCACT TGAACCCCCATACAGCGAATCC TCTCCGTGCCAACCAGAAATAGG TAATACGACTCACTATAGGGCACCATGCGGGACATCCGATAC TAATACGACTCACTATAGGGAAACTTGCGAAGACCATGACGA TAATACGACTCACTATAGGGACCGATCCAAGGTTGGCATAT TAATACGACTCACTATAGGGGCGAGTAGTTTCCTGTGGTGAGA TAATACGACTCACTATAGGGCCTCGTGACCACCCTGACCTAC TAATACGACTCACTATAGGGCACCTTGATGCCGTTCTTCTGC
Primers for dsRNA synthesis
Fig. 1. Genomic structures of RDLs from C. suppressalis, B. mori, D. melanogaster and T. castaneum.
Fig. 2. The mRNA expression levels of CsRDL1 and CsRDL2 in C. suppressalis. (A) The relative CsRDLs gene expression in different tissues of C. suppressalis. (B) The relative CsRDLs gene expression in different developmental stages of C. suppressalis. *Significant difference by one-way ANOVA test (P < 0.05).
3.3. RNAi of CsRDLs and the effect on larvae susceptibility to abamectin
developmental stages of C. suppressalis revealed that the mRNA expression of CsRDLs gradually decreased during larvae development from 1st instar to 6th instar and prepupae (Fig. 2B). The expression level of CsRDL2 dramatically increased in the late pupae stage and held a relative high expression level in adult stages, while CsRDL1 maintained a low expression level in all pupae and adult stages.
Oral delivery of dsRNA was used for the RNAi of CsRDLs. The expression levels of CsRDL1 were significantly reduced by 27.4% and 44.5% at 24 h and 36 h post-feeding of dsRDL1 respectively, when compared to the larvae treated with dsEGFP (Fig. 3A). The transcript levels of CsRDL2 in dsRDL2 treatment were reduced by 28.3% and 42.5% at 12 h and 24 h post-feeding respectively, and the maximum 3
Pesticide Biochemistry and Physiology xxx (xxxx) xxx–xxx
X. Meng et al.
Fig. 3. RNAi of CsRDLs gene in larvae of C. suppressalis. (A) The relative CsRDL1 gene expression induced by RNAi through oral delivery of dsRDL1. (B) The relative CsRDL2 gene expression induced by RNAi through oral delivery of dsRDL2.
found in some lepidoptera insects, such as two RDL genes in P. xylostella and three in B. mori, (Yuan et al., 2010; Yu et al., 2010). Recently, two RDL genes, CsRDL1 and CsRDL2, were identified from C. suppressalis (Sheng et al., 2018). In the present study, comparison of the genomic sequences and the cDNA sequences of seven RDLs from four insects showed that, similar to RDLs in P. xylostella (Yuan et al., 2010), the two C. suppressalis RDLs and the three B. mori RDLs consisted of 10 exons and nine introns, while nine exons and eight introns were identified in the RDLs of T. castaneum and D. melanogaster (Buckingham et al., 2005). The similar genomic structures of multiple RDLs in lepidoptera insects suggest the recent occurrence of gene duplication. Theoretically, gene expression pattern was related to its physiological roles. In order to explore the potential physiological roles of CsRDL1 and CsRDL2 in C. suppressalis, their expression profiles were extensively studied. Both CsRDL1 and CsRDL2 were predominantly expressed in the nervous tissues and showed low expression levels in gut and integument. Interestingly, the transcript levels of CsRDL1 decreased from larval to adult stages, while the transcript levels of CsRDL2 dramatically increased from prepupa to late pupae stages and showed high expression level in adult stages. These results indicated that in addition to the neural transmission function, CsRDLs may have multiple physiological roles in C. suppressalis, as has been reported in D. melanogaster that the RDL can modulate olfactory associative learning and aggression (Liu et al., 2007; Yuan et al., 2014). Abamectin belongs to the avermectin subfamily of macrocyclic lactones and has been widely used for the control of pests (Lasota and Dybas, 1991). Heterologous expression and binding studies suggested that in addition to targeting insect glutamate-gated chloride channels (GluCls), which is another member of Cys-loop LGIC superfamily, the abamectin also acts on RDL (Nakao et al., 2015; Wolstenholme and Rogers, 2005; Meng et al., 2018; Xu et al., 2016). However, the role of RDL in abamectin toxicity has rarely been studied in vivo. A recent study reported that the knockdown of TcRDL decreased acaricidal activity of abamectin in Tetranychus cinnabarinus (Xu et al., 2016). In consistence with this finding, we found that the dietary ingestion of dsRDL1 and dsRDL2 significantly decreased the larval susceptibility to abamectin. It has been reported that the insecticides fipronil and fluralaner displayed similar IC50 values in inhibiting GABA activated currents in oocytes injected with either CsRDL1 or CsRDL2 (Sheng et al., 2018). Further electrophysiological experiments are needed to confirm the role of CsRDL1 and CsRDL2 in the toxicology of abamectin.
Fig. 4. The survival rates of larvae treated with 0.15 mg/L abamectin. CK: no treatment; ABA: 0.15 mg/L abamectin; ABA + dsEGFP: 0.15 mg/L abamectin +20 μg/g dsEGFP; ABA + dsRDL1: 0.15 mg/L abamectin +20 μg/g dsRDL1; ABA + dsRDL2: 0.15 mg/L abamectin +20 μg/g dsRDL2. *Significant difference by one-way ANOVA test (P < 0.05).
interference efficiency was observed at 36 h post-feeding with an interference efficiency of 52.9% (Fig. 3B). The effects of CsRDLs on larval susceptibility to abamectin were investigated by the feeding of artificial diet containing both dsRDL and abamectin. The results revealed that the susceptibilities of larvae to abamectin decreased when the CsRDLs were knockdown (Fig. 4). The mortalities of dsEGFP treated larvae to abamectin were 44.4% and 62.2% at 36 h and 72 h post-feeding respectively, while the mortalities of dsRDL2 treated larvae to abamectin were 17.4% and 32.5% at 36 h and 72 h post-feeding respectively. No significant difference of mortalities was found among the dsRDL1 and the control treatments at 36 h post-feeding, while the mortality of dsRDL1 treated larvae was decreased at 72 h post-feeding with a mortality of 52.1% (Fig. 4). 4. Discussion Insect RDLs have been widely studied since the first discovery of RDL in D. melanogaster (Ffrench-Constant et al., 1991). While only a single RDL gene was found in D. melanogaster, M. domestica, A. mellifera, and T. castaneum (Jones and Sattelle, 2006; Jones and Sattelle, 2007; Scott et al., 2014; Del Villar and Jones, 2018), multiple RDL genes were 4
Pesticide Biochemistry and Physiology xxx (xxxx) xxx–xxx
X. Meng et al.
Acknowledgements
646–652. Nakao, T., Hama, M., Kawahara, N., Hirase, K., 2012. Fipronil resistance in Sogatella furcifera: Molecular cloning and functional expression of wild-type and mutant RDL GABA receptor subunits. J. Pestic. Sci. 37, 37–44. Nakao, T., Banba, S., Hirase, K., 2015. Comparison between the modes of action of novel meta-diamide and macrocyclic lactone insecticides on the RDL GABA receptor. Pestic. Biochem. Physiol. 120, 101–108. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res. 29, 2002–2007. Scott, J.G., Warren, W.C., Beukeboom, L.W., Bopp, D., Clark, A.G., Giers, S.D., Hediger, M., Jones, A.K., Kasai, S., Leichter, C.A., Li, M., Meisel, R.P., Minx, P., Murphy, T.D., Nelson, D.R., Reid, W.R., Rinkevich, F.D., Robertson, H.M., Sackton, T.B., Sattelle, D.B., Thibaud-Nissen, F., Tomlinson, C., van de Zande, L., Walden, K.K.O., Wilson, R.K., Liu, N., 2014. Genome of the house fly, Musca domestica L., a global vector of diseases with adaptations to a septic environment. Genome Biol. 15. Sheng, C.W., Jia, Z.Q., Ozoe, Y., Huang, Q.T., Han, Z.J., Zhao, C.Q., 2018. Molecular cloning, spatiotemporal and functional expression of GABA receptor subunits RDL1 and RDL2 of the rice stem borer Chilo suppressalis. Insect Biochem. Mol. Biol. 94, 18–27. Taylor-Wells, J., Brooke, B.D., Bermudez, I., Jones, A.K., 2015. The neonicotinoid imidacloprid, and the pyrethroid deltamethrin, are antagonists of the insect Rdl GABA receptor. J. Neurochem. 135, 705–713. Taylor-Wells, J., Hawkins, J., Colombo, C., Bermudez, I., Jones, A.K., 2017. Cloning and functional expression of intracellular loop variants of the honey bee (Apis mellifera) RDL GABA receptor. Neurotoxicology 60, 207–213. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Wang, X.Y., Du, L.X., Liu, C.X., Gong, L., Han, L.Z., Peng, Y.F., 2017. RNAi in the striped stem borer, Chilo suppressalis, establishes a functional role for aminopeptidase N in Cry1Ab intoxication. J. Invertebr. Pathol. 143, 1–10. Wei, Q., Wu, S.F., Niu, C.D., Yu, H.Y., Dong, Y.X., Gao, C.F., 2015. Knockdown of the ionotropic gamma-aminobutyric acid receptor (GABAR) Rdl gene decreases fipronil susceptibility of the small brown planthopper, Laodelphax striatellus (Hemiptera: Delphacidae). Arch. Insect Biochem. 88, 249–261. Wei, Q., Wu, S.F., Gao, C.F., 2017. Molecular characterization and expression pattern of three GABA receptor-like subunits in the small brown planthopper Laodelphax striatellus (Hemiptera: Delphacidae). Pestic. Biochem. Physiol. 136, 34–40. Wolstenholme, A.J., Rogers, A.T., 2005. Glutamate-gated chloride channels and the mode of action of the avermectin/milbemycin anthelmintics. Parasitology 131, S85–S95. Xiang, M., Zhang, L., Lu, Y., Tang, Q., Liang, P., Shi, X., Song, D., Gao, X., 2017. A Pglycoprotein gene serves as a component of the protective mechanisms against 2tridecanone and abamectin in Helicoverpa armigera. Gene 627, 63–71. Xu, Z., Wu, Q., Xu, Q., He, L., 2016. Functional analysis reveals glutamate-gated chloride and γ-amino butyric acid channels as targets of avermectins in the carmine spider mite. Toxicol. Sci. 155, 258–269. Yin, C.L., Liu, Y., Liu, J., Xiao, H., Huang, S., Lin, Y., Han, Z., Li, F., 2014. ChiloDB: a genomic and transcriptome database for an important rice insect pest Chilo suppressalis. Database 15, 92–108. Yu, L.L., Cui, Y.J., Lang, G.J., Zhang, M.Y., Zhang, C.X., 2010. The ionotropic gammaaminobutyric acid receptor gene family of the silkworm, Bombyx mori. Genome 53, 688–697. Yuan, G., Gao, W., Yang, Y., Wu, Y., 2010. Molecular cloning, genomic structure, and genetic mapping of two Rdl-orthologous genes of gaba receptors in the diamondback moth, Plutella xylostella. Arch. Insect Biochem. 74, 81–90. Yuan, Q., Song, Y., Yang, C.H., Jan, L.Y., Jan, Y.N., 2014. Female contact modulates male aggression via a sexually dimorphic GABAergic circuit in Drosophila. Nat. Neurosci. 17, 81–88. Zhang, Y.X., Meng, X.K., Yang, Y.X., Li, H., Wang, X., Yang, B.J., Zhang, J.H., Li, C., Millar, N.S., Liu, Z.W., 2016. Synergistic and compensatory effects of two point mutations conferring target-site resistance to fipronil in the insect GABA receptor RDL. Sci. Rep. 6.
This work was supported by National Natural Science Foundation of China (31701807, 31572000), Jiangsu Province Science Foundation for Youths (BK20170491) and the Key Laboratory of Biology, Genetics and Breeding of Special Economic Animals & Plants,Ministry of Agriculture,P.R. China (Y2018PT14). References Buckingham, S.D., Biggin, P.C., Sattelle, B.M., Brown, L.A., Sattelle, D.B., 2005. Insect GABA receptors: Splicing, editing, and targeting by antiparasitics and insecticides. Mol. Pharmacol. 68, 942–951. Buckingham, S.D., Ihara, M., Sattelle, D.B., Matsuda, K., 2017. Mechanisms of action, resistance and toxicity of insecticides targeting GABA receptors. Curr. Med. Chem. 24, 2935–2945. Casida, J.E., Durkin, K.A., 2015. Novel GABA receptor pesticide targets. Pestic. Biochem. Physiol. 121, 22–30. Del Villar, S.G., Jones, A.K., 2018. Cloning and functional characterisation of the duplicated RDL subunits from the pea aphid, Acyrthosiphon pisum. Int. J. Mol. Sci. 19. Ffrench-Constant, R.H., Mortlock, D.P., Shaffer, C.D., MacIntyre, R.J., Roush, R.T., 1991. Molecular cloning and transformation of cyclodiene resistance in Drosophila: an invertebrate gamma-aminobutyric acid subtype a receptor locus. Proc. Natl. Acad. Sci. U. S. A. 88, 7209–7213. He, Y., Zhang, J., Gao, C., Su, J., Chen, J., Shen, J., 2013. Regression analysis of dynamics of insecticide resistance in field populations of Chilo suppressalis (Lepidoptera: Crambidae) during 2002-2011 in China. J. Econ. Entomol. 106, 1832–1837. Hosie, A.M., Aronstein, K., Sattelle, D.B., Ffrench-Constant, R.H., 1997. Molecular biology of insect neuronal GABA receptors. Trends Neurosci. 20, 578–583. Huang, L., Lu, M., Han, G., Du, Y., Wang, J., 2016. Sublethal effects of chlorantraniliprole on development, reproduction and vitellogenin gene (CsVg) expression in the rice stem borer, Chilo suppressalis. Pest Manag. Sci. 72, 2280–2286. Huang, S., Chen, Q., Qin, W., Sun, Y., Qin, H., 2017. Resistance monitoring of four insecticides and a description of an artificial diet incorporation method for Chilo suppressalis (Lepidoptera: Crambidae). J. Econ. Entomol. 110, 2554–2561. Hui, X.M., Yang, L.W., He, G.L., Yang, Q.P., Han, Z.J., Li, F., 2011. RNA interference of ace1 and ace2 in Chilo suppressalis reveals their different contributions to motor ability and larval growth. Insect Biochem. Molec. 20, 507–518. Jones, A.K., Sattelle, D.B., 2006. The cys-loop ligand-gated ion channel superfamily of the honeybee, Apis mellifera. Invertebr. Neurosci. 6, 123–132. Jones, A.K., Sattelle, D.B., 2007. The cys-loop ligand-gated ion channel gene superfamily of the red flour beetle, Tribolium castaneum. BMC Genomics 8. Jones, A.K., Bera, A.N., Lees, K., Sattelle, D.B., 2010. The cys-loop ligand-gated ion channel gene superfamily of the parasitoid wasp, Nasonia vitripennis. Heredity 104, 247–259. Lasota, J.A., Dybas, R.A., 1991. Avermectins, a novel class of compounds: implications for use in arthropod pest control. Annu. Rev. Entomol. 36, 91–117. Liu, X., Krause, W.C., Davis, R.L., 2007. GABA(a) receptor RDL inhibits Drosophila olfactory associative learning. Neuron 56, 1090–1102. Liu, W., Xie, Y., Ma, J., Luo, X., Nie, P., Zuo, Z., Lahrmann, U., Zhao, Q., Zheng, Y., Zhao, Y., Xue, Y., Ren, J., 2015. IBS: an illustrator for the presentation and visualization of biological sequences. Bioinformatics 31, 3359–3361. Meng, X.K., Xie, Z.J., Zhang, N., Ji, C.H., Dong, F., Qian, K., Wang, J.J., 2018. Molecular cloning and characterization of GABA receptor and GluCl subunits in the western flower thrips, Frankliniella occidentalis. Pestic. Biochem. Physiol. 150, 33–39. Nakao, T., 2017. Mechanisms of resistance to insecticides targeting RDL GABA receptors in planthoppers. Neurotoxicology 60, 293–298. Nakao, T., Kawase, A., Kinoshita, A., Abe, R., Hama, M., Kawahara, N., Hirase, K., 2011. The A2'N mutation of the RDL gamma-aminobutyric acid receptor conferring fipronil resistance in Laodelphax striatellus (Hemiptera: Delphacidae). J. Econ. Entomol. 104,
5