Identification of a Gravitropism-Deficient Mutant in Rice

Available online at www.sciencedirect.com

ScienceDirect Rice Science, 2017, 24(2): 109−118

Identification of a Gravitropism-Deficient Mutant in Rice HE Yan, SHI Yong-feng, ZHANG Xiao-bo, WANG Hui-mei, XU Xia, WU Jian-li (State Key Laboratory of Rice Biology / Chinese National Center for Rice Improvement, China National Rice Research Institute, Hangzhou 310006, China)

Abstract: A gravitropism-deficient mutant M96 was isolated from a mutant bank, generated by ethyl methane sulfonate (EMS) mutagenesis of indica rice accession ZJ100. The mutant was characterized as prostrate growth at the beginning of germination, and the prostrate growth phenotype ran through the whole life duration. Tiller angle and tiller number of M96 increased significantly in comparison with the wild type. Tissue section observation analysis indicated that asymmetric stem growth around the second node occurred in M96. Genetic analysis and gene mapping showed that M96 was controlled by a single recessive nuclear gene, tentatively termed as gravitropism-deficient M96 (gdM96), which was mapped to a region of 506 kb flanked by markers RM5960 and InDel8 on the long arm of chromosome 11. Sequencing analysis of the open reading frames in this region revealed a nucleotide substitution from G to T in the third exon of LOC_Os11g29840. Additionally, real-time fluorescence quantitative PCR analysis showed that the expression level of LOC_Os11g29840 in the stems was much higher than in the roots and leaves in M96. Furthermore, the expression level was more than four times in M96 stem than in the wild type stem. Our results suggested that the mutant gene was likely a new allele to the reported gene LAZY1. Isolation of this new allele would facilitate the further characterization of LAZY1. Key words: plant architecture; gravitropism; LAZY1; gene mapping; mutant

Plant architecture is one of the significant factors associated with rice yield. Erect plant architecture is considered to be the ideal plant type and continuously selected by farmers and breeders (Kovach et al, 2007). Previous studies have shown that gravity is a significant external factor during plant growth and development, and contributes to morphogenesis and physiological function of the plant. Plant response to gravity is called gravitropism or geotropism, and can be divided into four sequential steps: gravity perception, signal formation in the gravity perceptive cell, intracellular and intercellular signal transduction, and asymmetric cell elongation between the upper and lower sides of the responding organs (Fukaki et al, 1996). The normal gravitropism (shoot negative gravitropism and root positive gravitropism) is necessary for plant

morphological development and biological function (Dong, 2014). Most plant species show the root positive gravitropism for the uptake of water and minerals while exhibit the shoot negative gravitropism in favor of photosynthesis and fertilization preferably (Song et al, 2006). Mutants with defective gravitropism from Arabidopsis vary in their response to gravity and can be divided into five different classes: class I, mutants that show an abnormal gravitropic response in inflorescence stems only; class II, mutants that show defective gravitropism in both inflorescence stems and hypocotyls, but normal gravitropism in roots; class III, mutants that show defective gravitropism in the roots, hypocotyls and inflorescence stems; class IV, mutants that have defective gravitropism in hypocotyls and roots but not in inflorescence stems; class V, mutants that exhibit

Received: 10 April 2016; Accepted: 6 June 2016 Corresponding author: WU Jian-li ([email protected]) Copyright © 2017, China National Rice Research Institute. Hosting by Elsevier B.V. B V This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/) Peer review under responsibility of China National Rice Research Institute http://dx.doi.org/ http://dx.doi.org/10.1016/j.rsci.2016.06.009

110

Rice Science, Vol. 24, No. 2, 2017

only a defective gravitropic phenotype in roots (Tasaka et al, 1999). Gravitropism has been also observed in rice, and a few number of gravitropismrelated genes have been identified and characterized such as LAZY1 (LA1) (Li et al, 2007), PROSTRATE GROWTH1 (PROG1) (Jin et al, 2008), LOOSE PLANT ARCHITECTURE1 (LPA1) (Liu et al, 2016) and spk(t) (Miyata et al, 2005). Among these genes, LAZY1 controls rice shoot gravitropism through regulating polar auxin transportation (Li et al, 2007) and LAZY1-dependent and -independent signaling pathways have been identified in coleoptiles (Yoshihara and Iino, 2007). PROG1 encodes a single Cys2-His2 zinc-finger protein (Tan et al, 2008), and predominantly expresses in the axillary meristems (Jin et al, 2008). It is believed that PROG1 lost its function during the evolutional process in the ancestor of modern cultivated rice. LPA1, encoding a plant-specific INDETERMINATE DOMAIN protein, influences plant architecture by affecting the gravitropism of leaf sheath pulvinus and lamina joint (Wu et al, 2013). In fact, LPA1 determines lamina joint bending by suppressing auxin signaling that interacts with C-22-hydroxylated and 6-deoxo brassinosteroids in rice (Liu et al, 2016). spk(t) is thought to be a gene responsible for the stub spreading phenotype in Kasalath but yet to be isolated (Miyata et al, 2005). In the present study, we identified a prostrate growth mutant M96 from an ethane methyl sulfonate (EMS)-induced rice accession ZJ100 mutant bank. Here, we present the results on characterization of the mutant phenotype, genetic analysis, gene mapping and candidate gene prediction. Our results showed that the prostrate growth phenotype of M96 is controlled by a single recessive gene which is likely a new allele to LAZY1. Isolation of this new allele, tentatively termed as gravitropism-deficient M96 (gdM96), would facilitate the further characterization of LAZY1.

MATERIALS AND METHODS Rice materials The M96 mutant was obtained from an EMS-induced

indica rice accession ZJ100 mutant bank. This mutant has been selfed for more than 10 generations, and the target trait has been stably expressed in both the greenhouse and field conditions in Fuyang, Zhejiang Province and Lingshui, Hainan Province, China. Methods Gravity response analysis For gravity response experiment, the seeds of mutant M96 and the wild type ZJ100 were dehusked and surface sterilized with 75% ethanol for 2 min and 30% bleach for 15 min, and then washed five times with autoclaved distilled water. The sterilized seeds were then planted in plates containing 1/2 MS medium (pH 5.8) and 0.5% Plant Preservative Mixture (PPMTM, Beijing QiWei YiCheng Tech Co., Ltd., Beijing, China) for 5 d under continuous light or continuous dark at 28 ºC in a growth chamber (Panasonic, MLR-352HPC, Osaka, Japan), respectively. Consequently, the seedlings were placed horizontally in the same conditions for 24 h. Exogenous hormone treatment For hormone treatment, the sterilized seeds were planted in 1/2 MS medium (pH 5.8) and 0.05% Plant Preservative Mixture (PPMTM, Beijing QiWei YiCheng Tech Co., Ltd., Beijing, China) supplemented with different concentrations of exogenous hormones (Table 1) and grew in a growth chamber (Panasonic, MLR-352H-PC, Osaka, Japan) for 5 d at 28 ºC with 14 h light and 10 h dark each day. Plant hormones 2,4-dichlorophenoxyacetic acid (2,4-D) and gibberellic acid 3 (GA3) were purchased from Sigma-Aldrich Co., ST. Louis, USA. Tissue microstructure Optical microscopic observation of stems was performed with plants at the heading stage grown in the paddy fields. The second internodes above the ground were cut longitudinally and fixed in 2.5% glutaraldehyde overnight. The optical microscopic observation was carried out as described by Zhang et al (2007). Genetic analysis and gene mapping M96 mutant was used as the female parent and

mg/L

Table 1. Concentrations of exogenous hormones. Hormone type 2,4-dichlorophenoxyacetic acid Gibberellic acid 3

Treatment 1 0.1 0.5

2 0.1 1.0

3 0.5 2.0

4 1.0 4.0

5 2.0 10.0

6 4.0 20.0

HE Yan, et al. A New Allele for Rice Gravitropic Mutant

crossed to the male parent ORO. F1 plants were grown in the paddy field and F2 population was planted in the greenhouse at China National Rice Research Institute (Fuyang, Zhejiang Province, China) for segregation analysis. The DNA of the parents and F2 individuals with prostrate growth phenotype was extracted following the mini-preparation method (Lu et al, 1992). PCR amplification was performed according to Shi et al (2009), and the PCR products were separated and visualized on 6% non-denaturing polyacrylamide gels using silver staining. A total of 1 014 simple sequence repeat (SSR) markers evenly covering 12 chromosomes were applied in polymorphism survey between the parents M96 and ORO. The polymorphic markers were then used for screening the 30 mutational randomly-selected F2 individuals for chromosome linkage analysis and gene preliminary mapping. The candidate gene sequence was obtained from the Rice Genome Annotation Project (http://rice.plantbiology. msu.edu/). Subsequently, primers were designed using the Primer 5.0 software. Sequence analysis of the candidate genes was carried out using DNAStar 8.0 software to identify the mutation site. Real-time fluorescent quantitative PCR (RT-PCR) and cDNA cloning At the tillering stage, TRIzol Reagent Kit (Aidlab, China) was used to extract the total RNA of the roots, stems and leaves from M96 and the wild type. The

111

first strand of cDNA was synthesized using the ReverTra Ace qPCR RT Master Mix with gDNA Remover Kit (ToYoBo, Japan) for RT-PCR and cDNA cloning. RT-PCR was carried out using the SYBR® Premix Ex TaqTM II (Tli RNaseH Plus) Kit and performed on Thermal Cycle Dice® Real Time System (TaKaRa, Japan). The method of cDNA amplification and sequence analyzing resembles as stated above. Structural and phylogenetic analysis BLAST analysis was performed on the NCBI website (http://www.ncbi.nlm.nih.gov/) to search for homologs of LAZY1. A total of 11 sequences from 9 species were identified. The sequences were aligned using ClustalW software, and the neighbor-joining tree (Saitou and Nei, 1987) was generated using the Poisson correction method in MEGA 5.1 software (Tamura et al, 2011). Bootstrap replication with 1 000 times was used for a statistical support for the nodes in the phylogenetic tree.

RESULTS Phenotypic performance of M96 mutant The prostrate growth phenotype of M96 mutant appeared at the beginning of seed germination (Fig. 1-A) and lasted throughout the whole growth duration (Fig. 1-B and -C). The tiller angle of M96 mutant

Fig. 1. Phenotypes of wild type (WT) and M96 mutant. A, Sprout of WT (left) and M96 (right); B, WT (left) and M96 (right) at the early tillering stage; C, M96 at the heading stage; D, WT at the heading stage.

112

increased gradually from the seedling stage (Fig. 1-B) and peaked at the heading stage compared with the wild type (Fig. 1-C and -D). In addition, the tiller numbers of M96 mutant were increased obviously than those of the wild type under the greenhouse conditions (Fig. 2). The prostrate growth of M96 was due to the bending of the second node (Fig. 3-A). Paraffin section observation on the curved node of M96 mutant indicated that, unlike the equivalent cell elongation in the wild type plants, the cell numbers per unit area of the near-ground side (right) were more than two times higher than those of the far-ground side (left) in the M96 mutant (Fig. 3-B). Furthermore, both cell shape

Rice Science, Vol. 24, No. 2, 2017

Fig. 2. Comparison of tiller numbers between wild type and M96. Error bars represent the standard deviation (n = 5).

Fig. 3. Paraffin section observation of the second node longitudinal sections. A, Stem of wild type (WT, left) and M96 mutant (right). The arrow indicates the curved node of M96 mutant; B, Longitudinal cell numbers of the sides of the second node in WT and M96. Different lowercase letters indicate significant differences at the 0.01 level by the Duncan’s test. Error bars represent the standard deviation (n = 5); C, Longitudinal section on the far-ground side of the second node in WT; D, Longitudinal section on the near-ground side of the second node in WT; E, Longitudinal section on the far-ground side of the second node in M96; F, Longitudinal section on the near-ground side of the second node in M96.

HE Yan, et al. A New Allele for Rice Gravitropic Mutant

113

exhibited a similar phenotype at all the concentrations of 2,4-D and GA3 (data not shown), indicating that the prostrate growth phenotype of M96 mutant could not be recovered by 2,4-D and GA3. gdM96 is likely a new allele of LAZY1

Fig. 4. Gravity response of wild type (WT) and M96 under light and dark conditions. A, 5-day-old WT (top) and M96 (bottom) seedlings grown under light; B, 5-day-old WT (top) and M96 (bottom) seedlings grown under dark. Arrows indicate gravity direction.

and cell arrangement of the near-ground side and far-ground side of the second curved node in M96 mutant were irregular especially at the far-ground side (Fig. 3-C, -D and -F). These results indicated that the asymmetric growth at the two sides of the second node might result from the asymmetric cell number, size and distribution. Gravity response of M96 was not affected by light and exogenous hormone To determine the effect of light on the prostrate growth, the wild type and M96 were grown under light and dark conditions, respectively. Our results showed that the wild type responded to gravity stimulus markedly and tended to recover for erect growth under light condition, but the M96 lost the gravity response ability and remained horizontally (Fig. 4-A). Similar responses to gravity were observed both for the wild type and M96 under dark condition (Fig. 4-B). The results suggested that light had no contribution to the gravity response of M96 mutant. To determine the effect of plant hormones on the prostrate growth of M96, different concentrations of exogenous hormones (2,4-D and GA3) were applied. We found that both the wild type and M96 mutant

To determine the genetic control of the prostrate growth phenotype in M96, we crossed M96 with ORO. All the F1 plants derived from the cross M96/ORO showed the normal phenotype similar to ORO. In the F2 population, only the prostrate growth phenotype and normal growth phenotype were observed. Among a total of 302 F2 individuals, 224 plants were normal and 78 plants were prostrate, matching the predicted 3:1 Mendelian ratio (χ2 = 0.11 < χ20.05 = 3.84). These results indicated that the mutation was governed by a single recessive nuclear gene, tentatively termed as gravitropism-deficient M96 (gdM96). To locate the gene, 311 polymorphic markers between the two parents were used for linkage analysis and initial gene mapping with 30 randomly selected mutant type F2 individuals. Among these markers, four SSR markers (RM536, RM6901, RM229 and RM27051) on chromosome 11 were probably linked to the target gene (Table 2 amd Fig. 5-A). By genotyping all 319 mutant type of F 2 individuals, the target region was narrowed down to 506 kb between markers RM5960 and InDel8 (Table 2 and Fig. 5-A). According to the Rice Genome Annotation Project (http://rice.plantbiology.msu.edu/), we found the target region contained the LAZY1 gene (LOC_Os11g29840) previously reported by Li et al (2007). Since LAZY1 is responsible for prostrate growth, we consider that it might be the targeted gene for gdM96 as well. We then proceeded to sequence LOC_Os11g29840 in M96 and the wild type. The results showed that the mutant allele has a single base substitution (G/T) at the position of 2 580 bp compared with the wild type (Fig.

Table 2. Part of primers used in this study. Marker RM536 RM6091 RM229 RM27051 RM287 RM5960 InDel8 M96 M96RT-2 Ubiquitin

Forward primer (5′−3′) TCTCTCCTCTTGTTTGGCTC GCGGACACACCAGAGAATAAGC CACTCACACGAACGACTGAC ACCTGGCTACCATCCAAACACG GGCTACACCTACACGCGAGAACC CGAGCAGCACTGGAGAACACC AACACCACCCGATTCCCT ATCATTGCCGTTGTCATCATCT AAAGTCTACCCCGAGAACAC CCCTCCACCTCGTCCTCAG

Reverse primer (5′−3′) ACACACCAACACGACCACAC GTGCTGTCCTGTCCTTGAATCC CGCAGGTTCTTGTGAAATGT GCTTTAGGGAGTTCCTGATGTGC AGATGCATGGAATGCCTGTTTGG CTCCTAGGTGCAGCGGACTACC CAGATTGGATGAGCAGCAAC CAGCACATTCAAGCCCTTCTAT CTCTTGTTGCCGTTCATCTC AGATAACAACGGAAGCATAAAAGTC

114

Rice Science, Vol. 24, No. 2, 2017

Fig. 5. Gene mapping and candidate gene analysis. A, Gene mapping of M96 mutant; B, Sequence of the mutational region in LOC_Os11g29840 from the wild type; C, Sequence of the mutational region in LOC_Os11g29840 from M96. Arrows indicate the position at 2 580 bp.

5-B). To confirm the co-segregation of polymorphism between the genotype and the phenotype in the F2 population. Each three randomly-chosen F2 plants with and without the mutant phenotype, respectively, were sequenced, and the results showed that all the M96 plants had the same mutation while all the wild type individuals had no mutation. The cDNA of gdM96 consists of 1 599 bp including a 28 bp 5′-UTR, a 320 bp 3′-UTR and a 1 251 bp coding sequence. gdM96 has five exons and four introns, and encodes a predicted protein with 416 amino acid residuals. The G/T mutation was confirmed at the cDNA level and presumably resulted in the change from 74th glycine in the wild type to cysteine in M96.

nuclear localization sequence (NLS) domain are presented in the monocots including S. bicolor, Z. mays, S. italica, O. brachyantha, B. distachyon, A. tauschii, T. urartu. The similarity level from high to low is O. brachyantha (76%), S. italica (64%), S. bicolor (63%), Z. mays (61%), B. distachyon (57%), A. tauschii (56%) and T. urartu (54%). Although several genes controlling the prostrate growth both in Arabidopsis and rice have been isolated, they have very low similarities in the protein level with A. thaliana (24%), O. sativa (PROG1) (7%), and no similarity with O. sativa (LPA1) (Fig. 7). These results suggest that the prostrate growth is controlled differently between/in the monocot and the dicot, and

gdM96 is specifically expressed and relatively conserved in monocot To determine the expression level of gdM96, RT-PCR was carried out using different organs. The results showed that the target gene transcripts were abundant in the stems while rare in the roots and leaves both in the wild type and M96. The expression level of gdM96 in stems of M96 was more than four times compared with the wild type (Fig. 6). It suggested that the target gene was expressed specifically in the stem, and it might play an important role in controlling the rice tiller angle. A database search (http://www.ncbi.nlm.nih.gov/) reveals that LAZY1 homologus proteins with a conserved transmembrance domain and a putative

Fig. 6. Expression analysis of target gene in root, stem and leaf of the wild type and M96 by real-time PCR. Error bars represent the standard deviation (n = 5). ** represents the significant difference at the 0.01 level by the Duncan’s test.

HE Yan, et al. A New Allele for Rice Gravitropic Mutant

115

Fig. 7. Structural and phylogenetic analysis of gdM96 homologs. A, Comparison of amino acid sequences of gdM96 homologs. Accession numbers for the respective protein sequences are as follows: O. sativa (LAZY1) (LOC_Os11g29840), O. sativa (PROG1) (LOC_Os07g05900), O. sativa (LPA1) (LOC_Os03g13400), A. thaliana (NP_196913.2); O. brachyantha (XP_015697926), S. italic (XP_004979290), A. tauschii (EMT22503), B. distachyon (XP_010237715), S. bicolor (XP_002449512), Z. mays (AEM59513) and T. urartu (EMS62694). The asterisk indicates the mutant site in M96, the red squared box indicates the predicted transmembrane domain and the blue squared box indicates the putative nuclear localization sequence domain. B, Dendrogram of gdM96 homologs.

116

Rice Science, Vol. 24, No. 2, 2017

multiple mechanisms may present in the monocot rice as well.

DISCUSSION Gravitropism is a complex multistep process, and the main progress on its molecular mechanism has been achieved in the dicotyledon A. thaliana, but the molecular mechanism of gravitropism in monocotyledon remains largely unknown. In this study, the rice mutant M96 showed the prostrate phenotype from the beginning of germinating to the maturity. The phenotype is irrelevant to light and exogenous hormone treatment and directly caused by the asymmetric cell growth and development at the second node of the stems. Morphologically, the mutant phenotype of M96 is similar to the rice mutants la1-ZF802 and lpa1. gdM96 (LOC_Os11g29840) is likely a new allele of LAZY1 based on the physical location and DNA sequence, although genetic complementation or RNAi is required to prove it functionally. lazy1, controlling the protrate growth of the rice mutant la1-ZF802, has 8 bp deletion in the fourth exon and leads to the premature termination of LAZY1 protein, which contains a conserved transmembrane domain (amino-acid residues 62–83) and a putative NLS domain (aminoacid residues 286–312) (Li et al, 2007). In the present study, gdM96 has a single base substitution at the position of 2 580 bp, resulting in a change from glycine to cysteine at the 74th amino acid residual. Unlike lazy1, gdM96 is upregulated in M96. However, the transcript of gdM96 might function improperly and finally leads to the loss of gravitropic response similar to lazy1. Interestingly, this residual is located in the transmembrane domain. We therefore speculate that the conserved transmembrane domain may play a critical role through structural conformation in the determination of gravitropism response in the monocot rice. Previous studies have reported that light can regulate plant gravitropism by phytochrome (Hangarter, 1997). The A. thaliana mutant enhanced bending 1 (ehb1) exhibits hypocotyl bending under blue light conditions although hypocotyl bending may be also induced by gravitropism (Knauer et al, 2011). Shoots of the tomato lazy-2 mutant exhibit negative gravitropism in the dark, but show positive gravitropism under light (Hasenstein and Kuznetsov, 1999), and the altered gravitropic response of lazy-2 is phytochrome-regulated (Gaiser and Lornax, 1993). Furthermore, the gravitropic set-point angle (GSA) of

the hypocotyl in lazy-2 seedlings under white light conditions is sensitive to 3-(3,4-dichlorophenyl)1,1-di-methylurea (DCMU) and norflurazon treatment, hence the light effects on the GSA of an organ could be mediated via both phytochrome and photosynthesis (Digby and Firn, 2002). Unlike the cases above, M96 mutant could not respond to gravity stimulus under both light and dark conditions. Therefore, we conclude initially that both phytochrome and photosynthesis of M96 mutant are normal as in the wild type. ZmCLA4, the maize homolog of LAZY1, plays a negative role in the control of maize erect-leaf-angle through the alteration of mRNA accumulation, leading to altered shoot gravitropism and cell development (Zhang et al, 2014). In this study, gdM96 is specifically expressed in the stems. However, detailed analysis of mRNA accumulation on the far-ground and near-ground sides of the stem should be carried out in order to explain the reason causing the bending growth in M96. Auxin is the first phytohormone identified in plants (Pennazio, 2002) and plays an important role in the process of plant development. Previous study has shown that LAZY1 is a negative regulator in polar auxin transport (PAT) and loss-of-function of LAZY1 enhances PAT greatly and consequently alters the endogenous indole-3-acetic acid (IAA) distribution in shoots, leading to the reduced gravitropism (Li et al, 2007). In contrast, strigolactones are a group of newly identified plant hormones which inhibit auxin biosynthesis and attenuate rice shoot gravitropism, mainly by decreasing the local IAA content (Sang et al, 2014). Furthermore, ethylene significantly promotes the elongation of floating rice internodes (Azuma et al, 2003), and the previous studies have shown a possible interaction between ethylene and auxin transport in root gravitropism (Buer et al, 2003; Vandenbussche et al, 2003). In this study, the gravitropism of M96 remain unchanged with exogenous hormones (2,4-D and GA3) treatment although high concentration exogenous hormone inhibits the growth of M96 seedlings. These results suggested that the biosynthetic pathways of 2,4-D and GA3 in M96 mutant were normal. However, the plant gravitropic growth might be related to hormones such as IAA, GA, brassinosteroid and ethylene, but their interactions and specific roles in mediating gravitropism are still obscure. Therefore, further investigation is required to test the response of M96 to other kinds of auxins.

HE Yan, et al. A New Allele for Rice Gravitropic Mutant

gdM96 is conserved among the monocot species with a conserved transmembrane domain and a NLS domain. The transmembrane domain may be critical to its function associated with the response to gravity. However, the rice PROG1 and LPA1 are quite different from gdM96 and LAZY1 both in their DNA sequences and protein structures. Furthermore, protein similarities between gdM96 or LAZY1 and the dicot Arabidopsis are also low. All there indicate that the prostrate growth phenotypes are complicated and probably controlled by multiple mechanisms in plant species. Thus, the isolation of gdM96 in the present study would facilitate the further investigation of mechanisms underlying the plant gravitropic response.

ACKNOWLEDGEMENT This study was supported by the National High Technology Research and Development Program of China (Grant No. 2014AA10A603).

REFERENCES Azuma T, Hatanaka T, Uchida N, Yasuda T. 2003. Interactions between abscisic acid, ethylene and gibberellin in internodal elongation in floating rice: The promotive effect of abscisic acid at low humidity. Plant Growth Regul, 41(2): 105–109. Buer C S, Wasteneys G O, Masle J. 2003. Ethylene modulates root-wave responses in Arabidopsis. Plant Physiol, 132(2): 1085–1096. Digby J, Firn R D. 2002. Light modulation of the gravitropic set-point angle (GSA). J Exp Bot, 53: 377–381. Dong Z B. 2014. Map-based cloning and functional analysis on the maize LAZY1 gene. Beijing: China Agricultural University. (in Chinese with English abstract) Fukaki H, Fujisawa H, Tasaka M. 1996. How do plant shoots bend up? The initial step to elucidate the molecular mechanisms of shoot gravitropism using Arabidopsis thaliana. J Plant Res, 109(2): 129–137. Gaiser J C, Lomax T L. 1993. The altered gravitropic response of the lazy-2 mutant of tomato is phytochrome regulated. Plant Physiol, 102(2): 339–344. Hangarter R P. 1997. Gravity, light and plant form. Plant Cell Environ, 20(6): 796–800. Hasenstein K H, Kuznetsov O A. 1999. The response of lazy-2 tomato seedlings to curvature-inducing magnetic gradients is modulated by light. Planta, 208(1): 59–65. Jin J, Huang W, Gao J P, Yang J, Shi M, Zhu M Z, Luo D, Lin H X. 2008. Genetic control of rice plant architecture under domestication. Nat Genet, 40(11): 1365–1369. Knauer T, Dümmer M, Landgraf F, Forreiter C. 2011. A negative effector of blue light-induced and gravitropic bending in

117 Arabidopsis. Plant Physiol, 156(1): 439–447. Kovach M J, Sweeney M T, McCouch S R. 2007. New insights into the history of rice domestication. Trends Genet, 23(11): 578–587. Li P J, Wang Y H, Qian Q, Fu Z M, Wang M, Zeng D L, Li B H, Wang X J, Li J Y. 2007. LAZY1 controls rice shoot gravitropism through regulating polar auxin transport. Cell Res, 17(5): 402–410. Liu J M, Park S J, Huang J, Lee E J, Xuan Y H, Je B I, Kumar V, Priatama R A, Raj K V, Kim S H, Min M K, Cho J H, Kim T H, Chandran A K N, Jung K H, Takatsuto S, Fujioka S, Han C D. 2016. Loose Plant Architecture1 (LPA1) determines lamina joint bending by suppressing auxin signaling that interacts with C-22-hydroxylated and 6-deoxo brassinosteroids in rice. J Exp Bot, 67(3): 1883–1895. Lu Y J, Zheng K L. 1992. A simple method for isolation of rice DNA. Chin J Rice Sci, 6(1): 47–48. (in Chinese with English abstract) Miyata M, Komori T, Yamamoto T, Ueda T, Yano M, Nitta N. 2005. Fine scale and physical mapping of Spk(t) controlling spreading stub in rice. Breeding Sci, 55(2): 237–239. Pennazio S. 2002. The discovery of the chemical nature of the plant hormone auxin. Rivista Di Biol, 95(2): 289–308. Saitou N, Nei M. 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol, 4(4): 406–425. Sang D J, Chen D Q, Liu G F, Liang Y, Huang L Z, Meng X B, Chu J F, Sun X H, Dong G J, Yuan Y D, Qian Q, Li J Y, Wang Y H. 2014. Strigolactones regulate rice tiller angle by attenuating shoot gravitropism through inhibiting auxin biosynthesis. Proc Natl Acad Sci USA, 111: 11199–11204. Shi Y F, Chen J, Liu W Q, Huang Q N, Shen B, Leung H, Wu J L. 2009. Genetic analysis and gene mapping of a new rolled-leaf mutant in rice (Oryza sativa L.). Sci China C: Life Sci, 52(9): 885–890. Song C B, Yang W T, Du D L, Li D. 2006. Progress on plant gravitropism mechanism and its related functional genes. In: Proceedings of the Workshop on Research & Development of Biotechnology in Hainan. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol, 28(10): 2731–2739. Tan L B, Li X R, Liu F X, Sun X Y, Li C G, Zhu Z F, Fu Y C, Cai H W, Wang X K, Xie D X, Sun C Q. 2008. Control of a key transition from prostrate to erect growth in rice domestication. Nat Genet, 40: 1360–1364. Tasaka M, Kato T, Fukaki H. 1999. The endodermis and shoot gravitropism. Trends Plant Sci, 4(3): 103–107. Vandenbussche F, Smalle J, Le J, Saibo N J M, de Paepe A, Chaerle L, Tietz O, Smets R, Laarhoven L J J, Harren F J M, van Onckelen H, Palme K, Verbelen J P, van Der Straeten D. 2003. The Arabidopsis mutant alh1 illustrates a cross talk between ethylene and auxin. Plant Physiol, 131(3): 1228–1238. Wu X R, Tang D, Li M, Wang K J, Cheng Z K. 2013. Loose Plant

118 Architecture 1, an INDETERMINATE DOMAIN protein involved in shoot gravitropism, regulates plant architecture in rice. Plant Physiol, 161(1): 317–329. Yoshihara T, Iino M. 2007. Identification of the gravitropismrelated rice gene LAZY1 and elucidation of LAZY1-dependent and -independent gravity signaling pathways. Plant Cell Physiol, 48(5): 678–688. Zhang J, Ku L X, Han Z P, Guo S L, Liu H J, Zhang Z Z, Cao L R,

Rice Science, Vol. 24, No. 2, 2017 Cui X J, Chen Y H. 2014. The ZmCLA4 gene in the qLA4-1 QTL controls leaf angle in maize (Zea mays L.). J Exp Bot, 65: 5063–5076. Zhang Q F, Xu J D, Li Y, Xu P Z, Zhang H Y, Wu X J. 2007. Morphological, anatomical and genetic analysis for a rice mutant with abnormal hull. J Genet Genomics, 34(6): 519–526. (Managing Editor: LI Guan)