- Email: [email protected]
Identification of a novel isoform of MD-2 that downregulates lipopolysaccharide signaling
BBRC Biochemical and Biophysical Research Communications 323 (2004) 1103–1108 www.elsevier.com/locate/ybbrc
Identification of a novel isoform of MD-2 that downregulates lipopolysaccharide signaling Shoichiro Ohta*, Uleng Bahrun, Mariko Tanaka, Masao Kimoto Department of Immunology, Saga Medical School, 5-1-1 Nabeshima, Saga, Saga 849-8501, Japan Received 3 June 2004 Available online 11 September 2004
Abstract MD-2 is an association molecule of Toll-like receptor 4 and is indispensable for the recognition of lipopolysaccharide. Here we report the identification of mRNA for an alternatively spliced form of MD-2, named MD-2B, which lacks the first 54 bases of exon 3. When overexpressed with MD-2, MD-2B competitively suppressed NF-jB activity induced by LPS. Regardless of the truncation, however, MD-2B still bound to TLR4 as efficiently as MD-2. Flow cytometric analyses revealed that MD-2B inhibited TLR4 from being expressed on the cell surface. Our data indicate that MD-2B may compete with MD-2 for binding to TLR4 and decrease the number of TLR4/MD-2 complexes on the cell surface, resulting in the inhibition of LPS signaling. 2004 Elsevier Inc. All rights reserved. Keywords: MD-2B; MD-2; LPS; TLR4; Isoform
When pathogenic microorganisms attack, the immune system provokes inflammation to remove the pathogens from the body. Mammalian Toll-like receptors (TLRs) have been shown to recognize pathogens and transmit signals for inflammatory responses [1,2]. Among the TLR family members, TLR4 has unique structural characteristics in that it associates with the MD-2 molecule essential for the recognition of lipopolysaccharide (LPS) in Gram-negative bacteria [3]. The analysis of MD-2 knockout mice revealed that MD-2 was indispensable for the cell surface expression of TLR4 and LPS-mediated immune activation [4]. Although it is necessary to defend the body from pathogens by inflammatory responses, excessive responses can perturb homeostasis. In particular, the LPS-induced excessive inflammatory response, known as endotoxin shock, often causes multiple organ failure and is even lethal to animals [5]. Therefore, avoiding
excessive response is also important in the maintenance of the ordinary physiological system as well as LPS. Several cytoplasmic molecules such as MyD88s [6], SOCS [7], and IRAK-M [8] and a membrane protein, SIGIRR [9], have been reported to disturb LPS signaling by interacting with other cytoplasmic molecules on LPS signaling pathways. On the other hand, few inhibitory molecules that function at the process of LPS recognition have been identified. As LPS recognition is the first step of the signaling pathway, inhibiting LPS recognition could be an efficient way to suppress inflammatory responses before the signal has been transmitted into the downstream pathways. We report here the identification of an alternatively spliced form of the MD-2 molecule, MD-2B, as a novel inhibitor of LPS signaling at the LPS recognition phase.
Materials and methods *
Corresponding author. Fax: +81 952 34 2049. E-mail address: [email protected] (S. Ohta).
0006-291X/$ - see front matter 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.08.203
RT-PCR. Total RNA was extracted from murine splenocytes and bone marrow cells using ISOGEN (Nippon Gene, Tokyo, Japan) or
1104
S. Ohta et al. / Biochemical and Biophysical Research Communications 323 (2004) 1103–1108
Fig. 1. Identification of MD-2B. (A) PCR was performed for 40 cycles with a primer pair for full-length MD-2 and cDNA from murine bone marrow cells as the template. The PCR product was separated in 1% agarose gel and stained with ethidium bromide. The band of MD-2 or the smeared background is indicated on the right with an arrowhead or a bar, respectively. The sizes of the DNA marker are indicated on the left. bp: base pairs. M: DNA size marker. (B) The nucleotide and putative amino acid sequences for MD-2 and MD-2B. The PCR primer specific to MD-2B is underlined. The full coding sequence of MD-2B has been submitted to the GenBank nucleotide sequence database under Accession No. AY641431. (C) PCRs were performed with the indicated primers and the cDNA of splenocytes (SC) or bone marrow-derived macrophages (BMMP) or dendritic cells (BMDC) as a template. Thirty-five cycles for MD-2 and MD-2B or 27 cycles for b-actin were carried out with an annealing temperature of 65 or 55 C, respectively. The PCR products were separated on 1.5% agarose gels and stained with ethidium bromide. The approximate sizes of the PCR products for MD-2 and MD-2B are indicated. from bone marrow-derived macrophages and dendritic cells using RNeasy Mini (QIAGEN, Hilden, Germany). Five or 0.5 lg of the total RNA was reverse transcribed into cDNA using Superscript First Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA). Full-length MD-2 (Fig. 1A) was amplified using the primer pair, forward: 5 0 -GCG CTCGAGATCATGTTGCCATTTATTCTC, reverse: 5 0 -AAAGGAT CCATTGACATCACGGCGGTGAAT. MD-2, MD-2B or b-actin (Fig. 1C) was amplified using the following primer pairs: MD-2 forward: 5 0 -CTCTTTTCGACGCTGCTTTCT (common for MD-2B), reverse: 5 0 -CTTCCTTACGCTTCGGCAACT. MD-2B reverse: TTCCTTACG CTTCGGCAACTT. b-actin forward: ATGGATGACGATATCGC TG, reverse: ATGAGGTAGTCTGTCAGGT. Plasmids. The pFLAG TLR4 plasmid that expressed FLAG-tagged TLR4 was generated by an insertion of TLR4 cDNA into pFLAG-CMV-1 (SIGMA, St. Louis, MO). pEF-BOS FLAG [10] or pEF-BOS HA (hemagglutinin tag) expression vector, which was engineered by a modification of pEF-BOS FLAG, was inserted with MD-2 or MD-2B cDNA to generate pEF-BOS MD-2f, pEF-BOS MD-2Bf, pEF-BOS MD-2HA or pEF-BOS MD-2BHA. An NF-jB promoter-luciferase construct, p55Igjluc [11], was kindly supplied by Dr. Fujita (Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan). A Renilla luciferase reporter vector, phRG-TK, was obtained from Promega (Madison, WI). Cell culture and transfection. Murine bone marrow cells were removed from female C57BL/6 mice. For macrophages, the cells were plated in 100-mm plates with RPMI/10% FCS supplemented with 50 ng/ml of recombinant M-CSF (TECHNE, Minneapolis, MN) at 1.7 · 107 cells per plate. On day 7, adherent cells were collected. More than 90% of CD11b-positive cells were observed by flow cytometry. Dendritic cell culture was performed as described [12]. Briefly, bone marrow cells were plated in 6-well plates with RPMI/10% FCS supplemented with 10 ng/ml GM-CSF (TECHNE) at 5 · 106 cells per well. Every 2 days, floating cells were removed and fresh medium containing GM-CSF was supplied. On day 6, loosely adherent cells were collected. More than 90% of CD11c-positive cells were observed by flow cytometry. HEK293 cells were cultured in DMEM supplemented with 10% FBS. Expression constructs were transfected into HEK293 cells using
FuGENE 6 transfection reagent (Roche, Basel, Switzerland) according to the manufacturerÕs instruction. Luciferase assay. Forty-eight hours after transfection of the HEK293 cells with the expression constructs, 100 ng/ml LPS (SIGMA) was added to the culture and incubated for 6 h. Luciferase assays were performed using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturerÕs instruction. Immunoprecipitation and immunoblot. Forty-eight hours after transfection of the HEK293 cells with the expression constructs, the cells were lysed in lysis buffer: 2 mM CaCl2, 2 mM MgCl2, 50 mM Tris–HCl, pH 7.5, 150 mM NaCl, and Complete Miniprotease inhibitor cocktail (Roche). The whole cell lysate was incubated with the anti-FLAG M2 (SIGMA) or the anti-HA (Roche) antibody and protein G–Sepharose (Amersham Biosciences, Piscataway, NJ) at 4 C overnight. The precipitated protein was separated by SDS–PAGE under a reducing condition and detected using the anti-FLAG M2 or the anti-HA antibody. A mouse antibody for c-myc (Santa Cruz, Santa Cruz, CA) was used as a negative control IgG. Cell staining and flow cytometry. Forty-eight hours after transfection of the HEK293 cells with the expression constructs, the cells were detached from the plates using EDTA/PBS. Single-cell suspensions in staining buffer (HBSS/3% FCS/0.02% NaN3) were incubated for 60 min with the anti-FLAG M2 antibody (SIGMA) or MTS510 that recognized the TLR4/MD-2 complex [10], followed by a 45-min incubation with FITC-labeled secondary antibodies (American Qualex, San Clemente, CA). Flow cytometry was performed using FACScan flow cytometer (BD, Franklin Lakes, NJ) and WinMDI software.
Results Identification of MD-2B PCR was performed with cDNA for murine bone marrow cells as a template using a pair of primers that amplified the full-length MD-2 cDNA. In addition to
S. Ohta et al. / Biochemical and Biophysical Research Communications 323 (2004) 1103–1108
a band of the reported MD-2, a smeared background was observed in the agarose gel (Fig. 1A). After TA cloning of the whole PCR products, several subcloned plasmids were found to contain inserts of different sizes from MD-2. DNA sequencing for one of the different inserts revealed that it was an MD-2 isoform lacking the first 54 bases of exon 3 (Fig. 1B). The isoform, MD2B, was putatively translated into a 142-residue protein with no frame shift plus one amino acid substitution at the junction between exons 2 and 3 (Fig. 1B). As the amount of MD-2B mRNA was probably much less than that of MD-2, it was difficult to amplify MD-2 and MD-2B simultaneously using the primer pair for full-length MD-2. To confirm the existence of MD-2B, a PCR primer pair that specifically amplified MD-2B was composed. The lower primer of the MD2B-specific primer pair spans the deleted sequence so that the pair amplifies MD-2B but not MD-2 (Fig. 1B). The specific primer pair could detect MD-2B in splenocytes and bone marrow-derived macrophages and dendritic cells (Fig. 1C). MD-2B competitively inhibits LPS signaling To search for functions of MD-2B, we investigated the effect of MD-2B in LPS signaling using an NF-jB reporter assay. HEK293 cells transfected with the expression plasmids for MD-2B, MD-2, and/or TLR4 as well as an NF-jB-luciferase reporter were stimulated with LPS and processed in a luciferase assay. The cells transfected with both MD-2 and TLR4 showed approximately four times higher NF-jB reporter activity than TLR4 alone when stimulated by LPS (Fig. 2). When equal amounts of MD-2B and MD-2 were co-transfected, a mild reduction of LPS-stimulated NF-jB activity was observed. As the amount of transfected MD-2B was increased up to eight times more than MD-2, NFjB activity was reduced to a level similar to those of the unstimulated cells transfected with MD-2 and TLR4 (Fig. 2). These data indicated that MD-2B inhibited TLR4/MD-2-mediated LPS signaling in a dose-dependent manner. MD-2B associates with TLR4 It was speculated that competition between MD-2B and MD-2 for binding to either TLR4 or LPS led to the suppression of LPS signaling by MD-2B. To test whether MD-2B interacted with TLR4, immunoprecipitation analyses were carried out. The lysate of HEK293 cells expressing TLR4 tagged with the FLAG epitope at the N-terminus (FLAG-TLR4) and HA-tagged MD-2B (MD-2B-HA) was immuoprecipitated using the antiFLAG antibody. After the separation and blotting of the precipitated molecules, the anti-HA antibody clearly detected MD-2B-HA, indicating co-precipitation with
1105
Fig. 2. MD-2B competitively suppressed NF-jB activity induced by LPS. HEK293 cells in a 24-well plate were transfected with the indicated amount (ng) per well of the expression constructs, p55Igjluc and phRG-TK. The transfected DNA amounts were adjusted to the same amount using an empty vector. Six hours after stimulation by 100 ng/ml LPS, NF-jB activity was measured by luciferase assay. The NF-jB activity was normalized by Renilla luciferase activity. The filled bars: incubation with LPS. The open bars: incubation without LPS.
TLR4 (Fig. 3A). In the control reaction, a similar amount of HA-tagged MD-2 (MD-2-HA) was co-precipitated with TLR4 from the FLAG-TLR4/MD-2-HA transfectant cells (Fig. 3A). In a reverse immunoprecipitation experiment, that is, immunoprecipitation with the antiHA antibody followed by blotting with the anti-FLAG antibody, the association of MD-2B with TLR4 was also demonstrated (Fig. 3B). The multiple bands for MD-2 and MD-2B are considered glycosylated forms [13]. Although the precipitated MD-2B in these experiments were derived from cytoplasm, MD-2B could be glycosylated because glycosylation of proteins occurs in the endoplasmic reticulum and the Golgi apparatus before the proteins translocate to the cell membrane or the extracellular space. In our unpublished data, another isoform of MD-2 that lacked Asn114, one of the two putative N-glycosylation sites [13], lost several bands of slower mobility, supporting a glycosylation mechanism. Thus, despite the deletion of 18 amino acid residues of exon 3, MD-2B could still bind to TLR4 as efficiently as MD-2. The TLR4/MD-2B complex is not expressed on the cell surface As MD-2 is required for TLR4 to be expressed on the cell surface [4], we were prompted to investigate the surface expression of the TLR4/MD-2B complex. FLAGTLR4 was co-expressed with FLAG-tagged MD-2
1106
S. Ohta et al. / Biochemical and Biophysical Research Communications 323 (2004) 1103–1108
Fig. 3. MD-2B associated with TLR4. HEK293 cells in a 6-well plate were transfected with 1 lg FLAG-TLR4 (fTLR4), 2 lg MD-2-HA (MD-2ha), and/or 2 lg MD-2B-HA (MD-2Bha) per well and subjected to immunoprecipitation. The transfected DNA amounts were adjusted to the same amount using an empty vector. (A) FLAG-TLR4 was immunoprecipitated using the anti-FLAG antibody. MD-2-HA and MD-2B-HA were detected using the anti-HA antibody. An isotype control IgG was used to exclude non-specific bindings. (B) MD-2-HA and MD-2B-HA were immunoprecipitated using the anti-HA antibody. FLAG-TLR4 was detected using the anti-FLAG antibody. Non-specific bands derived from IgG are indicated with arrowheads. IP: immunoprecipitation. WB: Western blotting. WCL: whole cell lysate.
(MD-2-FLAG) or FLAG-tagged MD-2B (MD-2BFLAG) in HEK293 cells and analyzed by flow cytometry. On the surface of the cells transfected with FLAG-TLR4 and MD-2, TLR4 molecules were detected by the anti-FLAG antibody or MTS510 that recognized the TLR4/MD-2 complex (Fig. 4A). In contrast, no surface expression of TLR4 was detected on cells transfected with FLAG-TLR4 and MD-2B (Fig. 4A). Furthermore, the expression of MD-2B competitively inhibited the surface expression of the TLR4/MD-2 complex in a dose-dependent manner (Figs. 4A and B).
Discussion We identified MD-2B, a novel isoform of MD-2. The coding region of MD-2B is shorter than that of MD-2
by 54 bases, leading to the deletion of 18 amino acids (Fig. 1B). MD-2B is considered an alternatively spliced form of the MD-2 regular form because the deletion of exon 3 can be detected at the messenger level, excluding posttranslational modifications. In addition, the deleted sequence starts from the top of exon 3 and finishes with AG; in other words, the putative intron 2 begins with GT and ends with AG, complying with the consensual splicing acceptor and donor sites. Re and Strominger [14] reported using mutation analyses that the binding of MD-2 to TLR4 was dependent on several amino acids located in the region between Arg90 and Tyr102. Since MD-2B retains this region, the binding ability of MD-2B to TLR4 can be conserved. Regardless of the deletion of 18 amino acids, MD-2B can still bind to TLR4 as efficiently as MD-2 (Figs. 3A and B). The association of MD-2B with TLR4 is consistent with their study. As MD-2 has been reported to be indispensable for LPS signaling in association with TLR4 and LPS [3,4], MD-2B was expected to modulate LPS signaling. The NF-jB assay showed that MD-2B moderately inhibited LPS signaling transmitted through the TLR4/MD-2 complex (Fig. 2). Although relatively large amounts of MD-2B are required for strong repression of NF-jB activity, such a mild inhibition by MD-2B may be suitable for the cell to retain certain reactivity to LPS. We also identified other isoforms of MD-2 (unpublished data). These isoforms may work cooperatively to exhibit stronger suppression of LPS signaling. As for inhibitory molecules of LPS signaling, several cytoplasmic molecules such as MyD88s [6], SOCS [7], and IRAK-M [8] have been reported. These molecules interact with other cytoplasmic molecules that promote LPS signaling, for instance, MyD88, JAK, and IRAK, interfering with the LPS signaling pathway. A membrane protein, SIGIRR [9], also inhibits LPS signaling by interacting with TLR4, IRAK, and TRAF6. Meanwhile, few inhibitory molecules that function at the process of LPS recognition have been identified. As LPS recognition is the initial step of the signaling pathway, inhibiting LPS recognition could be an efficient way to suppress inflammatory responses before the signal has been transmitted into the downstream pathways. A rare example of such inhibitory molecules may be smTLR4 [15], which has an extra exon and is encoded as a soluble TLR4 protein. However, it is unknown how smTLR4 inhibits LPS signaling. MD-2B is considered to work as an inhibitory molecule in the LPS recognition phase. Flow cytometric analyses indicate that the surface expression of TLR4/MD-2 complexes is competitively inhibited when MD-2B is coexpressed (Figs. 4A and B). As a result, the number of TLR4/MD-2 complexes responsible for LPS recognition and signal transduction on the cell surface probably decreases. Therefore, the cell may interact with fewer LPS
S. Ohta et al. / Biochemical and Biophysical Research Communications 323 (2004) 1103–1108
1107
Fig. 4. The TLR4/MD-2B complex was not expressed on the cell surface. HEK293 cells in a 6-well plate were transfected with the indicated amount (lg) per well of the expression constructs. The transfected DNA amounts were adjusted to the same amount using an empty vector. The cells were detached and stained with the indicated antibodies plus FITC-labeled secondary antibodies. (A) Flow cytometry of the transfected cells. The shaded histograms show the cells stained by the primary antibodies. The open histograms show the cells incubated with only the secondary antibodies. (B) The mean fluorescent intensities of (A) were integrated into a histogram. The open bars indicate anti-FLAG and the shaded bars indicate MTS510.
molecules, leading to a reduction of the LPS signals transmitted to the downstream pathways. Furthermore, secreted MD-2B not associating with TLR4 may also contribute to inhibit LPS signaling by neutralizing LPS because the basic and aromatic region (amino acid 119–132) that may interact with LPS [14,16] is maintained in MD-2B. The amount of MD-2B mRNA expressed in splenocytes or bone marrow-derived macrophages or dendritic cells is much smaller than that of MD-2. Even stimulated by LPS, the expression of MD-2B mRNA did not increase (data not shown). Since these cells need to be very sensitive to LPS in order to activate the immune system as soon as they find bacteria inside tissues, the inhibition of LPS signaling by MD-2B may not be necessary. It is clear from our data that the MD-2B isoform exists in vivo at least in the spleen and bone marrow, although small in amounts. It is therefore conceivable that MD-2B and also several other isoforms exist in various cell types including cells of intestinal mucosa and intestinal lymphoid follicles. These cells might be responsible for the recognition and regulation of the stimuli provided by intestinal florae. The amount of MD-2B in these cells is hard to estimate because the number of these cells might be quite low. This would be the reason why we were able to detect only a small amount of the MD-2B transcripts by specific RT-PCR using the whole intestine as the starting materials (data not shown). We have to wait for the availability of antibody that specifically recognizes MD-2B to detect the expression of this isoform at individual cellular level. Previous studies on the suppression of LPS signaling have mainly used cytoplasmic molecules. The identification of MD-2B encourages us to scrutinize secreted mol-
ecules that function in the extracellular space where LPS or pathogen-associated molecular patterns trigger signals to activate the immune system.
Acknowledgments We thank Dr. Takashi Fujita for providing p55Igj luc plasmid and Drs. Yoshinori Nagai, Sachiko Akashi, and Kensuke Miyake (University of Tokyo, Tokyo, Japan) and Dr. Kenji Fukudome (Saga Medical School) for technical suggestions and helpful discussions.
References [1] A. Aderem, R.J. Ulevitch, Toll-like receptors in the induction of the innate immune response, Nature 406 (2000) 782–787. [2] K. Takeda, T. Kaisho, S. Akira, Toll-like receptors, Annu. Rev. Immunol. 21 (2003) 335–376. [3] R. Shimazu, S. Akashi, H. Ogata, Y. Nagai, K. Fukudome, K. Miyake, M. Kimoto, MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4, J. Exp. Med. 189 (1999) 1777–1782. [4] Y. Nagai, S. Akashi, M. Nagafuku, M. Ogata, Y. Iwakura, S. Akira, T. Kitamura, A. Kosugi, M. Kimoto, K. Miyake, Essential role of MD-2 in LPS responsiveness and TLR4 distribution, Nat. Immunol. 3 (2002) 667–672. [5] E.S. Van Amersfoort, T.J. Van Berkel, J. Kuiper, Receptors, mediators, and mechanisms involved in bacterial sepsis and septic shock, Clin. Microbiol. Rev. 16 (2003) 379–414. [6] S. Janssens, K. Burns, J. Tschopp, R. Beyaert, Regulation of interleukin-1- and lipopolysaccharide-induced NF-kappaB activation by alternative splicing of MyD88, Curr. Biol. 12 (2002) 467–471. [7] M. Fujimoto, T. Naka, Regulation of cytokine signaling by SOCS family molecules, Trends Immunol. 24 (2003) 659–666.
1108
S. Ohta et al. / Biochemical and Biophysical Research Communications 323 (2004) 1103–1108
[8] K. Kobayashi, L.D. Hernandez, J.E. Galan, C.A. Janeway Jr., R. Medzhitov, R.A. Flavell, IRAK-M is a negative regulator of Tolllike receptor signaling, Cell 110 (2002) 191–202. [9] D. Wald, J. Qin, Z. Zhao, Y. Qian, M. Naramura, L. Tian, J. Towne, J.E. Sims, G.R. Stark, X. Li, SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling, Nat. Immunol. 4 (2003) 920–927. [10] S. Akashi, R. Shimazu, H. Ogata, Y. Nagai, K. Takeda, M. Kimoto, K. Miyake, Cutting edge: cell surface expression and lipopolysaccharide signaling via the toll-like receptor 4-MD-2 complex on mouse peritoneal macrophages, J. Immunol. 164 (2000) 3471–3475. [11] T. Fujita, G.P. Nolan, H.C. Liou, M.L. Scott, D. Baltimore, The candidate proto-oncogene bcl-3 encodes a transcriptional coactivator that activates through NF-kappa B p50 homodimers, Genes Dev. 7 (1993) 1354–1363. [12] K. Inaba, M. Inaba, N. Romani, H. Aya, M. Deguchi, S. Ikehara, S. Muramatsu, R.M. Steinman, Generation of large numbers of
[13]
[14]
[15]
[16]
dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor, J. Exp. Med. 176 (1992) 1693–1702. T. Ohnishi, M. Muroi, K. Tanamoto, N-linked glycosylations at Asn(26) and Asn(114) of human MD-2 are required for toll-like receptor 4-mediated activation of NF-kappaB by lipopolysaccharide, J. Immunol. 167 (2001) 3354–3359. F. Re, J.L. Strominger, Separate functional domains of human MD-2 mediate Toll-like receptor 4-binding and lipopolysaccharide responsiveness, J. Immunol. 171 (2003) 5272–5276. K.I. Iwami, T. Matsuguchi, A. Masuda, T. Kikuchi, T. Musikacharoen, Y. Yoshikai, Cutting edge: naturally occurring soluble form of mouse Toll-like receptor 4 inhibits lipopolysaccharide signaling, J. Immunol. 165 (2000) 6682–6686. M. Mancek, P. Pristovsek, R. Jerala, Identification of LPSbinding peptide fragment of MD-2, a toll-receptor accessory protein, Biochem. Biophys. Res. Commun. 292 (2002) 880– 885.
Identification of a novel isoform of MD-2 that downregulates lipopolysaccharide signaling Shoichiro Ohta*, Uleng Bahrun, Mariko Tanaka, Masao Kimoto Department of Immunology, Saga Medical School, 5-1-1 Nabeshima, Saga, Saga 849-8501, Japan Received 3 June 2004 Available online 11 September 2004
Abstract MD-2 is an association molecule of Toll-like receptor 4 and is indispensable for the recognition of lipopolysaccharide. Here we report the identification of mRNA for an alternatively spliced form of MD-2, named MD-2B, which lacks the first 54 bases of exon 3. When overexpressed with MD-2, MD-2B competitively suppressed NF-jB activity induced by LPS. Regardless of the truncation, however, MD-2B still bound to TLR4 as efficiently as MD-2. Flow cytometric analyses revealed that MD-2B inhibited TLR4 from being expressed on the cell surface. Our data indicate that MD-2B may compete with MD-2 for binding to TLR4 and decrease the number of TLR4/MD-2 complexes on the cell surface, resulting in the inhibition of LPS signaling. 2004 Elsevier Inc. All rights reserved. Keywords: MD-2B; MD-2; LPS; TLR4; Isoform
When pathogenic microorganisms attack, the immune system provokes inflammation to remove the pathogens from the body. Mammalian Toll-like receptors (TLRs) have been shown to recognize pathogens and transmit signals for inflammatory responses [1,2]. Among the TLR family members, TLR4 has unique structural characteristics in that it associates with the MD-2 molecule essential for the recognition of lipopolysaccharide (LPS) in Gram-negative bacteria [3]. The analysis of MD-2 knockout mice revealed that MD-2 was indispensable for the cell surface expression of TLR4 and LPS-mediated immune activation [4]. Although it is necessary to defend the body from pathogens by inflammatory responses, excessive responses can perturb homeostasis. In particular, the LPS-induced excessive inflammatory response, known as endotoxin shock, often causes multiple organ failure and is even lethal to animals [5]. Therefore, avoiding
excessive response is also important in the maintenance of the ordinary physiological system as well as LPS. Several cytoplasmic molecules such as MyD88s [6], SOCS [7], and IRAK-M [8] and a membrane protein, SIGIRR [9], have been reported to disturb LPS signaling by interacting with other cytoplasmic molecules on LPS signaling pathways. On the other hand, few inhibitory molecules that function at the process of LPS recognition have been identified. As LPS recognition is the first step of the signaling pathway, inhibiting LPS recognition could be an efficient way to suppress inflammatory responses before the signal has been transmitted into the downstream pathways. We report here the identification of an alternatively spliced form of the MD-2 molecule, MD-2B, as a novel inhibitor of LPS signaling at the LPS recognition phase.
Materials and methods *
Corresponding author. Fax: +81 952 34 2049. E-mail address: [email protected] (S. Ohta).
0006-291X/$ - see front matter 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.08.203
RT-PCR. Total RNA was extracted from murine splenocytes and bone marrow cells using ISOGEN (Nippon Gene, Tokyo, Japan) or
1104
S. Ohta et al. / Biochemical and Biophysical Research Communications 323 (2004) 1103–1108
Fig. 1. Identification of MD-2B. (A) PCR was performed for 40 cycles with a primer pair for full-length MD-2 and cDNA from murine bone marrow cells as the template. The PCR product was separated in 1% agarose gel and stained with ethidium bromide. The band of MD-2 or the smeared background is indicated on the right with an arrowhead or a bar, respectively. The sizes of the DNA marker are indicated on the left. bp: base pairs. M: DNA size marker. (B) The nucleotide and putative amino acid sequences for MD-2 and MD-2B. The PCR primer specific to MD-2B is underlined. The full coding sequence of MD-2B has been submitted to the GenBank nucleotide sequence database under Accession No. AY641431. (C) PCRs were performed with the indicated primers and the cDNA of splenocytes (SC) or bone marrow-derived macrophages (BMMP) or dendritic cells (BMDC) as a template. Thirty-five cycles for MD-2 and MD-2B or 27 cycles for b-actin were carried out with an annealing temperature of 65 or 55 C, respectively. The PCR products were separated on 1.5% agarose gels and stained with ethidium bromide. The approximate sizes of the PCR products for MD-2 and MD-2B are indicated. from bone marrow-derived macrophages and dendritic cells using RNeasy Mini (QIAGEN, Hilden, Germany). Five or 0.5 lg of the total RNA was reverse transcribed into cDNA using Superscript First Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA). Full-length MD-2 (Fig. 1A) was amplified using the primer pair, forward: 5 0 -GCG CTCGAGATCATGTTGCCATTTATTCTC, reverse: 5 0 -AAAGGAT CCATTGACATCACGGCGGTGAAT. MD-2, MD-2B or b-actin (Fig. 1C) was amplified using the following primer pairs: MD-2 forward: 5 0 -CTCTTTTCGACGCTGCTTTCT (common for MD-2B), reverse: 5 0 -CTTCCTTACGCTTCGGCAACT. MD-2B reverse: TTCCTTACG CTTCGGCAACTT. b-actin forward: ATGGATGACGATATCGC TG, reverse: ATGAGGTAGTCTGTCAGGT. Plasmids. The pFLAG TLR4 plasmid that expressed FLAG-tagged TLR4 was generated by an insertion of TLR4 cDNA into pFLAG-CMV-1 (SIGMA, St. Louis, MO). pEF-BOS FLAG [10] or pEF-BOS HA (hemagglutinin tag) expression vector, which was engineered by a modification of pEF-BOS FLAG, was inserted with MD-2 or MD-2B cDNA to generate pEF-BOS MD-2f, pEF-BOS MD-2Bf, pEF-BOS MD-2HA or pEF-BOS MD-2BHA. An NF-jB promoter-luciferase construct, p55Igjluc [11], was kindly supplied by Dr. Fujita (Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan). A Renilla luciferase reporter vector, phRG-TK, was obtained from Promega (Madison, WI). Cell culture and transfection. Murine bone marrow cells were removed from female C57BL/6 mice. For macrophages, the cells were plated in 100-mm plates with RPMI/10% FCS supplemented with 50 ng/ml of recombinant M-CSF (TECHNE, Minneapolis, MN) at 1.7 · 107 cells per plate. On day 7, adherent cells were collected. More than 90% of CD11b-positive cells were observed by flow cytometry. Dendritic cell culture was performed as described [12]. Briefly, bone marrow cells were plated in 6-well plates with RPMI/10% FCS supplemented with 10 ng/ml GM-CSF (TECHNE) at 5 · 106 cells per well. Every 2 days, floating cells were removed and fresh medium containing GM-CSF was supplied. On day 6, loosely adherent cells were collected. More than 90% of CD11c-positive cells were observed by flow cytometry. HEK293 cells were cultured in DMEM supplemented with 10% FBS. Expression constructs were transfected into HEK293 cells using
FuGENE 6 transfection reagent (Roche, Basel, Switzerland) according to the manufacturerÕs instruction. Luciferase assay. Forty-eight hours after transfection of the HEK293 cells with the expression constructs, 100 ng/ml LPS (SIGMA) was added to the culture and incubated for 6 h. Luciferase assays were performed using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturerÕs instruction. Immunoprecipitation and immunoblot. Forty-eight hours after transfection of the HEK293 cells with the expression constructs, the cells were lysed in lysis buffer: 2 mM CaCl2, 2 mM MgCl2, 50 mM Tris–HCl, pH 7.5, 150 mM NaCl, and Complete Miniprotease inhibitor cocktail (Roche). The whole cell lysate was incubated with the anti-FLAG M2 (SIGMA) or the anti-HA (Roche) antibody and protein G–Sepharose (Amersham Biosciences, Piscataway, NJ) at 4 C overnight. The precipitated protein was separated by SDS–PAGE under a reducing condition and detected using the anti-FLAG M2 or the anti-HA antibody. A mouse antibody for c-myc (Santa Cruz, Santa Cruz, CA) was used as a negative control IgG. Cell staining and flow cytometry. Forty-eight hours after transfection of the HEK293 cells with the expression constructs, the cells were detached from the plates using EDTA/PBS. Single-cell suspensions in staining buffer (HBSS/3% FCS/0.02% NaN3) were incubated for 60 min with the anti-FLAG M2 antibody (SIGMA) or MTS510 that recognized the TLR4/MD-2 complex [10], followed by a 45-min incubation with FITC-labeled secondary antibodies (American Qualex, San Clemente, CA). Flow cytometry was performed using FACScan flow cytometer (BD, Franklin Lakes, NJ) and WinMDI software.
Results Identification of MD-2B PCR was performed with cDNA for murine bone marrow cells as a template using a pair of primers that amplified the full-length MD-2 cDNA. In addition to
S. Ohta et al. / Biochemical and Biophysical Research Communications 323 (2004) 1103–1108
a band of the reported MD-2, a smeared background was observed in the agarose gel (Fig. 1A). After TA cloning of the whole PCR products, several subcloned plasmids were found to contain inserts of different sizes from MD-2. DNA sequencing for one of the different inserts revealed that it was an MD-2 isoform lacking the first 54 bases of exon 3 (Fig. 1B). The isoform, MD2B, was putatively translated into a 142-residue protein with no frame shift plus one amino acid substitution at the junction between exons 2 and 3 (Fig. 1B). As the amount of MD-2B mRNA was probably much less than that of MD-2, it was difficult to amplify MD-2 and MD-2B simultaneously using the primer pair for full-length MD-2. To confirm the existence of MD-2B, a PCR primer pair that specifically amplified MD-2B was composed. The lower primer of the MD2B-specific primer pair spans the deleted sequence so that the pair amplifies MD-2B but not MD-2 (Fig. 1B). The specific primer pair could detect MD-2B in splenocytes and bone marrow-derived macrophages and dendritic cells (Fig. 1C). MD-2B competitively inhibits LPS signaling To search for functions of MD-2B, we investigated the effect of MD-2B in LPS signaling using an NF-jB reporter assay. HEK293 cells transfected with the expression plasmids for MD-2B, MD-2, and/or TLR4 as well as an NF-jB-luciferase reporter were stimulated with LPS and processed in a luciferase assay. The cells transfected with both MD-2 and TLR4 showed approximately four times higher NF-jB reporter activity than TLR4 alone when stimulated by LPS (Fig. 2). When equal amounts of MD-2B and MD-2 were co-transfected, a mild reduction of LPS-stimulated NF-jB activity was observed. As the amount of transfected MD-2B was increased up to eight times more than MD-2, NFjB activity was reduced to a level similar to those of the unstimulated cells transfected with MD-2 and TLR4 (Fig. 2). These data indicated that MD-2B inhibited TLR4/MD-2-mediated LPS signaling in a dose-dependent manner. MD-2B associates with TLR4 It was speculated that competition between MD-2B and MD-2 for binding to either TLR4 or LPS led to the suppression of LPS signaling by MD-2B. To test whether MD-2B interacted with TLR4, immunoprecipitation analyses were carried out. The lysate of HEK293 cells expressing TLR4 tagged with the FLAG epitope at the N-terminus (FLAG-TLR4) and HA-tagged MD-2B (MD-2B-HA) was immuoprecipitated using the antiFLAG antibody. After the separation and blotting of the precipitated molecules, the anti-HA antibody clearly detected MD-2B-HA, indicating co-precipitation with
1105
Fig. 2. MD-2B competitively suppressed NF-jB activity induced by LPS. HEK293 cells in a 24-well plate were transfected with the indicated amount (ng) per well of the expression constructs, p55Igjluc and phRG-TK. The transfected DNA amounts were adjusted to the same amount using an empty vector. Six hours after stimulation by 100 ng/ml LPS, NF-jB activity was measured by luciferase assay. The NF-jB activity was normalized by Renilla luciferase activity. The filled bars: incubation with LPS. The open bars: incubation without LPS.
TLR4 (Fig. 3A). In the control reaction, a similar amount of HA-tagged MD-2 (MD-2-HA) was co-precipitated with TLR4 from the FLAG-TLR4/MD-2-HA transfectant cells (Fig. 3A). In a reverse immunoprecipitation experiment, that is, immunoprecipitation with the antiHA antibody followed by blotting with the anti-FLAG antibody, the association of MD-2B with TLR4 was also demonstrated (Fig. 3B). The multiple bands for MD-2 and MD-2B are considered glycosylated forms [13]. Although the precipitated MD-2B in these experiments were derived from cytoplasm, MD-2B could be glycosylated because glycosylation of proteins occurs in the endoplasmic reticulum and the Golgi apparatus before the proteins translocate to the cell membrane or the extracellular space. In our unpublished data, another isoform of MD-2 that lacked Asn114, one of the two putative N-glycosylation sites [13], lost several bands of slower mobility, supporting a glycosylation mechanism. Thus, despite the deletion of 18 amino acid residues of exon 3, MD-2B could still bind to TLR4 as efficiently as MD-2. The TLR4/MD-2B complex is not expressed on the cell surface As MD-2 is required for TLR4 to be expressed on the cell surface [4], we were prompted to investigate the surface expression of the TLR4/MD-2B complex. FLAGTLR4 was co-expressed with FLAG-tagged MD-2
1106
S. Ohta et al. / Biochemical and Biophysical Research Communications 323 (2004) 1103–1108
Fig. 3. MD-2B associated with TLR4. HEK293 cells in a 6-well plate were transfected with 1 lg FLAG-TLR4 (fTLR4), 2 lg MD-2-HA (MD-2ha), and/or 2 lg MD-2B-HA (MD-2Bha) per well and subjected to immunoprecipitation. The transfected DNA amounts were adjusted to the same amount using an empty vector. (A) FLAG-TLR4 was immunoprecipitated using the anti-FLAG antibody. MD-2-HA and MD-2B-HA were detected using the anti-HA antibody. An isotype control IgG was used to exclude non-specific bindings. (B) MD-2-HA and MD-2B-HA were immunoprecipitated using the anti-HA antibody. FLAG-TLR4 was detected using the anti-FLAG antibody. Non-specific bands derived from IgG are indicated with arrowheads. IP: immunoprecipitation. WB: Western blotting. WCL: whole cell lysate.
(MD-2-FLAG) or FLAG-tagged MD-2B (MD-2BFLAG) in HEK293 cells and analyzed by flow cytometry. On the surface of the cells transfected with FLAG-TLR4 and MD-2, TLR4 molecules were detected by the anti-FLAG antibody or MTS510 that recognized the TLR4/MD-2 complex (Fig. 4A). In contrast, no surface expression of TLR4 was detected on cells transfected with FLAG-TLR4 and MD-2B (Fig. 4A). Furthermore, the expression of MD-2B competitively inhibited the surface expression of the TLR4/MD-2 complex in a dose-dependent manner (Figs. 4A and B).
Discussion We identified MD-2B, a novel isoform of MD-2. The coding region of MD-2B is shorter than that of MD-2
by 54 bases, leading to the deletion of 18 amino acids (Fig. 1B). MD-2B is considered an alternatively spliced form of the MD-2 regular form because the deletion of exon 3 can be detected at the messenger level, excluding posttranslational modifications. In addition, the deleted sequence starts from the top of exon 3 and finishes with AG; in other words, the putative intron 2 begins with GT and ends with AG, complying with the consensual splicing acceptor and donor sites. Re and Strominger [14] reported using mutation analyses that the binding of MD-2 to TLR4 was dependent on several amino acids located in the region between Arg90 and Tyr102. Since MD-2B retains this region, the binding ability of MD-2B to TLR4 can be conserved. Regardless of the deletion of 18 amino acids, MD-2B can still bind to TLR4 as efficiently as MD-2 (Figs. 3A and B). The association of MD-2B with TLR4 is consistent with their study. As MD-2 has been reported to be indispensable for LPS signaling in association with TLR4 and LPS [3,4], MD-2B was expected to modulate LPS signaling. The NF-jB assay showed that MD-2B moderately inhibited LPS signaling transmitted through the TLR4/MD-2 complex (Fig. 2). Although relatively large amounts of MD-2B are required for strong repression of NF-jB activity, such a mild inhibition by MD-2B may be suitable for the cell to retain certain reactivity to LPS. We also identified other isoforms of MD-2 (unpublished data). These isoforms may work cooperatively to exhibit stronger suppression of LPS signaling. As for inhibitory molecules of LPS signaling, several cytoplasmic molecules such as MyD88s [6], SOCS [7], and IRAK-M [8] have been reported. These molecules interact with other cytoplasmic molecules that promote LPS signaling, for instance, MyD88, JAK, and IRAK, interfering with the LPS signaling pathway. A membrane protein, SIGIRR [9], also inhibits LPS signaling by interacting with TLR4, IRAK, and TRAF6. Meanwhile, few inhibitory molecules that function at the process of LPS recognition have been identified. As LPS recognition is the initial step of the signaling pathway, inhibiting LPS recognition could be an efficient way to suppress inflammatory responses before the signal has been transmitted into the downstream pathways. A rare example of such inhibitory molecules may be smTLR4 [15], which has an extra exon and is encoded as a soluble TLR4 protein. However, it is unknown how smTLR4 inhibits LPS signaling. MD-2B is considered to work as an inhibitory molecule in the LPS recognition phase. Flow cytometric analyses indicate that the surface expression of TLR4/MD-2 complexes is competitively inhibited when MD-2B is coexpressed (Figs. 4A and B). As a result, the number of TLR4/MD-2 complexes responsible for LPS recognition and signal transduction on the cell surface probably decreases. Therefore, the cell may interact with fewer LPS
S. Ohta et al. / Biochemical and Biophysical Research Communications 323 (2004) 1103–1108
1107
Fig. 4. The TLR4/MD-2B complex was not expressed on the cell surface. HEK293 cells in a 6-well plate were transfected with the indicated amount (lg) per well of the expression constructs. The transfected DNA amounts were adjusted to the same amount using an empty vector. The cells were detached and stained with the indicated antibodies plus FITC-labeled secondary antibodies. (A) Flow cytometry of the transfected cells. The shaded histograms show the cells stained by the primary antibodies. The open histograms show the cells incubated with only the secondary antibodies. (B) The mean fluorescent intensities of (A) were integrated into a histogram. The open bars indicate anti-FLAG and the shaded bars indicate MTS510.
molecules, leading to a reduction of the LPS signals transmitted to the downstream pathways. Furthermore, secreted MD-2B not associating with TLR4 may also contribute to inhibit LPS signaling by neutralizing LPS because the basic and aromatic region (amino acid 119–132) that may interact with LPS [14,16] is maintained in MD-2B. The amount of MD-2B mRNA expressed in splenocytes or bone marrow-derived macrophages or dendritic cells is much smaller than that of MD-2. Even stimulated by LPS, the expression of MD-2B mRNA did not increase (data not shown). Since these cells need to be very sensitive to LPS in order to activate the immune system as soon as they find bacteria inside tissues, the inhibition of LPS signaling by MD-2B may not be necessary. It is clear from our data that the MD-2B isoform exists in vivo at least in the spleen and bone marrow, although small in amounts. It is therefore conceivable that MD-2B and also several other isoforms exist in various cell types including cells of intestinal mucosa and intestinal lymphoid follicles. These cells might be responsible for the recognition and regulation of the stimuli provided by intestinal florae. The amount of MD-2B in these cells is hard to estimate because the number of these cells might be quite low. This would be the reason why we were able to detect only a small amount of the MD-2B transcripts by specific RT-PCR using the whole intestine as the starting materials (data not shown). We have to wait for the availability of antibody that specifically recognizes MD-2B to detect the expression of this isoform at individual cellular level. Previous studies on the suppression of LPS signaling have mainly used cytoplasmic molecules. The identification of MD-2B encourages us to scrutinize secreted mol-
ecules that function in the extracellular space where LPS or pathogen-associated molecular patterns trigger signals to activate the immune system.
Acknowledgments We thank Dr. Takashi Fujita for providing p55Igj luc plasmid and Drs. Yoshinori Nagai, Sachiko Akashi, and Kensuke Miyake (University of Tokyo, Tokyo, Japan) and Dr. Kenji Fukudome (Saga Medical School) for technical suggestions and helpful discussions.
References [1] A. Aderem, R.J. Ulevitch, Toll-like receptors in the induction of the innate immune response, Nature 406 (2000) 782–787. [2] K. Takeda, T. Kaisho, S. Akira, Toll-like receptors, Annu. Rev. Immunol. 21 (2003) 335–376. [3] R. Shimazu, S. Akashi, H. Ogata, Y. Nagai, K. Fukudome, K. Miyake, M. Kimoto, MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4, J. Exp. Med. 189 (1999) 1777–1782. [4] Y. Nagai, S. Akashi, M. Nagafuku, M. Ogata, Y. Iwakura, S. Akira, T. Kitamura, A. Kosugi, M. Kimoto, K. Miyake, Essential role of MD-2 in LPS responsiveness and TLR4 distribution, Nat. Immunol. 3 (2002) 667–672. [5] E.S. Van Amersfoort, T.J. Van Berkel, J. Kuiper, Receptors, mediators, and mechanisms involved in bacterial sepsis and septic shock, Clin. Microbiol. Rev. 16 (2003) 379–414. [6] S. Janssens, K. Burns, J. Tschopp, R. Beyaert, Regulation of interleukin-1- and lipopolysaccharide-induced NF-kappaB activation by alternative splicing of MyD88, Curr. Biol. 12 (2002) 467–471. [7] M. Fujimoto, T. Naka, Regulation of cytokine signaling by SOCS family molecules, Trends Immunol. 24 (2003) 659–666.
1108
S. Ohta et al. / Biochemical and Biophysical Research Communications 323 (2004) 1103–1108
[8] K. Kobayashi, L.D. Hernandez, J.E. Galan, C.A. Janeway Jr., R. Medzhitov, R.A. Flavell, IRAK-M is a negative regulator of Tolllike receptor signaling, Cell 110 (2002) 191–202. [9] D. Wald, J. Qin, Z. Zhao, Y. Qian, M. Naramura, L. Tian, J. Towne, J.E. Sims, G.R. Stark, X. Li, SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling, Nat. Immunol. 4 (2003) 920–927. [10] S. Akashi, R. Shimazu, H. Ogata, Y. Nagai, K. Takeda, M. Kimoto, K. Miyake, Cutting edge: cell surface expression and lipopolysaccharide signaling via the toll-like receptor 4-MD-2 complex on mouse peritoneal macrophages, J. Immunol. 164 (2000) 3471–3475. [11] T. Fujita, G.P. Nolan, H.C. Liou, M.L. Scott, D. Baltimore, The candidate proto-oncogene bcl-3 encodes a transcriptional coactivator that activates through NF-kappa B p50 homodimers, Genes Dev. 7 (1993) 1354–1363. [12] K. Inaba, M. Inaba, N. Romani, H. Aya, M. Deguchi, S. Ikehara, S. Muramatsu, R.M. Steinman, Generation of large numbers of
[13]
[14]
[15]
[16]
dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor, J. Exp. Med. 176 (1992) 1693–1702. T. Ohnishi, M. Muroi, K. Tanamoto, N-linked glycosylations at Asn(26) and Asn(114) of human MD-2 are required for toll-like receptor 4-mediated activation of NF-kappaB by lipopolysaccharide, J. Immunol. 167 (2001) 3354–3359. F. Re, J.L. Strominger, Separate functional domains of human MD-2 mediate Toll-like receptor 4-binding and lipopolysaccharide responsiveness, J. Immunol. 171 (2003) 5272–5276. K.I. Iwami, T. Matsuguchi, A. Masuda, T. Kikuchi, T. Musikacharoen, Y. Yoshikai, Cutting edge: naturally occurring soluble form of mouse Toll-like receptor 4 inhibits lipopolysaccharide signaling, J. Immunol. 165 (2000) 6682–6686. M. Mancek, P. Pristovsek, R. Jerala, Identification of LPSbinding peptide fragment of MD-2, a toll-receptor accessory protein, Biochem. Biophys. Res. Commun. 292 (2002) 880– 885.