- Email: [email protected]
Identification of a novel Xenopus laevis poly (A) binding protein
Biology of the Cell 96 (2004) 519–527 www.elsevier.com/locate/biocell
Identification of a novel Xenopus laevis poly (A) binding protein Bertrand Cosson a,*, Frederique Braun a,1, Luc Paillard a, Perry Blackshear b,c, H. Beverley Osborne a a
UMR6061 CNRS – Génétique et Développement, Université de Rennes 1, Faculté de Médecine, 2 avenue Professeur Leon Bernard, CS 34317, 35043 Rennes cedex, France. b Laboratory of Signal Transduction and the Offıce of Clinical Research, National Institute of Environmental Health Sciences, NIH, DHHS, Research Triangle Park, NC 27709; USA c Departments of Medicine and Biochemistry, Duke University Medical Center, Durham, NC 27710, USA Received 2 April 2004; accepted 29 April 2004 Available online 02 June 2004
Abstract Poly (A) binding proteins are intimately implicated in controlling a number of events in mRNA metabolism from nuclear polyadenylation to cytoplasmic translation and stability. The known poly(A) binding proteins can be divided into three distinct structural groups (prototypes PABP1, PABPN1/PABP2 and Nab2p) and two functional families, showing that similar functions can be accomplished by differing structural units. This has prompted us to perform a screen for novel poly(A) binding proteins using Xenopus laevis. A novel poly(A) binding protein of 32 kDa (p32) was identified. Sequence analysis showed that p32 has about 50% identity to the known nuclear poly(A) binding proteins (PABPN1) but is more closely related to a group of mammalian proteins of unknown function. The expression of Xenopus laevis ePABP2 is restricted to early embryos. Accordingly, we propose that p32 is the founder member of a novel class of poly(A) binding proteins named ePABP2. © 2004 Elsevier SAS. All rights reserved. Keywords: ePABP2; Cytoplasmic protein; Oocytes; Embryos
1. Introduction With the exception of mRNAs encoding histones, mRNAs in eukaryotic cells terminate with a track of polyadenosines that are added post-transcriptionally during the maturation of the primary transcript in the nucleus. It has been known for a number of years that this poly(A) tail confers stability on a mRNA and increases translation efficiency (Richter, 1999; Wilusz et al., 2001). Several proteins, either nuclear or cytoplasmic, have been identified and cloned that specifically interact with poly(A) tracts. In mammals, a specific poly(A) binding protein (PABPN1 or PABP2) was shown to play a role in pre-mRNA processing (Wahle, 1991). This protein will be referred to as * Corresponding author: Tel : 33 (0) 223 23 46 90, Fax : 33 (0) 223 23 44 78. E-mail address: [email protected] (B. Cosson). 1 Present adress, FRE 2230 Biocatalyse, 2, rue de la Houssinière, BP92208, 44322 Nantes Cedex 3, France. © 2004 Elsevier SAS. All rights reserved. doi:10.1016/j.biolcel.2004.04.006
PABPN1 as suggested by Mangus et al (2003). Nuclear 3′ end processing of cellular pre-mRNAs occurs in two steps that are coupled. Endonucleolytic cleavage is followed by addition of poly(A) to the upstream cleavage product. Poly(A) polymerase (PAP) catalyses the addition of a short (around 10 nucleotides) poly(A) sequence. This nascent poly(A) tail is a binding site for PABPN1 and the functional interaction between PABPN1 and PAP is required for the subsequent processive elongation of the poly(A) tail and control of its length (Bienroth et al., 1993; Wahle, 1995). In the cytoplasm, a family of closely related poly(A) binding proteins have been implicated to different degrees in the control of mRNA translation and stability (Wilusz et al., 2001). The founder member of this family is the 70 kDa poly(A) binding protein 1 (PABP1) that was first isolated by Blobel (1973). In the amphibian Xenopus laevis an embryonic poly(A) binding protein (ePAB) was recently described (Cosson et al., 2002b; Voeltz et al., 2001). An inducible poly(A) binding protein has been characterised in human cells (Yang et al., 1995) and a testis specific transcript has
520
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527
been characterised in humans (Feral et al., 2001). These proteins are structurally related to PABP1 but are encoded by distinct genes. The distinction between a PABPN1-mediated nuclear polyadenylation and the PABP1-mediated cytoplasmic events may not be as clear-cut as it would appear at first. For instance, frog oocytes contain sequence specific polyadenylation activities in both their nucleus and cytoplasm (Fox et al., 1989). Cytoplasmic polyadenylation first occurs during oocyte maturation and can proceed even in enucleated oocytes (Fox et al., 1989). Evidence that cytoplasmic polyadenylation also occurs in nerve cells has also been reported (Wu et al., 1998; Si et al., 2003). In addition, in yeast Rbp29 was identified as a sequence homologue of the mammalian nuclear poly(A) binding proteins (PABPN1) but was not found to play any role in nuclear polyadenylation (Winstall et al., 2000). In vitro studies suggested that the yeast 70 kDa PABP1 was responsible for controlling poly(A) tail length in both the nucleus and the cytoplasm (Amrani et al., 1997; Minvielle-Sebastia et al., 1997). However this dual role for the yeast PABP1 has been recently questioned by the demonstration that the protein Nab2p, that is unrelated to the mammalian nuclear poly(A) binding protein, is required for nuclear poly(A) tail length control in vivo (Hector et al., 2002). The known RNA binding proteins that show a specificity for poly(A) can be subdivided into three structurally distinct groups: PABP1, PABPN1 and Nab2p. However, other poly(A) binding proteins may exist whose sequences are unrelated to these three groups of known poly(A) binding proteins. The identification of such novel proteins would probably be instructive in deciphering the various mechanisms that control poly(A) metabolism. As an initial step to identify bona fide poly(A) binding proteins that may not be structurally related to PABP1 and PABPN1 we have used poly(A) RNA affinity chromatography. We describe here the characterisation of a novel Xenopus RNA-binding protein that displays a specificity for poly(A). The expression of this protein is restricted to early embryos. Sequence analysis identified several closely related mammalian proteins with unknown function. Due to the expression pattern and the cytoplasmic location of the Xenopus protein, we propose that these proteins constitute a new family of poly(A) binding proteins named as ePABP2. 2. Results 2.1. Identification of poly(A) binding proteins in Xenopus egg extracts To identify the poly(A) binding proteins in Xenopus egg extracts a RNA-affinity chromatography protocol was used to isolate detectable amounts of these proteins. The proteins eluted from the column by a micrococal nuclease treatment were separated by SDS-PAGE and revealed by Coomassie blue staining (Fig. 1A, lanes 1 and 2). Four major bands at 70,
Fig. 1. Identification of new poly(A) binding proteins. A - Unfertilized egg extracts were chromatographed on a poly(A) column. Proteins eluted after micrococcal nuclease treatment were analysed by SDS-PAGE followed by Coomassie staining (lane 2). Poly(A) column eluate (lane 4) was analysed by western blotting using anti-PABP1 C4 serum in parallel with cell extract prepared from stage 31/32 embryos (lane 3). Lane 1 show molecular weight markers stained with Coomassie blue. B - Comparison of amino acid sequence homology, indicated as a percentage, between p32 and known poly(A) binding proteins.
32, 20 and 18 kDa were reproducibly observed. Sequence data obtained from the excised bands showed that p18 corresponded to the micrococcal nuclease used to elute the column (data not shown). Western analysis using an anti PABP1 antibody (Fig. 1A, lanes 3 and 4) detected a strongly immuno-reactive 70 kDa protein in the eluant from the poly(A) column. The anti-PABP1 antibodies used in this experiment was subsequently found to cross reacts with ePAB (Cosson et al., 2002b) and in some experiments the 70 kDa band migrated as a doublet. We assumed therefore that the 70 kDa band is composed of PABP1 and ePAB. To identify the other proteins eluted from the poly(A) column peptide sequence data were obtained from the material excised from the SDS-polyacrylamide gel at the positions of p32 and p20. The sequences of three peptides were obtained for p20 (LFIGGLNFDTNEESL; YGQISEVVVVK; GFGFVTFENPDDAKD). All of these corresponded exactly to the Xcirp-2 (Xenopus Cold-Inducible Ribonucleic Protein 2) protein sequence (Matsumoto et al., 2000). The sequence of the four peptides derived from p32 did not show any clearly significant sequence homology to known proteins. Therefore to further study the 32 kDa protein, the peptide sequences were back-translated and the derived oligonucleotides were used to clone cDNAs by a combination of RT-PCR and 5′ RACE. Comparison of the sequence data obtained from these partial cDNAs with that produced by the NIH Xenopus EST project (Blackshear et al., 2001) allowed in silico cloning of the proximal part of the
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527
3’UTR and the C-terminal extremity of the open reading frame (ORF). The complete ORF was subsequently cloned by RT-PCR using specific primers and sequenced. The cDNA sequence (accession number AY221506) contains an open reading frame of 218 amino acids in which all the identified peptides are present (see Fig. 6). When initially submitted (Feb. 1 2003) this protein was named PABPN2/ePABP2. As will become apparent during the description of the results presented in this article, the second name is more appropriate. During the preparation of this manuscript, a sequence was submitted by Good at al. (accession number AAR26263) that is 95% identical to the p32 sequence. These two sequences probably correspond to two alleles, both of which are expressed. This is a case often encountered with Xenopus laevis whose genome is tetraploide. Comparison of the p32 sequence with that of known poly(A) binding proteins (see Fig. 1B) showed that this protein has the highest sequence conservation (about 50%) with proteins of the PABPN1 family. The conservation between p32 and cytoplasmic PABPs was only about 16%. The identity between Xenopus and mouse PABPN1 is 69% and a similar degree of identity is also found between the two Xenopus cytoplasmic PABPs (XPABP1 and ePAB). The identity between Xenopus PABN1 and p32 is only 49%. Therefore Xenopus PABPN1 is more closely related to its mouse orthologue than to p32. This suggests that p32 may belong to a novel family of poly(A) binding proteins. 2.2. p32 is a poly(A) binding protein The way in which XCirp2 and p32 were purified suggests that they may be poly(A) binding proteins. A series of experiments was therefore designed to test this hypothesis. For XCirp2 these experiments were inconclusive. Accordingly, a description of the binding properties of Xcirp2 to poly(A) requires additional experiments and will not be further discussed in this paper. First the p32 coding sequence was expressed in rabbit reticulocyte lysates and the recombinant protein was incubated with poly(A) or control RNA beads. As controls, similar analyses were performed with recombinant in vitro translated ePAB, PABP1 and GST-GFP. The results of these experiments are shown in Fig. 2. As expected the majority of the input ePAB and PABP1 were retained on the poly(A) beads (lane 2). A small amount of these proteins also bound to the control beads (lane 3), we interpret this as non-specific background binding. The recombinant p32, like the maternal protein, bound to the poly(A) beads but not to the control beads. The GST-GFP protein was not retained on either set of beads. Secondly, to confirm the specificity of p32 binding to the poly(A) ligand, competition experiments were performed. As a positive control a known poly(A) binding protein (PABP1) was used, and EDEN-BP that binds to U/purine rich sequences (Paillard and Osborne, 2003) constituted a negative control. The three recombinant proteins were synthetised
521
Fig. 2. Binding Properties of p32 Radiolabelled in vitro translated proteins, as indicated on the right of each panel, were incubated with poly(A) (lane 2) and control RNA (poly(C) (lane 3) beads. ePAB, PABP1 and GST-GFP were used as positive and negative controls. 1/5 of the input protein (lane 1) was loaded in parallel with the SDS-eluted proteins. After separation by SDS-PAGE the proteins were detected by autoradiography.
by in vitro translation in the presence of [35S]-methionine and then incubated with poly(A) beads. When required the recombinant protein was incubated with competing RNA prior to addition to the poly(A) beads. The data in Fig. 3A shows that, as expected, only PABP1 (lane 5) and p32 (lanes 6 and 7) were retained on the poly(A) beads. When the recombinant p32 was incubated with the competing poly(A) RNA at a 150-fold excess over the amount of poly(A) ligand bound to the beads the binding to the poly(A) beads was decreased by about 85% (see Fig. 3B). The presence of the other competing RNAs did not affect the p32 binding to the poly(A) beads: poly(C) (lanes 10 and 11), poly(G) (lanes 12 and 13) and tRNA (lanes 14 and 15). This was confirmed by quantification of the bound protein (Fig. 3B). In a separate set of experiments the competitor poly(A) was used at a 40-fold molar excess. In these conditions the binding of p32 to the poly(A) beads was inhibited by 60% (data not shown). It is formally possible that p32 (maternal or recombinant) is binding to the poly(A) beads via an interaction with ePAB or PABP1 respectively. ePAB is the major poly(A) binding protein in egg and embryo extracts (Cosson et al., 2002b) whereas PABP1 is abundant in reticulocyte lysates. To exclude this possibility recombinant 35S-labelled p32 was incubated with His tagged ePAB coupled to Ni affinity beads. No binding of p32 to the affinity matrix could be detected (data not shown) although in the conditions used eRF3 binding to ePAB could be detected (Cosson et al., 2002a).
522
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527
Fig. 3. p32 binds specifically to poly(A) A - Radiolabelled in vitro translated p32, EDEN-BP and PABP1 were incubated with poly(A) beads in the absence (lanes 4-7) or the presence of a 150-fold molar excess of RNA competitor poly(A) (lanes 8 and 9), poly(C) (lanes 10 and 11), poly(G) (lanes 12 and 13) or tRNA (lanes 14 and 15). Lanes 6 to 15 are duplicate analyses of p32 binding for each of the indicated condition. After eliminating the unbound proteins, bound proteins were eluted with SDS and analysed by SDS-PAGE and autoradiography. Lanes 1 to 3 corresponds to 1/5 of the indicated input proteins. B - The autoradiograms from two experiments (total of 5 samples) similar to that shown in (A) were quantified using a phosphoimager. The results represent the percentage of p32 retained on the poly(A) beads in the presence of each competitor RNA relative to the amount retained in the absence of competitor RNA.
Together, these results demonstrate that p32 has the properties of a poly(A) binding protein. 2.3. RNA dependence for cap affınity purified proteins The PABP1 protein, via an interaction with eIF4G, can be co-purified with the cap-binding protein eIF4E (Tarun et al., 1996; Imataka et al., 1998; Cao and Richter, 2002). This interaction of PABP1 with the cap affinity column does not require the presence of RNA. To test if p32 can also associate with the cap-binding complex eIF4F, a cap affinity (7mGTPSepharose) column was loaded with unfertilized eggs extracts pre-treated or not with RNase A and supplemented with GTP (0.2mM) as described previously (Cosson et al., 2002b). After extensive washing the proteins bound to the cap affinity column were eluted with SDS and subjected to Western analysis using anti eIF4E, anti-ePAB and anti p32 antibodies. The anti p32 antibody used (see Materials and Methods) detected a single protein of the expected size in the eluant from the poly(A) columns and in whole Xenopus embryo extracts (data not shown, see also Fig. 5). The results of these Western analyses are shown in Fig. 4. As expected equal amounts of eIF4E were recovered in eluates from
RNase A treated and untreated unfertilized egg extracts (bottom panel, lanes 2 and 3). As previously demonstrated (Cosson et al., 2002b), the ePAB present in RNase A treated extracts was also retained on the cap-affinity column (top
Fig. 4. p32 does not bind to Cap columns. RNase treated (+, lanes 2 and 4) or untreated (-, lanes 3 and 5) unfertilized egg extracts were incubated with cap affinity beads (lanes 2 and 3), or poly(A) beads (lanes 4 and 5) for protein stability control. Lane 1, input 1/5 of the cell extract before RNase treatment. After separation of the bound proteins by SDS-PAGE, Western blotting was performed using specific antibodies against ePAB, p32 and eIF4E as indicated. All the samples were analysed on the same gel, the lanes were rearranged for clarity.
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527
523
prior RNase A treatment of the extract. Hence, the retention of p32 in mRNP complexes on the cap affinity column is dependent on RNA, as previously observed for the mammalian PABPN1 proteins in association with the CBP80- containing nuclear cap complexes (Ishigaki et al., 2001). The absence of a p32 signal for the RNase A treated extracts is not due to a fortuitous degradation of these proteins as similar amounts were recovered when these samples were incubated with poly(A) beads (right panel, lanes 4 and 5). In the experimental conditions used the poly(A) affinity ligand was not degraded by the RNase A added to the extract. These results imply that p32 does not partake in translation initiation reactions in contrast to ePAB that is associated with eIF4F via RNA-independent protein-protein interactions. Furthermore, they show that the previously demonstrated binding of p32 to the poly(A) column was not due to a fortuitous RNA bridge between these proteins and the poly(A) ligand. Indeed, in this case p32 would not have been retained on the poly(A) column after RNase A treatment (Fig. 4 lane 4). 2.4. p32 is only expressed during oogenesis and early embryogenesis
Fig. 5. Expression pattern of p32 during oogenesis and embryogenesis. Western blots using anti p32 antibodies of protein extracts from oocytes and embryos. A - Cell extracts prepared from Xenopus oocytes at different stages as indicated. B - Stage VI oocytes manually dissected into Germinal Vesicles (GV) and enucleated oocytes (cytopl.) fractions. C - Extracts from embryos at different times after fertilisation. Anti tubulin (Tub.) and anti PCNA sera were used to control, respectively, sample load and the dissection.
panel, lane 2), indicating that this protein interacts directly with eIF4F complex. For extracts not treated with RNase A (top panel, lane 3), the ePAB binding to the cap affinity column is reduced. This behaviour has already been observed (Cosson et al., 2002b). The RNase A treatment, by degrading the endogenous RNAs and disrupting mRNP complexes, probably makes all the ePAB available for eIF4F binding leading to an increased signal. The opposite behaviour was observed for p32 (middle panel, lanes 2 and 3). When extracts not treated with RNase A were used, this protein bound to the cap affinity column; this binding was abolished by a
In order to study the temporal expression pattern of p32, a Western analysis of oocyte and embryo extracts was performed. The maternal p32 was present throughout oogenesis (Fig. 5A). The Western signal for this protein (per oocyte) increased between stage I and II and then remained constant as oocytes grew to stage VI. To determine the nuclear/ cytoplasmic localisation of p32 in oocytes, germinal vesicles and enucleated oocytes were prepared. Western analysis (Fig. 5B) of these fractions showed that p32 is exclusively cytoplasmic in the fullygrown oocyte. The quality of the germinal vesicle and the enucleated oocyte preparations were controlled with antibodies to the nuclear protein PCNA. Early embryos also contained p32 (Fig. 5C). The amount of this protein remained approximately constant up to 5 days of development (tadpoles). In older embryos the amount of p32 decreased and was almost totally absent at 15 days of development. In addition, this protein was absent from several adult tissues: lung, heart, nerve and brain (data not shown). 2.5. p32 is the founding member of a novel family of poly(A) binding proteins The above results establish that p32 has the properties of a poly(A) binding protein. However our previous sequence comparisons showed only a moderate degree of conservation with the known nuclear proteins and even less with the cytoplasmic PABPs (see Fig. 1B). Therefore the derived protein sequence was compared to know genomic and EST sequences using a combination of BLAST and CLUSTALW analyses. On the deduced phylogenetic tree (Fig. 6A) the p32 sequence is nearest to a group of sequences that include mice, rat and human members. These mammalian ESTs were only
524
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527
Fig. 6. p32 is the founder member of a novel family of poly(A) binding proteins –ePABP2. A - Phylogenetic tree deduced from sequence analysis using ClustalW (http://www.ebi.ac.uk/clustalw) of PABPN1 proteins and sequences related to p32 (p32/ePABP2, accession number AAO33927) from human (hePABP2, XP_372648), mouse (mePABP2, XP_356111) and rat (rePABP2, XP_226547). B - Alignment of the ePABP2 proteins from various species. Sequences of the peptides derived from XePABP2 eluted from the poly(A) column are boxed. Amino acids 95- 169 corresponding to the RRM consensus sequence are underlined. The sequences are numbered individually on the right.
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527
present in embryo cDNA libraries except for one cancerous tissue. Therefore, as expression of p32 is restricted to oocytes and early embryos we have named this protein XePABP2 and we propose that it is a founder member of a new family of poly(A) binding protein (ePABP2) that also contains the proteins encoded by the mammalian ESTs. As a group these sequences are structurally most similar to those of the PABPN1 family in as much as they have a single RNA recognition motif (RRM) in the C-terminal half of the protein (Burd and Dreyfuss, 1994). They are clearly structurally distinct from the cytoplasmic PABPs (PABPC) (see Mangus et al., 2003). The PABPN1 group of proteins is highly conserved. In mammals the amino acid sequences are at least 98% identical and the Xenopus PABPN1 is about 70% identical to the mammalian proteins (see Fig. 1B). This sequence conservation of the PABPN1 proteins is spread through-out the protein and is not restricted to a specific domain. In contrast to this high conservation of the PABPN1 proteins the sequences of the ePABP2 protein group are more divergent (Fig. 6B). Over the whole sequence the mouse and rat proteins are 82% identical but these two proteins are only about 47% identical to the human protein and about 42% of the amino acids are conserved in Xenopus laevis. In fact, the conserved sequences are part of the RRM; outside of this domain there is almost no sequence conservation (see Fig. 6B). 3. Discussion In this report we have used affinity chromatography to isolate maternal Xenopus proteins that can bind to poly(A) tracts. Two proteins were identified: XCirp2, that is already known to be implicated in the control of mRNA stability (Aoki et al., 2003) and XePABP2/p32, that is about 50% identical to XPABPN1(Kim et al., 2001). XCirp2 has been shown to associate with ElrA in binding to AU-rich sequences (Aoki et al., 2003). At present we do not have an explanation for the retention of this protein on the poly(A) affinity columns. In contrast, the analyses performed using recombinant XePABP2 showed that this protein is a bona fide poly(A) binding protein. Although XPABPN1 is expressed throughout early embryogenesis (Kim et al., 2001) it was not a major constitutant in poly(A) eluates. This means that free XPABPN1 is under represented when compared to the other poly(A) binding proteins. The cytoplasmic poly(A) binding proteins (PABP1 and ePAB) were present in these eluants. Sequence analysis showed that XePABP2 has the greatest similarity to a group sequences encoding putative proteins of as yet unknown function. We propose that this group of proteins constitute a novel family of poly(A) binding proteins denoted as ePABP2. In Xenopus the expression of XePABP2 decreases seven days post fertilization and was not detected in adult tissues. Therefore, the XePABP2 present in early embryos is prob-
525
ably either of maternal origin, inherited from the oocyte, or translated from a maternal mRNA. The ESTs corresponding to the mammalian ePABP2 proteins were only found in embryo libraries except for one cancerous tissue. This suggests that in normal tissues the expression of this family of poly(A) binding proteins may be restricted to embryonic cells. During the revision of this article similar results were published by Good et al (2004) in which they identified ePABP2 by database searching. As mentioned earlier the sequence they retrieved was 95% identical to that described here, suggesting that these two cDNAs correspond to two alleles of the gene, both of which are expressed in Xenopus oocytes. The expression pattern for both alleles is identical, although Good et al. (2004) did not observe the decreased protein expression after 5 days due to the more restricted period of embryogenesis that they studied. Complementary to the binding assays that are reported here Good et al.,(2004) performed gel-shift assays with the recombinant protein. They observed that the complex formed between XePABP2 and 32P-labelled poly(A) decreased in the presence of unlabelled (competing) poly(A) but was unaffected by the presence of competing poly(C). The complementary nature of the results presented here and those published by Good et al. (2004) firmly establish that the 32kDa protein we isolated from Xenopus embryo extracts is a poly(A) binding protein. The identification of a novel poly(A) binding protein (XePABP2), raises the question of what its function may be. Nuclear PABPs are involved in pre-mRNA processing (Wahle, 1991). In fully grown oocytes XePABP2 is exclusively cytoplasmic which would appear to be incompatible with a role of this protein in pre-mRNA processing. However, in freshly lain Drosophila embryos, PABPN1 is also specifically cytoplasmic and then progressively concentrates in nuclei during the preblastoderm and syncitial blastoderm stages that precede the onset of zygotic transcription (Benoit et al., 1999). Therefore, one could hypothesis that a similar cytoplasm to nuclear transfer may also exist for XePABP2. However, no known nuclear localisation signals were detected in the sequence of XePABP2 and related sequences when scanned against the Prosite database of protein motifs. Also there is no significant homology of ePABP2 with the C terminal domain of human PABPN1 (aa 256-306) that localize to the nucleus when fused to GFP (Calado et al., 2000). An alternative hypothesis is that XePABP2 plays a role in the cytoplasm. One possible function would be in the control of cytoplasmic polyadenylation of maternal mRNAs. Specific cytoplasmic isoforms of PAP (Ballantyne et al., 1995; Gebauer and Richter, 1995) and CPSF complex (that lack the 73 kDa subunit (Zhao et al., 1999)), have been described. More recently, and most pertinent to the present report, genes that encode specific cytoplasmic poly(A) polymerases have been identified in yeast, c.elegans, mice and humans (Read et al., 2002; Saitoh et al., 2002; Wang et al., 2002; Kwak et al., 2004). These cytoplasmic poly(A) polymerases in combination with ePABP2 may reconstitute, in vivo, a functional and
526
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527
processive polyadenyation complex. CPEB (Hake and Richter, 1994) may be active in the recruitment of these factors ensuring the polyadenylation of CPE-containing maternal mRNAs. XePABP2 is not able to interact with the capbinding complex and hence probably does not stimulate translation at least at the initiation step. Therefore, if XePABP2 is required for the processive cytoplasmic polyadenylation it would be replaced by PABP1 to allow the initiation of translation, as occurs during the transport into the cytoplasm transport of nuclear 3′ end processed mRNA. 4. Materials and Methods 4.1. Poly(A) affınity chromatography and peptide sequencing for the identification of poly(A) binding proteins Poly(A) beads were prepared by overnight incubation of poly(A) RNA with CNBr activated beads (Amersham Pharmacia Biotech) in 100 mM NaHPO4 pH 7. Beads were washed in water and incubated for two hours in 0.2 M Tris pH 8. Beads were then rinsed in XB buffer (Hepes-KOH 10 mM pH 7.7; KCl 100 mM; CaCl2 0.1mM; MgCl2 1mM) and incubated for 1.5 hours at 4°C with unfertilized eggs extract prepared as described previously (Murray and Kirschner, 1989). The incubated beads were washed extensively with XB buffer containing 0.5 mM DTT, 2 µg/ml tRNA, 0.1% NP40 and 10 µg/ml of heparin (Sigma). Nuclease treatment was then performed by incubating the beads with micrococcal nuclease in XB buffer for two hours at 4°C. A fraction of the eluate was loaded on a 15% SDS-PAGE gel and after electrophoresis the proteins revealed by Coomassie Blue staining or by western blotting. The remainder of the eluted proteins were concentrated using the Centricon system and separated by electrophoresis on a 15% SDS-PAGE. After staining with Amido-black, the acrylamide blocks containing p32, p20 or p18 were cut out and the proteins eluted. Trypsin digestion, peptide purification and sequencing were performed by the protein sequencing service at the Institut Pasteur (Paris, France).
that were used to obtain radiolabelled recombinant proteins in rabbit reticulocyte lysate system (Promega). Recombinant PABP1, ePAB and EDEN-BP were obtained as previously described (Cosson et al., 2002b, Paillard et al., 1998). Extracts from oocytes or unfertilized eggs were prepared as previously described (Murray and Kirschner, 1989) and incubated with 0.2 mg/ml of RNase A or 0.8 units/µl of RNAsin (Promega) for three hours at 4°C, to obtain RNase treated and untreated extracts, respectively. Poly(A) and 7mGTP chromatography was carried out accordingly to Cosson et al. (2002b). In the binding assays competitor RNA was added, when required, to the recombinant proteins before incubation with the poly(A) beads. The molar excess competitor RNA, relative to the amount of poly(A) ligand, was calculated from the manufacture’s (Sigma) specifications for the poly(A) beads. Autoradiography was performed using the gel imaging system Storm (Amersham Pharmacia Biotech). Western blot analyses were done using alkaline phosphatase conjugated second antibody with a chemifluorescent detection system (ECF, Amersham Pharmacia Biotech). 4.4. Antibodies To obtain recombinant protein for immunisation a 157 amino acid fragment of p32 was cloned in the PQE vector (Qiagen) using the following PCR primers: BglII 5’ GAAGATCTGCCATCAGAATGCGAGAAATGG and PstI 3’ TTCTGCAGCGGCGGCATCTACAGAGTTCC. The PCR fragment was digested with BglII and PstI and cloned into the PQE30 vector previously digested with BamHI and PstI. PQE-p32 was transformed in bacteria to produce His tagged recombinant proteins that were purified by affinity chromatography (Talon system, Clontech) and used for rabbit immunisation. Anti-PABP1 C4 serum developed in rabbit against amino acids 315-499 of Xenopus PABP1, rabbit polyclonal sera 773 (against PABP1), 869 (against ePAB) and anti eIF4E were described previously (Cosson et al., 2002b). Anti tubulin and anti PCNA antibodies were obtained from Sigma.
4.2. Cloning of p32 The total sequence of p32 (accession number Genbank AY221506) was obtained by a combination of in silico analyses, and 5′ and 3′ RACE (Clontech). PolyA+ RNAs from Xenopus laevis ovaries were retrotranscribed using 6 U/µl of MMLV (Gibco) and 50 ng/µl of oligo dT. PCR was then performed using oligos 140 (5’CGGGATCCGCATGTCTGAGAGAGTTTCAGAAGAAC) and 141 (5’GGACTAGTAGTCAGTATGGGTGATTCAAAGGGCC). The SpeI PCR-generated fragment containing the entire p32 open reading frame was inserted in the SpeI site of pT7TS vector (Cleaver et al., 1996) and sequenced. 4.3. Analytical protein procedures PT7TS-p32 linearized by EcoRI was transcribed with the Riboprobe system (Promega) in order to produce mRNAs
Acknowledgements This work was supported by the Centre National de la Recherche Scientifique and by Research Grants from the European Union (contract QLK3-CT- 2000-00721), the Association pour la Recherche sur le Cancer (ARC no. 9529 and no. 4791), the Region Bretagne (PRIR A3CBN2). B.C. was supported by a grant from the Region Bretagne (PRIR A2CAL1) and a technology transfer contract with the CNRS and Rennes Metropole/CNRS during part of this work. References Amrani, N., Minet, M., Le Gouar, M., Lacroute, F., Wyers, F., 1997. Yeast Pab1 interacts with Rna15 and participates in the control of the poly(A) tail length in vitro. Mol. Cell. Biol 17, 3694–3701.
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527 Aoki, K., Matsumoto, K., Tsujimoto, M., 2003. Xenopus cold-inducible RNA-binding protein 2 interacts with ElrA, the Xenopus homolog of HuR, and inhibits deadenylation of specific mRNAs. J Biol Chem 278, 48491–48497. Ballantyne, S., Bilger, A., Astrom, J., Virtanen, A., Wickens, M., 1995. Poly (A) polymerases in the nucleus and cytoplasm of frog oocytes: dynamic changes during oocyte maturation and early development. RNA 1, 64–78. Benoit, B., Nemeth, A., Aulner, N., Kuhn, U., Simonelig, M., Wahle, E., Bourbon, H.M., 1999. The Drosophila poly(A)-binding protein II is ubiquitous throughout Drosophila development and has the same function in mRNA polyadenylation as its bovine homolog in vitro. Nucleic Acids Res 27, 3771–3778. Bienroth, S., Keller, W., Wahle, E., 1993. Assembly of a processive messenger RNA polyadenylation complex. EMBO J 12, 585–594. Blackshear, P.J., Lai, W.S., Thorn, J.M., Kennington, E.A., Staffa, N.G., Moore, D.T., Bouffard, G.G., Beckstrom-Sternberg, S.M., Touchman, J.W., Bonaldo, M.F., et al., 2001. The NIEHS Xenopus maternal EST project: interim analysis of the first 13,879 ESTs from unfertilized eggs. Gene 267, 71–87. Blobel, G., 1973. A protein of molecular weight 78,000 bound to the polyadenylate region of eukaryotic messenger RNAs. Proc Natl Acad Sci U S A. 70, 924–928. Burd, C.G., Dreyfuss, G., 1994. Conserved structures and diversity of functions of RNA-binding proteins. Science 265, 615–621. Calado, A., Kutay, U., Kuhn, U., Wahle, E., Carmo-Fonseca, M., 2000. Deciphering the cellular pathway for transport of poly(A)-binding protein II. RNA 6, 245–256. Cao, Q., Richter, J.D., 2002. Dissolution of the maskin-eIF4E complex by cytoplasmic polyadenylation and poly(A)-binding protein controls cyclin B1 mRNA translation and oocyte maturation. EMBO J 21, 3852– 3862. Cleaver, O.B., Patterson, K.D., Krieg, P.A., 1996. Overexpression of the tinman-related genes XNkx-2.5 and XNkx-2.3 in Xenopus embryos results in myocardial hyperplasia. Development 122, 3549–3556. Cosson, B., Berkova, N., Couturier, A., Chabelskaya, S., Philippe, M., Zhouravleva, G., 2002a. Poly(A)-binding protein and eRF3 are associated in vivo in human and Xenopus cells. Biol Cell 94, 205–216. Cosson, B., Couturier, A., Guellec, R.L., Moreau, J., Chabelskaya, S., Zhouravleva, G., Philippe, M., 2002b. Characterization of the poly(A) binding protein expressed during oogenesis and early development of Xenopus laevis. Biol Cell 94, 217–231. Feral, C., Guellaen, G., Pawlak, A., 2001. Human testis expresses a specific poly(A)-binding protein. Nucleic Acids Res 29, 1872–1883. Fox, C.A., Sheets, M.D., Wickens, M., 1989. Poly(A) addition during maturation of frog oocytes: Distinct nuclear and cytoplasmic activities and regulation by the sequence UUUUUAU. Genes Dev 3, 2151–2162. Gebauer, F., Richter, J.D., 1995. Cloning and characterization of a Xenopus poly(A) polymerase. Mol. Cell. Biol. 15, 1422–1430. Good, P.J., Abler, L., Herring, D., Sheets, M.D., 2004. Xenopus embryonic poly(A) binding protein 2 (ePABP2) defines a new family of cytoplasmic poly(A) binding proteins expressed during the early stages of vertebrate development. Genesis 38, 166–175. Hake, L.E., Richter, J.D., 1994. CPEB is a specificity factor that mediates cytoplasmic polyadenylation during Xenopus oocyte maturation. Cell 79, 617–627. Hector, R.E., Nykamp, K.R., Dheur, S., Anderson, J.T., Non, P.J., Urbinati, C.R., Wilson, S.M., Minvielle-Sebastia, L., Swanson, M.S., 2002. Dual requirement for yeast hnRNP Nab2p in mRNA poly(A) tail length control and nuclear export. EMBO J 21, 1800–1810. Imataka, H., Gradi, A., Sonenberg, N., 1998. A newly identified N-terminal amino acid sequence of human eIF4G binds poly(A)-binding protein and functions in poly(A)-dependent translation. EMBO J 17, 7480–7489. Ishigaki, Y., Li, X., Serin, G., Maquat, L.E., 2001. Evidence for a pioneer round of mRNA translation: mRNAs subject to nonsense-mediated decay in mammalian cells are bound by CBP80 and CBP20. Cell 106, 607–617.
527
Kim, J., Choi, S.C., Chang, J.Y., Han, J.K., 2001. Poly(A) binding protein II in Xenopus laevis is expressed in developing brain and pancreas. Mech Dev 109, 111–114. Kwak, J.-E., Wang, L., Ballantyne, S., Kimble, J., Wickens, M., 2004. Mammalian-GLD-2 homologogs are poly(A) polymerases. Proc Natl Acad Sci USA 101, 4407–4412. Mangus, D.A., Evans, M.C., Jacobson, A., 2003. Poly(A)-binding proteins: multifunctional scaffolds for the post-transcriptional control of gene expression. Genome Biol 4, 223. Matsumoto, K., Aoki, K., Dohmae, N., Takio, K., Tsujimoto, M., 2000. CIRP2, a major cytoplasmic RNA-binding protein in Xenopus oocytes. Nucleic Acids Res 28, 4689–4697. Minvielle-Sebastia, L., Preker, P.J., Wiederkehr, T., Strahm, Y., Keller, W., 1997. The major yeast poly(A)-binding protein is associated with clevage factor IA and functions in premessenger RNA 3’-end formation. Proc. Natl. Acad. Sci. U. S. A. 94, 7897–7902. Murray, A.W., Kirschner, M.W., 1989. Cyclin synthesis drives the early embryonic cell cycle. Nature (Lond) 339, 275–280. Paillard, L., Osborne, H.B., 2003. East of EDEN was a poly(A) tail. Biol Cell 95, 211–219. Paillard, L., Omilli, F., Legagneux, V., Bassez, T., Maniey, D., Osborne, H.B., 1998. EDEN and EDEN-BP, a cis element and an associated factor that mediate sequence-specific mRNA deadenylation in Xenopus embryos. EMBO J 17, 278–287. Read, R.L., Martinho, R.G., Wang, S.W., Carr, A.M., Norbury, C.J., 2002. Cytoplasmic poly(A) polymerases mediate cellular responses to S phase arrest. Proc. Natl. Acad. Sci. U.S.A. 99, 12079–12084. Richter, J.D., 1999. Cytoplasmic polyadenylation in development and beyond. Microbiol Mol Biol Rev 63, 446–456. Saitoh, S., Chabes, A., McDonald, W.H., Thelander, L., Yates, J.R., Russell, P., 2002. Cid13 is a cytoplasmic poly(A) polymerase that regulates ribonucleotide reductase mRNA. Cell 109, 563–573. Si, K., Giustetto, M., Etkin, A., Hsu, R., Janisiewicz, A.M., Miniaci, M.C., Kim, J.H., Zhu, H., Kandel, E.R., 2003. A neuronal isoform of CPEB regulates local protein synthesis and stabilizes synapse-specific longterm facilitation in aplysia. Cell 115, 893–904. Tarun Jr, S.Z., Sachs, A.B., 1996. Association of the yeast poly(A) tail binding protein with translation initiation factor eIF-4G. EMBO. J. 15, 7169–7177. Voeltz, G., Ongkasuwan, J., Standart, N., Steitz, J., 2001. A novel embryonic poly(A) binding protein, ePAB, regulates mRNA deadenylation in Xenopus egg extracts. Genes Dev 15, 774–788. Wahle, E., 1991. A novel poly(A)-binding protein acts as a specificity factor in the second phase of messenger RNA polyadenylation. Cell 66, 759– 768. Wahle, E., 1995. Poly(A) tail length control is caused by termination of processive synthesis. J. Biol. Chem 270, 2800–2808. Wang, L., Eckmann, C.R., Kadyk, L.C., Wickens, M., Kimble, J., 2002. A regulatory cytoplasmic poly(A) polymerase in Caenorhabditis elegans. Nature 419, 312–316. Wilusz, C.J., Wormington, M., Peltz, S.W., 2001. The cap-to-tail guide to mRNA turnover. Nat Rev Mol Cell Biol 2, 237–246. Winstall, E., Sadowski, M., Kuhn, U., Wahle, E., Sachs, A.B., 2000. The Saccharomyces cerevisiae RNA-binding protein Rbp29 functions in cytoplasmic mRNA metabolism. J Biol Chem 275, 21817–21826. Wu, L., Wells, D., Tay, J., Mendis, D., Abbott, M., Barnitt, A., Quinlan, E., Heynen, A., Fallon, J., Richter, J., 1998. CPEB-mediated cytoplasmic polyadenylation and the regulation of experience-dependent translation of alpha-CaMKII mRNA at synapses. Neuron 5, 1129–1139. Yang, H., Duckett, C.S., Lindsten, T., 1995. iPABP, an inductible poly(A)binding protein detected in activated human T cells. Mol. Cell. Biol. 15, 6770–6776. Zhao, J., Hyman, L., Moore, C., 1999. Formation of mRNA 3’ ends in eukaryotes: mechanism, regulation, and interrelationships with other steps in mRNA synthesis. Microbiol Mol Biol Rev 63, 405–445.
Identification of a novel Xenopus laevis poly (A) binding protein Bertrand Cosson a,*, Frederique Braun a,1, Luc Paillard a, Perry Blackshear b,c, H. Beverley Osborne a a
UMR6061 CNRS – Génétique et Développement, Université de Rennes 1, Faculté de Médecine, 2 avenue Professeur Leon Bernard, CS 34317, 35043 Rennes cedex, France. b Laboratory of Signal Transduction and the Offıce of Clinical Research, National Institute of Environmental Health Sciences, NIH, DHHS, Research Triangle Park, NC 27709; USA c Departments of Medicine and Biochemistry, Duke University Medical Center, Durham, NC 27710, USA Received 2 April 2004; accepted 29 April 2004 Available online 02 June 2004
Abstract Poly (A) binding proteins are intimately implicated in controlling a number of events in mRNA metabolism from nuclear polyadenylation to cytoplasmic translation and stability. The known poly(A) binding proteins can be divided into three distinct structural groups (prototypes PABP1, PABPN1/PABP2 and Nab2p) and two functional families, showing that similar functions can be accomplished by differing structural units. This has prompted us to perform a screen for novel poly(A) binding proteins using Xenopus laevis. A novel poly(A) binding protein of 32 kDa (p32) was identified. Sequence analysis showed that p32 has about 50% identity to the known nuclear poly(A) binding proteins (PABPN1) but is more closely related to a group of mammalian proteins of unknown function. The expression of Xenopus laevis ePABP2 is restricted to early embryos. Accordingly, we propose that p32 is the founder member of a novel class of poly(A) binding proteins named ePABP2. © 2004 Elsevier SAS. All rights reserved. Keywords: ePABP2; Cytoplasmic protein; Oocytes; Embryos
1. Introduction With the exception of mRNAs encoding histones, mRNAs in eukaryotic cells terminate with a track of polyadenosines that are added post-transcriptionally during the maturation of the primary transcript in the nucleus. It has been known for a number of years that this poly(A) tail confers stability on a mRNA and increases translation efficiency (Richter, 1999; Wilusz et al., 2001). Several proteins, either nuclear or cytoplasmic, have been identified and cloned that specifically interact with poly(A) tracts. In mammals, a specific poly(A) binding protein (PABPN1 or PABP2) was shown to play a role in pre-mRNA processing (Wahle, 1991). This protein will be referred to as * Corresponding author: Tel : 33 (0) 223 23 46 90, Fax : 33 (0) 223 23 44 78. E-mail address: [email protected] (B. Cosson). 1 Present adress, FRE 2230 Biocatalyse, 2, rue de la Houssinière, BP92208, 44322 Nantes Cedex 3, France. © 2004 Elsevier SAS. All rights reserved. doi:10.1016/j.biolcel.2004.04.006
PABPN1 as suggested by Mangus et al (2003). Nuclear 3′ end processing of cellular pre-mRNAs occurs in two steps that are coupled. Endonucleolytic cleavage is followed by addition of poly(A) to the upstream cleavage product. Poly(A) polymerase (PAP) catalyses the addition of a short (around 10 nucleotides) poly(A) sequence. This nascent poly(A) tail is a binding site for PABPN1 and the functional interaction between PABPN1 and PAP is required for the subsequent processive elongation of the poly(A) tail and control of its length (Bienroth et al., 1993; Wahle, 1995). In the cytoplasm, a family of closely related poly(A) binding proteins have been implicated to different degrees in the control of mRNA translation and stability (Wilusz et al., 2001). The founder member of this family is the 70 kDa poly(A) binding protein 1 (PABP1) that was first isolated by Blobel (1973). In the amphibian Xenopus laevis an embryonic poly(A) binding protein (ePAB) was recently described (Cosson et al., 2002b; Voeltz et al., 2001). An inducible poly(A) binding protein has been characterised in human cells (Yang et al., 1995) and a testis specific transcript has
520
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527
been characterised in humans (Feral et al., 2001). These proteins are structurally related to PABP1 but are encoded by distinct genes. The distinction between a PABPN1-mediated nuclear polyadenylation and the PABP1-mediated cytoplasmic events may not be as clear-cut as it would appear at first. For instance, frog oocytes contain sequence specific polyadenylation activities in both their nucleus and cytoplasm (Fox et al., 1989). Cytoplasmic polyadenylation first occurs during oocyte maturation and can proceed even in enucleated oocytes (Fox et al., 1989). Evidence that cytoplasmic polyadenylation also occurs in nerve cells has also been reported (Wu et al., 1998; Si et al., 2003). In addition, in yeast Rbp29 was identified as a sequence homologue of the mammalian nuclear poly(A) binding proteins (PABPN1) but was not found to play any role in nuclear polyadenylation (Winstall et al., 2000). In vitro studies suggested that the yeast 70 kDa PABP1 was responsible for controlling poly(A) tail length in both the nucleus and the cytoplasm (Amrani et al., 1997; Minvielle-Sebastia et al., 1997). However this dual role for the yeast PABP1 has been recently questioned by the demonstration that the protein Nab2p, that is unrelated to the mammalian nuclear poly(A) binding protein, is required for nuclear poly(A) tail length control in vivo (Hector et al., 2002). The known RNA binding proteins that show a specificity for poly(A) can be subdivided into three structurally distinct groups: PABP1, PABPN1 and Nab2p. However, other poly(A) binding proteins may exist whose sequences are unrelated to these three groups of known poly(A) binding proteins. The identification of such novel proteins would probably be instructive in deciphering the various mechanisms that control poly(A) metabolism. As an initial step to identify bona fide poly(A) binding proteins that may not be structurally related to PABP1 and PABPN1 we have used poly(A) RNA affinity chromatography. We describe here the characterisation of a novel Xenopus RNA-binding protein that displays a specificity for poly(A). The expression of this protein is restricted to early embryos. Sequence analysis identified several closely related mammalian proteins with unknown function. Due to the expression pattern and the cytoplasmic location of the Xenopus protein, we propose that these proteins constitute a new family of poly(A) binding proteins named as ePABP2. 2. Results 2.1. Identification of poly(A) binding proteins in Xenopus egg extracts To identify the poly(A) binding proteins in Xenopus egg extracts a RNA-affinity chromatography protocol was used to isolate detectable amounts of these proteins. The proteins eluted from the column by a micrococal nuclease treatment were separated by SDS-PAGE and revealed by Coomassie blue staining (Fig. 1A, lanes 1 and 2). Four major bands at 70,
Fig. 1. Identification of new poly(A) binding proteins. A - Unfertilized egg extracts were chromatographed on a poly(A) column. Proteins eluted after micrococcal nuclease treatment were analysed by SDS-PAGE followed by Coomassie staining (lane 2). Poly(A) column eluate (lane 4) was analysed by western blotting using anti-PABP1 C4 serum in parallel with cell extract prepared from stage 31/32 embryos (lane 3). Lane 1 show molecular weight markers stained with Coomassie blue. B - Comparison of amino acid sequence homology, indicated as a percentage, between p32 and known poly(A) binding proteins.
32, 20 and 18 kDa were reproducibly observed. Sequence data obtained from the excised bands showed that p18 corresponded to the micrococcal nuclease used to elute the column (data not shown). Western analysis using an anti PABP1 antibody (Fig. 1A, lanes 3 and 4) detected a strongly immuno-reactive 70 kDa protein in the eluant from the poly(A) column. The anti-PABP1 antibodies used in this experiment was subsequently found to cross reacts with ePAB (Cosson et al., 2002b) and in some experiments the 70 kDa band migrated as a doublet. We assumed therefore that the 70 kDa band is composed of PABP1 and ePAB. To identify the other proteins eluted from the poly(A) column peptide sequence data were obtained from the material excised from the SDS-polyacrylamide gel at the positions of p32 and p20. The sequences of three peptides were obtained for p20 (LFIGGLNFDTNEESL; YGQISEVVVVK; GFGFVTFENPDDAKD). All of these corresponded exactly to the Xcirp-2 (Xenopus Cold-Inducible Ribonucleic Protein 2) protein sequence (Matsumoto et al., 2000). The sequence of the four peptides derived from p32 did not show any clearly significant sequence homology to known proteins. Therefore to further study the 32 kDa protein, the peptide sequences were back-translated and the derived oligonucleotides were used to clone cDNAs by a combination of RT-PCR and 5′ RACE. Comparison of the sequence data obtained from these partial cDNAs with that produced by the NIH Xenopus EST project (Blackshear et al., 2001) allowed in silico cloning of the proximal part of the
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527
3’UTR and the C-terminal extremity of the open reading frame (ORF). The complete ORF was subsequently cloned by RT-PCR using specific primers and sequenced. The cDNA sequence (accession number AY221506) contains an open reading frame of 218 amino acids in which all the identified peptides are present (see Fig. 6). When initially submitted (Feb. 1 2003) this protein was named PABPN2/ePABP2. As will become apparent during the description of the results presented in this article, the second name is more appropriate. During the preparation of this manuscript, a sequence was submitted by Good at al. (accession number AAR26263) that is 95% identical to the p32 sequence. These two sequences probably correspond to two alleles, both of which are expressed. This is a case often encountered with Xenopus laevis whose genome is tetraploide. Comparison of the p32 sequence with that of known poly(A) binding proteins (see Fig. 1B) showed that this protein has the highest sequence conservation (about 50%) with proteins of the PABPN1 family. The conservation between p32 and cytoplasmic PABPs was only about 16%. The identity between Xenopus and mouse PABPN1 is 69% and a similar degree of identity is also found between the two Xenopus cytoplasmic PABPs (XPABP1 and ePAB). The identity between Xenopus PABN1 and p32 is only 49%. Therefore Xenopus PABPN1 is more closely related to its mouse orthologue than to p32. This suggests that p32 may belong to a novel family of poly(A) binding proteins. 2.2. p32 is a poly(A) binding protein The way in which XCirp2 and p32 were purified suggests that they may be poly(A) binding proteins. A series of experiments was therefore designed to test this hypothesis. For XCirp2 these experiments were inconclusive. Accordingly, a description of the binding properties of Xcirp2 to poly(A) requires additional experiments and will not be further discussed in this paper. First the p32 coding sequence was expressed in rabbit reticulocyte lysates and the recombinant protein was incubated with poly(A) or control RNA beads. As controls, similar analyses were performed with recombinant in vitro translated ePAB, PABP1 and GST-GFP. The results of these experiments are shown in Fig. 2. As expected the majority of the input ePAB and PABP1 were retained on the poly(A) beads (lane 2). A small amount of these proteins also bound to the control beads (lane 3), we interpret this as non-specific background binding. The recombinant p32, like the maternal protein, bound to the poly(A) beads but not to the control beads. The GST-GFP protein was not retained on either set of beads. Secondly, to confirm the specificity of p32 binding to the poly(A) ligand, competition experiments were performed. As a positive control a known poly(A) binding protein (PABP1) was used, and EDEN-BP that binds to U/purine rich sequences (Paillard and Osborne, 2003) constituted a negative control. The three recombinant proteins were synthetised
521
Fig. 2. Binding Properties of p32 Radiolabelled in vitro translated proteins, as indicated on the right of each panel, were incubated with poly(A) (lane 2) and control RNA (poly(C) (lane 3) beads. ePAB, PABP1 and GST-GFP were used as positive and negative controls. 1/5 of the input protein (lane 1) was loaded in parallel with the SDS-eluted proteins. After separation by SDS-PAGE the proteins were detected by autoradiography.
by in vitro translation in the presence of [35S]-methionine and then incubated with poly(A) beads. When required the recombinant protein was incubated with competing RNA prior to addition to the poly(A) beads. The data in Fig. 3A shows that, as expected, only PABP1 (lane 5) and p32 (lanes 6 and 7) were retained on the poly(A) beads. When the recombinant p32 was incubated with the competing poly(A) RNA at a 150-fold excess over the amount of poly(A) ligand bound to the beads the binding to the poly(A) beads was decreased by about 85% (see Fig. 3B). The presence of the other competing RNAs did not affect the p32 binding to the poly(A) beads: poly(C) (lanes 10 and 11), poly(G) (lanes 12 and 13) and tRNA (lanes 14 and 15). This was confirmed by quantification of the bound protein (Fig. 3B). In a separate set of experiments the competitor poly(A) was used at a 40-fold molar excess. In these conditions the binding of p32 to the poly(A) beads was inhibited by 60% (data not shown). It is formally possible that p32 (maternal or recombinant) is binding to the poly(A) beads via an interaction with ePAB or PABP1 respectively. ePAB is the major poly(A) binding protein in egg and embryo extracts (Cosson et al., 2002b) whereas PABP1 is abundant in reticulocyte lysates. To exclude this possibility recombinant 35S-labelled p32 was incubated with His tagged ePAB coupled to Ni affinity beads. No binding of p32 to the affinity matrix could be detected (data not shown) although in the conditions used eRF3 binding to ePAB could be detected (Cosson et al., 2002a).
522
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527
Fig. 3. p32 binds specifically to poly(A) A - Radiolabelled in vitro translated p32, EDEN-BP and PABP1 were incubated with poly(A) beads in the absence (lanes 4-7) or the presence of a 150-fold molar excess of RNA competitor poly(A) (lanes 8 and 9), poly(C) (lanes 10 and 11), poly(G) (lanes 12 and 13) or tRNA (lanes 14 and 15). Lanes 6 to 15 are duplicate analyses of p32 binding for each of the indicated condition. After eliminating the unbound proteins, bound proteins were eluted with SDS and analysed by SDS-PAGE and autoradiography. Lanes 1 to 3 corresponds to 1/5 of the indicated input proteins. B - The autoradiograms from two experiments (total of 5 samples) similar to that shown in (A) were quantified using a phosphoimager. The results represent the percentage of p32 retained on the poly(A) beads in the presence of each competitor RNA relative to the amount retained in the absence of competitor RNA.
Together, these results demonstrate that p32 has the properties of a poly(A) binding protein. 2.3. RNA dependence for cap affınity purified proteins The PABP1 protein, via an interaction with eIF4G, can be co-purified with the cap-binding protein eIF4E (Tarun et al., 1996; Imataka et al., 1998; Cao and Richter, 2002). This interaction of PABP1 with the cap affinity column does not require the presence of RNA. To test if p32 can also associate with the cap-binding complex eIF4F, a cap affinity (7mGTPSepharose) column was loaded with unfertilized eggs extracts pre-treated or not with RNase A and supplemented with GTP (0.2mM) as described previously (Cosson et al., 2002b). After extensive washing the proteins bound to the cap affinity column were eluted with SDS and subjected to Western analysis using anti eIF4E, anti-ePAB and anti p32 antibodies. The anti p32 antibody used (see Materials and Methods) detected a single protein of the expected size in the eluant from the poly(A) columns and in whole Xenopus embryo extracts (data not shown, see also Fig. 5). The results of these Western analyses are shown in Fig. 4. As expected equal amounts of eIF4E were recovered in eluates from
RNase A treated and untreated unfertilized egg extracts (bottom panel, lanes 2 and 3). As previously demonstrated (Cosson et al., 2002b), the ePAB present in RNase A treated extracts was also retained on the cap-affinity column (top
Fig. 4. p32 does not bind to Cap columns. RNase treated (+, lanes 2 and 4) or untreated (-, lanes 3 and 5) unfertilized egg extracts were incubated with cap affinity beads (lanes 2 and 3), or poly(A) beads (lanes 4 and 5) for protein stability control. Lane 1, input 1/5 of the cell extract before RNase treatment. After separation of the bound proteins by SDS-PAGE, Western blotting was performed using specific antibodies against ePAB, p32 and eIF4E as indicated. All the samples were analysed on the same gel, the lanes were rearranged for clarity.
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527
523
prior RNase A treatment of the extract. Hence, the retention of p32 in mRNP complexes on the cap affinity column is dependent on RNA, as previously observed for the mammalian PABPN1 proteins in association with the CBP80- containing nuclear cap complexes (Ishigaki et al., 2001). The absence of a p32 signal for the RNase A treated extracts is not due to a fortuitous degradation of these proteins as similar amounts were recovered when these samples were incubated with poly(A) beads (right panel, lanes 4 and 5). In the experimental conditions used the poly(A) affinity ligand was not degraded by the RNase A added to the extract. These results imply that p32 does not partake in translation initiation reactions in contrast to ePAB that is associated with eIF4F via RNA-independent protein-protein interactions. Furthermore, they show that the previously demonstrated binding of p32 to the poly(A) column was not due to a fortuitous RNA bridge between these proteins and the poly(A) ligand. Indeed, in this case p32 would not have been retained on the poly(A) column after RNase A treatment (Fig. 4 lane 4). 2.4. p32 is only expressed during oogenesis and early embryogenesis
Fig. 5. Expression pattern of p32 during oogenesis and embryogenesis. Western blots using anti p32 antibodies of protein extracts from oocytes and embryos. A - Cell extracts prepared from Xenopus oocytes at different stages as indicated. B - Stage VI oocytes manually dissected into Germinal Vesicles (GV) and enucleated oocytes (cytopl.) fractions. C - Extracts from embryos at different times after fertilisation. Anti tubulin (Tub.) and anti PCNA sera were used to control, respectively, sample load and the dissection.
panel, lane 2), indicating that this protein interacts directly with eIF4F complex. For extracts not treated with RNase A (top panel, lane 3), the ePAB binding to the cap affinity column is reduced. This behaviour has already been observed (Cosson et al., 2002b). The RNase A treatment, by degrading the endogenous RNAs and disrupting mRNP complexes, probably makes all the ePAB available for eIF4F binding leading to an increased signal. The opposite behaviour was observed for p32 (middle panel, lanes 2 and 3). When extracts not treated with RNase A were used, this protein bound to the cap affinity column; this binding was abolished by a
In order to study the temporal expression pattern of p32, a Western analysis of oocyte and embryo extracts was performed. The maternal p32 was present throughout oogenesis (Fig. 5A). The Western signal for this protein (per oocyte) increased between stage I and II and then remained constant as oocytes grew to stage VI. To determine the nuclear/ cytoplasmic localisation of p32 in oocytes, germinal vesicles and enucleated oocytes were prepared. Western analysis (Fig. 5B) of these fractions showed that p32 is exclusively cytoplasmic in the fullygrown oocyte. The quality of the germinal vesicle and the enucleated oocyte preparations were controlled with antibodies to the nuclear protein PCNA. Early embryos also contained p32 (Fig. 5C). The amount of this protein remained approximately constant up to 5 days of development (tadpoles). In older embryos the amount of p32 decreased and was almost totally absent at 15 days of development. In addition, this protein was absent from several adult tissues: lung, heart, nerve and brain (data not shown). 2.5. p32 is the founding member of a novel family of poly(A) binding proteins The above results establish that p32 has the properties of a poly(A) binding protein. However our previous sequence comparisons showed only a moderate degree of conservation with the known nuclear proteins and even less with the cytoplasmic PABPs (see Fig. 1B). Therefore the derived protein sequence was compared to know genomic and EST sequences using a combination of BLAST and CLUSTALW analyses. On the deduced phylogenetic tree (Fig. 6A) the p32 sequence is nearest to a group of sequences that include mice, rat and human members. These mammalian ESTs were only
524
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527
Fig. 6. p32 is the founder member of a novel family of poly(A) binding proteins –ePABP2. A - Phylogenetic tree deduced from sequence analysis using ClustalW (http://www.ebi.ac.uk/clustalw) of PABPN1 proteins and sequences related to p32 (p32/ePABP2, accession number AAO33927) from human (hePABP2, XP_372648), mouse (mePABP2, XP_356111) and rat (rePABP2, XP_226547). B - Alignment of the ePABP2 proteins from various species. Sequences of the peptides derived from XePABP2 eluted from the poly(A) column are boxed. Amino acids 95- 169 corresponding to the RRM consensus sequence are underlined. The sequences are numbered individually on the right.
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527
present in embryo cDNA libraries except for one cancerous tissue. Therefore, as expression of p32 is restricted to oocytes and early embryos we have named this protein XePABP2 and we propose that it is a founder member of a new family of poly(A) binding protein (ePABP2) that also contains the proteins encoded by the mammalian ESTs. As a group these sequences are structurally most similar to those of the PABPN1 family in as much as they have a single RNA recognition motif (RRM) in the C-terminal half of the protein (Burd and Dreyfuss, 1994). They are clearly structurally distinct from the cytoplasmic PABPs (PABPC) (see Mangus et al., 2003). The PABPN1 group of proteins is highly conserved. In mammals the amino acid sequences are at least 98% identical and the Xenopus PABPN1 is about 70% identical to the mammalian proteins (see Fig. 1B). This sequence conservation of the PABPN1 proteins is spread through-out the protein and is not restricted to a specific domain. In contrast to this high conservation of the PABPN1 proteins the sequences of the ePABP2 protein group are more divergent (Fig. 6B). Over the whole sequence the mouse and rat proteins are 82% identical but these two proteins are only about 47% identical to the human protein and about 42% of the amino acids are conserved in Xenopus laevis. In fact, the conserved sequences are part of the RRM; outside of this domain there is almost no sequence conservation (see Fig. 6B). 3. Discussion In this report we have used affinity chromatography to isolate maternal Xenopus proteins that can bind to poly(A) tracts. Two proteins were identified: XCirp2, that is already known to be implicated in the control of mRNA stability (Aoki et al., 2003) and XePABP2/p32, that is about 50% identical to XPABPN1(Kim et al., 2001). XCirp2 has been shown to associate with ElrA in binding to AU-rich sequences (Aoki et al., 2003). At present we do not have an explanation for the retention of this protein on the poly(A) affinity columns. In contrast, the analyses performed using recombinant XePABP2 showed that this protein is a bona fide poly(A) binding protein. Although XPABPN1 is expressed throughout early embryogenesis (Kim et al., 2001) it was not a major constitutant in poly(A) eluates. This means that free XPABPN1 is under represented when compared to the other poly(A) binding proteins. The cytoplasmic poly(A) binding proteins (PABP1 and ePAB) were present in these eluants. Sequence analysis showed that XePABP2 has the greatest similarity to a group sequences encoding putative proteins of as yet unknown function. We propose that this group of proteins constitute a novel family of poly(A) binding proteins denoted as ePABP2. In Xenopus the expression of XePABP2 decreases seven days post fertilization and was not detected in adult tissues. Therefore, the XePABP2 present in early embryos is prob-
525
ably either of maternal origin, inherited from the oocyte, or translated from a maternal mRNA. The ESTs corresponding to the mammalian ePABP2 proteins were only found in embryo libraries except for one cancerous tissue. This suggests that in normal tissues the expression of this family of poly(A) binding proteins may be restricted to embryonic cells. During the revision of this article similar results were published by Good et al (2004) in which they identified ePABP2 by database searching. As mentioned earlier the sequence they retrieved was 95% identical to that described here, suggesting that these two cDNAs correspond to two alleles of the gene, both of which are expressed in Xenopus oocytes. The expression pattern for both alleles is identical, although Good et al. (2004) did not observe the decreased protein expression after 5 days due to the more restricted period of embryogenesis that they studied. Complementary to the binding assays that are reported here Good et al.,(2004) performed gel-shift assays with the recombinant protein. They observed that the complex formed between XePABP2 and 32P-labelled poly(A) decreased in the presence of unlabelled (competing) poly(A) but was unaffected by the presence of competing poly(C). The complementary nature of the results presented here and those published by Good et al. (2004) firmly establish that the 32kDa protein we isolated from Xenopus embryo extracts is a poly(A) binding protein. The identification of a novel poly(A) binding protein (XePABP2), raises the question of what its function may be. Nuclear PABPs are involved in pre-mRNA processing (Wahle, 1991). In fully grown oocytes XePABP2 is exclusively cytoplasmic which would appear to be incompatible with a role of this protein in pre-mRNA processing. However, in freshly lain Drosophila embryos, PABPN1 is also specifically cytoplasmic and then progressively concentrates in nuclei during the preblastoderm and syncitial blastoderm stages that precede the onset of zygotic transcription (Benoit et al., 1999). Therefore, one could hypothesis that a similar cytoplasm to nuclear transfer may also exist for XePABP2. However, no known nuclear localisation signals were detected in the sequence of XePABP2 and related sequences when scanned against the Prosite database of protein motifs. Also there is no significant homology of ePABP2 with the C terminal domain of human PABPN1 (aa 256-306) that localize to the nucleus when fused to GFP (Calado et al., 2000). An alternative hypothesis is that XePABP2 plays a role in the cytoplasm. One possible function would be in the control of cytoplasmic polyadenylation of maternal mRNAs. Specific cytoplasmic isoforms of PAP (Ballantyne et al., 1995; Gebauer and Richter, 1995) and CPSF complex (that lack the 73 kDa subunit (Zhao et al., 1999)), have been described. More recently, and most pertinent to the present report, genes that encode specific cytoplasmic poly(A) polymerases have been identified in yeast, c.elegans, mice and humans (Read et al., 2002; Saitoh et al., 2002; Wang et al., 2002; Kwak et al., 2004). These cytoplasmic poly(A) polymerases in combination with ePABP2 may reconstitute, in vivo, a functional and
526
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527
processive polyadenyation complex. CPEB (Hake and Richter, 1994) may be active in the recruitment of these factors ensuring the polyadenylation of CPE-containing maternal mRNAs. XePABP2 is not able to interact with the capbinding complex and hence probably does not stimulate translation at least at the initiation step. Therefore, if XePABP2 is required for the processive cytoplasmic polyadenylation it would be replaced by PABP1 to allow the initiation of translation, as occurs during the transport into the cytoplasm transport of nuclear 3′ end processed mRNA. 4. Materials and Methods 4.1. Poly(A) affınity chromatography and peptide sequencing for the identification of poly(A) binding proteins Poly(A) beads were prepared by overnight incubation of poly(A) RNA with CNBr activated beads (Amersham Pharmacia Biotech) in 100 mM NaHPO4 pH 7. Beads were washed in water and incubated for two hours in 0.2 M Tris pH 8. Beads were then rinsed in XB buffer (Hepes-KOH 10 mM pH 7.7; KCl 100 mM; CaCl2 0.1mM; MgCl2 1mM) and incubated for 1.5 hours at 4°C with unfertilized eggs extract prepared as described previously (Murray and Kirschner, 1989). The incubated beads were washed extensively with XB buffer containing 0.5 mM DTT, 2 µg/ml tRNA, 0.1% NP40 and 10 µg/ml of heparin (Sigma). Nuclease treatment was then performed by incubating the beads with micrococcal nuclease in XB buffer for two hours at 4°C. A fraction of the eluate was loaded on a 15% SDS-PAGE gel and after electrophoresis the proteins revealed by Coomassie Blue staining or by western blotting. The remainder of the eluted proteins were concentrated using the Centricon system and separated by electrophoresis on a 15% SDS-PAGE. After staining with Amido-black, the acrylamide blocks containing p32, p20 or p18 were cut out and the proteins eluted. Trypsin digestion, peptide purification and sequencing were performed by the protein sequencing service at the Institut Pasteur (Paris, France).
that were used to obtain radiolabelled recombinant proteins in rabbit reticulocyte lysate system (Promega). Recombinant PABP1, ePAB and EDEN-BP were obtained as previously described (Cosson et al., 2002b, Paillard et al., 1998). Extracts from oocytes or unfertilized eggs were prepared as previously described (Murray and Kirschner, 1989) and incubated with 0.2 mg/ml of RNase A or 0.8 units/µl of RNAsin (Promega) for three hours at 4°C, to obtain RNase treated and untreated extracts, respectively. Poly(A) and 7mGTP chromatography was carried out accordingly to Cosson et al. (2002b). In the binding assays competitor RNA was added, when required, to the recombinant proteins before incubation with the poly(A) beads. The molar excess competitor RNA, relative to the amount of poly(A) ligand, was calculated from the manufacture’s (Sigma) specifications for the poly(A) beads. Autoradiography was performed using the gel imaging system Storm (Amersham Pharmacia Biotech). Western blot analyses were done using alkaline phosphatase conjugated second antibody with a chemifluorescent detection system (ECF, Amersham Pharmacia Biotech). 4.4. Antibodies To obtain recombinant protein for immunisation a 157 amino acid fragment of p32 was cloned in the PQE vector (Qiagen) using the following PCR primers: BglII 5’ GAAGATCTGCCATCAGAATGCGAGAAATGG and PstI 3’ TTCTGCAGCGGCGGCATCTACAGAGTTCC. The PCR fragment was digested with BglII and PstI and cloned into the PQE30 vector previously digested with BamHI and PstI. PQE-p32 was transformed in bacteria to produce His tagged recombinant proteins that were purified by affinity chromatography (Talon system, Clontech) and used for rabbit immunisation. Anti-PABP1 C4 serum developed in rabbit against amino acids 315-499 of Xenopus PABP1, rabbit polyclonal sera 773 (against PABP1), 869 (against ePAB) and anti eIF4E were described previously (Cosson et al., 2002b). Anti tubulin and anti PCNA antibodies were obtained from Sigma.
4.2. Cloning of p32 The total sequence of p32 (accession number Genbank AY221506) was obtained by a combination of in silico analyses, and 5′ and 3′ RACE (Clontech). PolyA+ RNAs from Xenopus laevis ovaries were retrotranscribed using 6 U/µl of MMLV (Gibco) and 50 ng/µl of oligo dT. PCR was then performed using oligos 140 (5’CGGGATCCGCATGTCTGAGAGAGTTTCAGAAGAAC) and 141 (5’GGACTAGTAGTCAGTATGGGTGATTCAAAGGGCC). The SpeI PCR-generated fragment containing the entire p32 open reading frame was inserted in the SpeI site of pT7TS vector (Cleaver et al., 1996) and sequenced. 4.3. Analytical protein procedures PT7TS-p32 linearized by EcoRI was transcribed with the Riboprobe system (Promega) in order to produce mRNAs
Acknowledgements This work was supported by the Centre National de la Recherche Scientifique and by Research Grants from the European Union (contract QLK3-CT- 2000-00721), the Association pour la Recherche sur le Cancer (ARC no. 9529 and no. 4791), the Region Bretagne (PRIR A3CBN2). B.C. was supported by a grant from the Region Bretagne (PRIR A2CAL1) and a technology transfer contract with the CNRS and Rennes Metropole/CNRS during part of this work. References Amrani, N., Minet, M., Le Gouar, M., Lacroute, F., Wyers, F., 1997. Yeast Pab1 interacts with Rna15 and participates in the control of the poly(A) tail length in vitro. Mol. Cell. Biol 17, 3694–3701.
B. Cosson et al. / Biology of the Cell 96 (2004) 519–527 Aoki, K., Matsumoto, K., Tsujimoto, M., 2003. Xenopus cold-inducible RNA-binding protein 2 interacts with ElrA, the Xenopus homolog of HuR, and inhibits deadenylation of specific mRNAs. J Biol Chem 278, 48491–48497. Ballantyne, S., Bilger, A., Astrom, J., Virtanen, A., Wickens, M., 1995. Poly (A) polymerases in the nucleus and cytoplasm of frog oocytes: dynamic changes during oocyte maturation and early development. RNA 1, 64–78. Benoit, B., Nemeth, A., Aulner, N., Kuhn, U., Simonelig, M., Wahle, E., Bourbon, H.M., 1999. The Drosophila poly(A)-binding protein II is ubiquitous throughout Drosophila development and has the same function in mRNA polyadenylation as its bovine homolog in vitro. Nucleic Acids Res 27, 3771–3778. Bienroth, S., Keller, W., Wahle, E., 1993. Assembly of a processive messenger RNA polyadenylation complex. EMBO J 12, 585–594. Blackshear, P.J., Lai, W.S., Thorn, J.M., Kennington, E.A., Staffa, N.G., Moore, D.T., Bouffard, G.G., Beckstrom-Sternberg, S.M., Touchman, J.W., Bonaldo, M.F., et al., 2001. The NIEHS Xenopus maternal EST project: interim analysis of the first 13,879 ESTs from unfertilized eggs. Gene 267, 71–87. Blobel, G., 1973. A protein of molecular weight 78,000 bound to the polyadenylate region of eukaryotic messenger RNAs. Proc Natl Acad Sci U S A. 70, 924–928. Burd, C.G., Dreyfuss, G., 1994. Conserved structures and diversity of functions of RNA-binding proteins. Science 265, 615–621. Calado, A., Kutay, U., Kuhn, U., Wahle, E., Carmo-Fonseca, M., 2000. Deciphering the cellular pathway for transport of poly(A)-binding protein II. RNA 6, 245–256. Cao, Q., Richter, J.D., 2002. Dissolution of the maskin-eIF4E complex by cytoplasmic polyadenylation and poly(A)-binding protein controls cyclin B1 mRNA translation and oocyte maturation. EMBO J 21, 3852– 3862. Cleaver, O.B., Patterson, K.D., Krieg, P.A., 1996. Overexpression of the tinman-related genes XNkx-2.5 and XNkx-2.3 in Xenopus embryos results in myocardial hyperplasia. Development 122, 3549–3556. Cosson, B., Berkova, N., Couturier, A., Chabelskaya, S., Philippe, M., Zhouravleva, G., 2002a. Poly(A)-binding protein and eRF3 are associated in vivo in human and Xenopus cells. Biol Cell 94, 205–216. Cosson, B., Couturier, A., Guellec, R.L., Moreau, J., Chabelskaya, S., Zhouravleva, G., Philippe, M., 2002b. Characterization of the poly(A) binding protein expressed during oogenesis and early development of Xenopus laevis. Biol Cell 94, 217–231. Feral, C., Guellaen, G., Pawlak, A., 2001. Human testis expresses a specific poly(A)-binding protein. Nucleic Acids Res 29, 1872–1883. Fox, C.A., Sheets, M.D., Wickens, M., 1989. Poly(A) addition during maturation of frog oocytes: Distinct nuclear and cytoplasmic activities and regulation by the sequence UUUUUAU. Genes Dev 3, 2151–2162. Gebauer, F., Richter, J.D., 1995. Cloning and characterization of a Xenopus poly(A) polymerase. Mol. Cell. Biol. 15, 1422–1430. Good, P.J., Abler, L., Herring, D., Sheets, M.D., 2004. Xenopus embryonic poly(A) binding protein 2 (ePABP2) defines a new family of cytoplasmic poly(A) binding proteins expressed during the early stages of vertebrate development. Genesis 38, 166–175. Hake, L.E., Richter, J.D., 1994. CPEB is a specificity factor that mediates cytoplasmic polyadenylation during Xenopus oocyte maturation. Cell 79, 617–627. Hector, R.E., Nykamp, K.R., Dheur, S., Anderson, J.T., Non, P.J., Urbinati, C.R., Wilson, S.M., Minvielle-Sebastia, L., Swanson, M.S., 2002. Dual requirement for yeast hnRNP Nab2p in mRNA poly(A) tail length control and nuclear export. EMBO J 21, 1800–1810. Imataka, H., Gradi, A., Sonenberg, N., 1998. A newly identified N-terminal amino acid sequence of human eIF4G binds poly(A)-binding protein and functions in poly(A)-dependent translation. EMBO J 17, 7480–7489. Ishigaki, Y., Li, X., Serin, G., Maquat, L.E., 2001. Evidence for a pioneer round of mRNA translation: mRNAs subject to nonsense-mediated decay in mammalian cells are bound by CBP80 and CBP20. Cell 106, 607–617.
527
Kim, J., Choi, S.C., Chang, J.Y., Han, J.K., 2001. Poly(A) binding protein II in Xenopus laevis is expressed in developing brain and pancreas. Mech Dev 109, 111–114. Kwak, J.-E., Wang, L., Ballantyne, S., Kimble, J., Wickens, M., 2004. Mammalian-GLD-2 homologogs are poly(A) polymerases. Proc Natl Acad Sci USA 101, 4407–4412. Mangus, D.A., Evans, M.C., Jacobson, A., 2003. Poly(A)-binding proteins: multifunctional scaffolds for the post-transcriptional control of gene expression. Genome Biol 4, 223. Matsumoto, K., Aoki, K., Dohmae, N., Takio, K., Tsujimoto, M., 2000. CIRP2, a major cytoplasmic RNA-binding protein in Xenopus oocytes. Nucleic Acids Res 28, 4689–4697. Minvielle-Sebastia, L., Preker, P.J., Wiederkehr, T., Strahm, Y., Keller, W., 1997. The major yeast poly(A)-binding protein is associated with clevage factor IA and functions in premessenger RNA 3’-end formation. Proc. Natl. Acad. Sci. U. S. A. 94, 7897–7902. Murray, A.W., Kirschner, M.W., 1989. Cyclin synthesis drives the early embryonic cell cycle. Nature (Lond) 339, 275–280. Paillard, L., Osborne, H.B., 2003. East of EDEN was a poly(A) tail. Biol Cell 95, 211–219. Paillard, L., Omilli, F., Legagneux, V., Bassez, T., Maniey, D., Osborne, H.B., 1998. EDEN and EDEN-BP, a cis element and an associated factor that mediate sequence-specific mRNA deadenylation in Xenopus embryos. EMBO J 17, 278–287. Read, R.L., Martinho, R.G., Wang, S.W., Carr, A.M., Norbury, C.J., 2002. Cytoplasmic poly(A) polymerases mediate cellular responses to S phase arrest. Proc. Natl. Acad. Sci. U.S.A. 99, 12079–12084. Richter, J.D., 1999. Cytoplasmic polyadenylation in development and beyond. Microbiol Mol Biol Rev 63, 446–456. Saitoh, S., Chabes, A., McDonald, W.H., Thelander, L., Yates, J.R., Russell, P., 2002. Cid13 is a cytoplasmic poly(A) polymerase that regulates ribonucleotide reductase mRNA. Cell 109, 563–573. Si, K., Giustetto, M., Etkin, A., Hsu, R., Janisiewicz, A.M., Miniaci, M.C., Kim, J.H., Zhu, H., Kandel, E.R., 2003. A neuronal isoform of CPEB regulates local protein synthesis and stabilizes synapse-specific longterm facilitation in aplysia. Cell 115, 893–904. Tarun Jr, S.Z., Sachs, A.B., 1996. Association of the yeast poly(A) tail binding protein with translation initiation factor eIF-4G. EMBO. J. 15, 7169–7177. Voeltz, G., Ongkasuwan, J., Standart, N., Steitz, J., 2001. A novel embryonic poly(A) binding protein, ePAB, regulates mRNA deadenylation in Xenopus egg extracts. Genes Dev 15, 774–788. Wahle, E., 1991. A novel poly(A)-binding protein acts as a specificity factor in the second phase of messenger RNA polyadenylation. Cell 66, 759– 768. Wahle, E., 1995. Poly(A) tail length control is caused by termination of processive synthesis. J. Biol. Chem 270, 2800–2808. Wang, L., Eckmann, C.R., Kadyk, L.C., Wickens, M., Kimble, J., 2002. A regulatory cytoplasmic poly(A) polymerase in Caenorhabditis elegans. Nature 419, 312–316. Wilusz, C.J., Wormington, M., Peltz, S.W., 2001. The cap-to-tail guide to mRNA turnover. Nat Rev Mol Cell Biol 2, 237–246. Winstall, E., Sadowski, M., Kuhn, U., Wahle, E., Sachs, A.B., 2000. The Saccharomyces cerevisiae RNA-binding protein Rbp29 functions in cytoplasmic mRNA metabolism. J Biol Chem 275, 21817–21826. Wu, L., Wells, D., Tay, J., Mendis, D., Abbott, M., Barnitt, A., Quinlan, E., Heynen, A., Fallon, J., Richter, J., 1998. CPEB-mediated cytoplasmic polyadenylation and the regulation of experience-dependent translation of alpha-CaMKII mRNA at synapses. Neuron 5, 1129–1139. Yang, H., Duckett, C.S., Lindsten, T., 1995. iPABP, an inductible poly(A)binding protein detected in activated human T cells. Mol. Cell. Biol. 15, 6770–6776. Zhao, J., Hyman, L., Moore, C., 1999. Formation of mRNA 3’ ends in eukaryotes: mechanism, regulation, and interrelationships with other steps in mRNA synthesis. Microbiol Mol Biol Rev 63, 405–445.