- Email: [email protected]
Identification of ADAM10 and ADAM17 with potential roles in the spermatogenesis of the Chinese mitten crab, Eriocheir sinensis
Gene 562 (2015) 117–127
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Identification of ADAM10 and ADAM17 with potential roles in the spermatogenesis of the Chinese mitten crab, Eriocheir sinensis Qing Li 1, Jing Xie 1, Lin He 1, Yuanli Wang, Zelin Duan, Hongdan Yang, Qun Wang ⁎ Laboratory of Immunological Defense & Reproduction, School of Life Science, East China Normal University, Shanghai, China
a r t i c l e
i n f o
Article history: Received 31 December 2014 Received in revised form 16 February 2015 Accepted 18 February 2015 Available online 19 February 2015 Keywords: Es-ADAM10 Es-ADAM17 Spermatogenesis Apoptosis
a b s t r a c t The ADAM (a disintegrin and metalloprotease) family plays an important role in sperm and egg fusion, development, inflammation, adhesion and migration. ADAM10 and ADAM17 are involved in the spermatogenesis. To better understand the role of ADAM10 and ADAM17 in the Chinese mitten crab, Eriocheir sinensis, the full-length cDNAs of ADAM10 and ADAM17 were cloned, and named Es-ADAM10 and EsADAM17, respectively. Sequence and structural analysis showed that Es-ADAM10 and Es-ADAM17 have the typical structure of the ADAM family. Quantitative real-time reverse transcription polymerase chain reaction analysis showed that Es-ADAM10 and Es-ADAM17 mRNAs were distributed in the heart, hepatopancreas, intestines, brain, muscle, thoracic ganglia, hemolymph, stomach, testis, ovary, gill and accessory gland. Both mRNAs were highly expressed in the muscles, and relatively high in the testis, ovary and accessory gland. In addition, the Es-ADAM17 mRNA level was detected in every stage of testis development, being relatively high from July to September, the lowest during October and November, increasing from December to January, and reached a peak in January. By contrast, the expression of Es-ADAM10 mRNA was constant during testis development. Immunofluorescence further showed that Es-ADAM10 and Es-ADAM17 proteins were present in the cytoplasm and cytomembrane of spermatocytes, and both detected in the sperm. Furthermore, etoposide induced upregulation of Es-ADAM17 and Es-ADAM10 at both the mRNA and protein levels. This study first showed that Es-ADAM10 and Es-ADAM17 were also involved in the spermatogenesis and mainly participated in the later germ cell apoptosis in E. sinensis. © 2015 Elsevier B.V. All rights reserved.
1. Introduction The ADAM family, belonging to the zinc dependent protease family, is a rapidly growing family of cell surface proteins with a transmembrane structure, characterized by a disintegrin and metalloprotease domain (ADAM) (Blobel, 1997; Huovila et al., 1996; Wolfsberg et al., 1995a,b). ADAMs play important roles in protein hydrolysis, sperm and egg fusion, development, inflammation, adhesion and migration (Blobel, 2005; Seals and Courtneidge, 2003). ADAM proteins were first identified in 1987 by the American scientist Primakoff, who studied the sperm membrane surface antigens of guinea pigs, and found the monoclonal antibody PH-30, which has an inhibitory effect on sperm
Abbreviations: ADAM, a disintegrin and metalloprotease domain; BSA, bovine serum albumin; PBST, phosphate buffer solution added Tween-20; HE, hematoxylin–eosin staining; sc1, primary spermatocyte; sc2, secondary spermatocyte; st, spermatid. ⁎ Corresponding author at: Laboratory of Immunological Defense & Reproduction, School of Life Science, East China Normal University, No. 500 Dong-Chuan Road, Shanghai, China. E-mail address: [email protected] (Q. Wang). 1 These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.gene.2015.02.060 0378-1119/© 2015 Elsevier B.V. All rights reserved.
and egg plasma membrane fusion, resulting in a reduction in the rate of the fusion of sperm and egg of 75%. The antigen, PH-30, was named fertilin (Primakoff et al., 1987). In subsequent research, two types of fertilin (Fertilin-α and Fertilin-β) were further analyzed and named ADAM1 and ADAM2, respectively (Blobel et al., 1992; Wolfsberg et al., 1993). ADAMs are typical transmembrane glycoproteins, and almost all members have a similar structure of 750–1200 amino acid with a characteristic set of domains: a pro-domain, serving as a molecular chaperone of metalloproteinase active site, which can not only influence transport, ensuring that the ADAM folds correctly and posttranslational processing, but also has its own catalytic function; a disintegrin domain; a metalloproteinase domain; a cysteine-rich domain, mainly responsible for the combination of proteoglycan molecules; an epidermal growth factor-like domain, which promotes cell membrane fusion; a transmembrane domain; and a cytoplasmic tail domain (Wolfsber and White, 1996). ADAMs are mainly distributed in multicellular organisms, including mammals, Xenopus, Drosophila and nematodes; however, none have been found in unicellular organisms, such as Escherichia coli, Saccharomyces cerevisiae, or in plants (Seals and Courtneidge, 2003). To date, 34 ADAM members have been identified, 21 of them in mammals. The distribution of ADAMs can be divided into two categories, those widely
118
Q. Li et al. / Gene 562 (2015) 117–127
distributed in the somatic cell of different tissues (ADAM7–15, ADAM17, ADAM19, ADAM22–23, ADAM28 and ADAM33); and those expressed specifically in the testis (ADAM1–6, ADAM16, ADAM18, ADAM20–21, ADAM24–26, and ADAM29–30) (Primakoff and Myles, 2000). ADAMs play an important role in the fertilization process. ADAM1 and ADAM2 form heterodimer, and further with ADAM3 to form fertilin. Knockout of one gene encoding ADAM1A, ADAM1B, ADAM2, or ADAM3 caused sperm damage during the mouse fertilization process (Cho et al., 1998). ADAM7 can form a complete plasma membrane protein in the sperm, and form a complex in sperm capacitation process with calnexin, head shock protein 5 and integral membrane protein 2B (Han et al., 2011). ADAM17 was the first member of the ADAM family with an identified role in ectodomain shedding. ADAM17 and ADAM10 are both expressed in mammalian testis, and are involved in the spermatogenesis (Lizama et al., 2010). In addition, ADAM10 and ADAM17 are widely expressed metalloproteases linked to the ectodomain release of ligands and receptors, such as Notch, epidermal growth factor (EGFR), the p75 neurotrophin receptor and ckit, which is dependent on ADAM17 activity. There is a strong link among ADAM17, processing of the c-kit ectodomain and the activation of apoptosis (Blobel, 2005). ADAM17, but not ADAM10, is upregulated in germ cells undergoing physiological apoptosis. Pharmacological inhibitors of ADAM17 significantly prevent apoptosis. KIT, the tyrosine kinase receptor, is fundamental for germ cell survival during mammalian spermatogenesis. During the first wave of spermatogenesis in the rat, extracellular domain shedding of KIT, induced by ADAM17, is associated with germ cell apoptosis (Galan et al., 2006). In addition, ADAM10 and ADAM17 are upregulated at the cell surface upon exposure to etoposide (an inhibitor of topoisomerase-II). Germ cells undergoing meiosis (named spermatocytes) are highly sensitive to DNA damage, and etoposide can induce DNA breaks and promote the activation of several key proteins, such as p73, a transcription factor, ultimately leading to apoptosis. The effect of etoposide has been well characterized in different models in vitro and in vivo, and the contribution of ADAM17 and ADAM10 in etoposide-induced apoptosis using two germ cell-like cell lines has been demonstrated (Lizama et al., 2011). The Chinese mitten crab (Eriocheir sinensis) is very popular in China and abroad, not only for its delicious taste and high nutritional value, but also for its medicinal effects. In addition, it is an important aquaculture species in Southeast Asia (Zhang et al., 2011) and is also often employed as a model organism of Brachyura in reproductive studies (Jiang et al., 2009; Wang et al., 2013). However, with largescale farming, the germplasm of crabs is degrading and causing huge economic loss. The ADAM family not only plays a role in sperm and egg adhesion and fusion, but also in the regulation of sperm quality, which must be guaranteed for normal fertilization (Seals and Courtneidge, 2003). At present, research of ADAM proteins has focused on mammalian and model species, however, little study on the expression and function of ADAM in crustaceans. Is the activation of ADAM10 and ADAM17 involved in germ cell apoptosis under DNA-damaging agents in E. sinensis as in mammals? In light of ADAMs' roles in reproduction, we cloned the full-length cDNA of ADAM10 and ADAM17 and explored their potential role in the spermatogenesis in E. sinensis. 2. Materials and methods 2.1. Experimental animals and tissues All animal procedures were performed according to protocols approved by the Biological Studies Animal Care and Use Committee, Shanghai, P.R. China. Healthy adult Chinese mitten crabs were purchased from the Shanghai aquaculture farm from July 2012 to January 2013. Crabs were allowed to breed in a filtered and aerated freshwater environment for acclimatization. The crabs were anesthetized for 3–
5 min before they were sacrificed or injected intramuscularly with etoposide. The heart, hepatopancreas, intestines, brain, muscle, thoracic ganglia, hemolymph, stomach, testis, ovary, gill and accessory gland tissues were dissected out, flash frozen in liquid nitrogen and then stored at − 80 °C until RNA extraction. Partial testis tissues were fixed in Bouin's solution and cut into 10-μm-thick sections used for immunofluorescence analysis. For in vivo experiments, the crabs were divided into ten groups, with four healthy crabs in every group. The crabs were injected intramuscularly with different concentrations of etoposide (Abmole, Shanghai, China) (0, 30, 60, 90, 120 μM) for 12 h and sacrificed at different time points (0, 6, 12, 18, and 24 h) at 90 μM etoposide. The testis tissues were isolated, frozen and stored at −80 °C for RNA extraction and western blotting. 2.2. RNA extraction Total RNA was isolated from frozen tissues using TRIzol (Invitrogen, California, USA) and quantified based on the absorbance at 260 nm; agarose gel electrophoresis was used to check the integrity of RNA. 2.3. Cloning, bioinformatics analysis, sequence alignment and phylogenetic analysis of ADAM10 and ADAM17 in E. sinensis First strand cDNA was synthesized from 2 μg purified total RNA using the First strand cDNA synthesis kit (TaKaRa, Japan) according to the manufacturer's instructions. The initial cDNA fragments of ADAM10 and ADAM17, obtained from the testes and accessory gland transcriptome (He et al., 2012, 2013), were confirmed using specific primers (Table 1) designed by Primer Premier 5.0 software. The 3′ and 5′ ends of Es-ADAM10 and Es-ADAM17 were then obtained using the rapid amplification of cDNA ends (RACE) method. The primers used are listed in Table 1. Polymerase chain reaction (PCR) was performed in a 25-μL volume with 12.5 μL Taq™ Hot Start premix (TaKaRa), 1 μL 10 μM of each primer, 1 μL of cDNA and 9.5 μL ddH2 O. The PCR conditions were 5 cycles of 94 °C for 30 s, 72 °C for 3 min; 5 cycles of 94 °C for 30 s, 66 °C for 30 s, 72 °C for 3 min; 25 cycles of 94 °C for 30 s, 62 °C for 30 s, 72 °C for 3 min; and 72 °C for 7 min for the final extension step. The purified amplification products were cloned into vector pZeroBack/blunt (Tiangen, Beijing, China), transformed into
Table 1 Primers used in this study. Primer name
Sequences 5′–3′
PCR ADAM10-F ADAM10-R ADAM17-F ADAM17-R ADAM10-5′ ADAM10-3′ ADAM17-5′ ADAM17-3′ UPM-short UPM-long
GACCGCACCACTTGTAAC CACCTTCGTCCCCTCAT GACGGTTCTGGTAATGAGCG TCTCCTTGAAGAAGCGATA AGTTCAAGATGTGGTGGAGCG TGTCTTCCAAAAGTGTCGTGCTGTG AGACAGCAGGCAGAGGCATACAACT CAACTTCCAGCAGTCTCGGGTCAT CTAATACGACTCACTATAGGGC CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT
QRT-PCR ADAM10-F ADAM10-R ADAM17-F ADAM17-R β-Actin-F β-Actin-R
GCACCACTTGTAACTTTGTC GGTTGCCGCCAAAGATA TGGTGGAGCGTTTCTGGGACAT GATGTCCCAGAAACGCTCCAC CTCCTGCTTGCTGATCCACATC GCATCCACGAGACCACTTACA
Sequencing T7 primer SP6 primer
TAATACGACTCACTATAGG ATTTAGGTGACACTATAGAA
Q. Li et al. / Gene 562 (2015) 117–127
competent E. coli Top10 cells (Tiangen), and sequenced in both directions, using T7 and SP6 primers, by Sangon Biotech Co. Ltd (Shanghai, China). The Es-ADAM10 and Es-ADAM17 full cDNA sequences were deposited into GenBank with accession numbers KF732871 and KC007532, respectively. The ORFs were detected using the National Center for Biotechnology Information (NCBI) ORF Finder tool (http://www. ncbi.nlm.nih.gov/projects/gorf/). The Simple Modular Architecture Research Tool (SMART, http://smart.embl-heidelberg.de/) was used to predict the protein domains. Signal peptide was predicted using the SignalP 4.1 Server (http://www.cbs.dtu.dk/ services/SignalP). The isoelectric point and molecular weight were predicted using ExPASy (http://web.expasy.org/protparam/). The TMpred program (http://www.ch.embnet.org/software/TMPRED_form. html/) and TMHMM Server 2.0 (http://www.cbs.dtu.dk/services/ TMHMM-2.0/) were used to detect transmembrane helices, and to calculate hydrophobicity and hydrophilicity. Multiple alignments of the EsADAM10 and Es-ADAM17 using the ClustalX multiple alignment program and the phylogenetic analyses of Es-ADAM10 and Es-ADAM17 were carried out using the MEGA5.1 software with 1000 bootstrap repeats (Takasuga et al., 2007). 2.4. Quantitative real-time reverse transcription PCR analysis of EsADAM10 and Es-ADAM17 mRNA expression QRT-PCR was used to explore the expression pattern of EsADAM10 and Es-ADAM17 mRNAs in various tissues and during testis development; every tissue had five samples and three replicates per sample. The Chinese mitten crab β-actin (HM053699.1) gene was used to calibrate the cDNA template as an internal control. Firststrand cDNA was carried out using a One Step SYBR® PrimeScript™ RT-PCR kit (TaKaRa). QRT-PCR was carried out on a CFX96™ realtime system (Bio-Rad) and each sample was run in a total volume of 25 μL with 12.5 μL SYBR® Premix Ex Taq™ II (2 ×) (TaKaRa), 1 μL of each PCR Primer (10 μM), 1 μL of diluted cDNA, and 9.5 μL ddH2 O. Primer Premier 5.0 software designed a pair of primers (Table 1) based on the conserved regions of Es-ADAM10 and EsADAM17, respectively. The PCR program was 95 °C for 3 min; followed by 40 cycles of 95 °C for 10 s, 60 °C for 30 s, 65 °C for 5 s, and 95 °C for 5 s. Dissociation curve analysis was performed at the end of each PCR reaction to verify the amplification of a single product. The 2− ΔΔCt method was used to analyze the relative expression levels of Es-ADAM10 and Es-ADAM17 (Livak and Schmittgen, 2001). All data are presented as means ± standard deviation, and were evaluated by one-way analysis of variance (ANOVA) using the SPSS 17.0 program. Differences were considered statistically significant at P b 0.05. 2.5. Western blotting analysis of Es-ADAM10 and Es-ADAM17 proteins expression Total proteins extracted from different tissues were prepared using a whole protein extraction kit (Sangon Biotech), and the protein concentration was determined using a BCA Protein Assay kit (Beyotime, Jiangsu, China). The protein homogenates (500 μg) was separated on a 10% SDS-PAGE gel and transferred to a methanol-activated polyvinylidene fluoride membrane (PVDF, CWBIO, Beijing, China) by electroblotting. The membrane was then blocked with 5% Bovine Serum Albumin (BSA, CWBIO) in 10 mM PBST (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2nM KH2PO4, 1 mM 20% Tween-20) for 2 h at room temperature, before being incubated with primary antibodies ADAM10 (source of rabbit) (1/500 dilution, bs-3574R, Bioss, China) and ADAM17 (source of rabbit) (1/500 dilution, bs-4236R, Bioss, China), respectively. As a negative control for the specificity, the anti-ADAM10 and antiADAM17 antisera were further preadsorbed with excessive corresponding immunogen (data not shown). As a loading control,
119
membranes were also incubated with anti-β-actin monoclonal antibodies (source of mouse) (1/1000 dilution, 60008-1-lg, Proteintech, USA) overnight at 4 °C. After washing, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody (1/1000 dilution, CWBIO) for 1 h at 37 °C. Immunoreactive bands were revealed using cECL western blotting kit (CWBIO), according to the manufacturer's instructions. The relative protein expression levels of Es-ADAM10 and Es-ADAM17 were analyzed using the Grey value method (Wang et al., 2012). 2.6. Immunofluorescence The spatial distribution of Es-ADAM10 and Es-ADAM17 proteins was determined using immunofluorescence. Paraffin-embedded sections of the testis tissue was dewaxed, incubated with xylene twice for every 5 min, with absolute ethyl alcohol twice for 5 min, with 95%, 85% and 75% ethyl alcohol for 5 min, respectively, and with ddH2O for 10 min. The sections were boiled for 10 min in 10 mM sodium citrate buffer (pH 6.0) for antigen retrieval and blocked in goat serum (SP-9001, SUNBIO) for 15 min at room temperature. The sections were then incubated with primary antibodies ADAM10 (1/100 dilution) and ADAM17 (1/100 dilution) overnight at 4 °C, respectively. The sections were then incubated with fluorescein isothiocyanate (FITC)-conjugated secondary antibody at a dilution of 1:100 for 1 h at room temperature. After washing three times in PBS for 10 min, the sections were counterstained with HelixGen Anti-fade Fluorescence Mounting Medium containing 4,6-diamidino-2-phenylindole (DAPI), a nuclear counterstain, and observed under a fluorescence microscope (Leica, Germany). 3. Results 3.1. Characterization of Es-ADAM10 and Es-ADAM17 full-length cDNA The complete sequence of Es-ADAM10 cDNA contained a 5′ UTR of 100 bp, a 3′ UTR of 409 bp, and an ORF of 2790 bp, encoding a polypeptide of 929 amino acids (Fig. 1A). The predicted molecular weight of EsADAM10 was 103.6 kDa and its isoelectric point (pI) was 6.99. The EsADAM17 full-length cDNA contained a 5′ UTR of 102 bp, a 3′ UTR of 207 bp with a poly(A) tail, and an ORF of 2274 bp encoding a 757 amino acid (Fig. 1B). The predicted molecular weight of Es-ADAM17 was 86.8 kDa and isoelectric point (pI) was 5.78. SignalP software analysis revealed that the deduced protein of Es-ADAM10 contained a putative signal peptide (11–165 nt). SMART analysis indicated that Es-ADAM10 contained the metalloprotease domain (302–486 nt), a disintegrin domain (558–653 nt), a cysteine-rich domain (575–683 nt), an epidermal growth factor repeat sequence (658–712 nt) and transmembrane domains (778–800 nt) (Fig. 2A). Es-ADAM17 also contained a putative signal peptide (11–165 nt), a metalloprotease domain (305–457 nt), a disintegrin domain (494–57 nt), a cysteine-rich domain (597–619 nt), an epidermal growth factor repeat sequence (544–579 nt) and transmembrane domains (678–700 nt) (Fig. 2B). Thus, the structures of EsADAM10 and Es-ADAM17 were typical of the ADAM family. In addition, the presence of putative transmembrane regions in Es-ADAM10 and EsADAM17 indicated that both proteins were integral membrane proteins (Fig. 3). 3.2. Multiple alignment and phylogenetic analysis of Es-ADAM10 and EsADAM17 The amino acid sequences of Es-ADAM10 and Es-ADAM17 shared homology with other reported ADAM10 and ADAM17 proteins. EsADAM10 shared 63% identity with that of Ceratitis capitata, 60% identity with that of Acyrthosiphon pisum, 56% identity with that of Apis florea, 54% identity with that of Harpegnathos saltator, 44% identity with that of
120
Q. Li et al. / Gene 562 (2015) 117–127
ADAMs conserved in other species, were also found in Es-ADAM10 (Fig. 4A, B) and Es-ADAM17 (Fig. 4C, D). A neighbor-joining phylogenetic tree was constructed based on the amino acid sequences of EsADAM10 and Es-ADAM17 and those of other species. Es-ADAM10 and Es-ADAM17 were firstly clustered with insects, and then clustered with vertebrate (Fig. 5), which agreed with the traditional taxonomy. 3.3. The expression pattern of Es-ADAM10 and Es-ADAM17 in E. sinensis The qRT-PCR results showed that Es-ADAM10 and Es-ADAM17 mRNAs were distributed in the heart, hepatopancreas, intestines, brain, muscle, thoracic ganglia, hemolymph, stomach, testis, ovary, gill and accessory gland. Both Es-ADAM10 and Es-ADAM17 mRNAs were highly expressed in the muscle, and relatively high in the testis, ovary and accessory gland. Furthermore, Es-ADAM17 mRNA was abundant in the hepatopancreas (Fig. 6A). In addition, qRT-PCR results of EsADAM10 and Es-ADAM17 mRNA expression patterns during testis development showed that the Es-ADAM17 mRNA level was detected in every stage of testis development, with relatively high expression from July to September, the lowest during October and November, then increased from December to January, and reached a peak in January. However, the Es-ADAM10 mRNA level remained steady during testis development (Fig. 6B). Immunofluorescence was used to examine the distribution of Es-ADAM10 and Es-ADAM17 proteins in the testis. Both Es-ADAM10 and Es-ADAM17 proteins were mainly located in the cytoplasm and cytomembrane of spermatocyte. Furthermore, according to histological analysis of hematoxylin–eosin staining, positive signal of Es-ADAM17 was higher than the level of Es-ADAM10 in mature sperm (Fig. 7). 3.4. Expression changes of Es-ADAM10 and Es-ADAM17 induced by etoposide in E. sinensis
Fig. 1. Nucleotide and deduced amino acid sequences of Es-ADAM10 (A) and EsADAM17 (B) genes. An asterisk (*) indicates the stop codon; the light gray region indicates the metalloproteinase-like domain; the underline region indicates the disintegrin-like domain; the red region indicates the cysteine-rich domain; the yellow region is the epidermal growth factor-like domain; the blue region is the transmembrane domain; and the end region is the cytoplasmic tail domain.
Crassostrea gigas, and 41% identity with that of Saccoglossus kowalevskii. Es-ADAM17 shared 66% identity with those of C. capitata, Tribolium castaneum and Bombyx mori, 65% identity with those of Aedes aegypti and Bombus impatiens, 63% identity with that of Drosophila melanogaster and 42% identity with that of Pseudopodoces humilis. The metalloprotease and disintegrin domains, two highly conserved and important domains of
The qRT-PCR results indicated that the Es-ADAM10 mRNA level decreased at 30 μM etoposide and showed no significant change at 60 μM, compared with the control. Its level increased significantly and reached a peak at 90 μM etoposide; however, its level decreased at 120 μM. Es-ADAM17 showed no significant change under 30 μM etoposide compared with the control. Thereafter, the Es-ADAM17 mRNA level increased with increasing concentrations of etoposide: its level was six times that of the control at 90 μM etoposide. The EsADAM17 mRNA level decreased significantly at 120 μM compared with its level at 90 μM, but was still higher than the level of the control (Fig. 8A). The Es-ADAM10 protein level increased slowly with increasing concentration of etoposide, showing no change at 30 μM, a significant increase at 60 μM, but no significant change at 90 and 120 μM, compared with the level at 60 μM. However, the EsADAM17 protein expression pattern was different. With increasing concentration of etoposide, the Es-ADAM17 protein level continued to increase, reaching a peak at 120 μM (Fig. 8B). The level of Es-ADAM10 and Es-ADAM17 were both high at 90 μM, so we treated crabs with 90 μM etoposide for different times to detect the change of Es-ADAM10 and ES-ADAM17 at the mRNA and protein levels. The Es-ADAM10 mRNA level increased significantly to three times that of the control after 6 h and six times that of the control after 12 h. For Es-ADAM17, its level increased after 6 h and reached a peak of eight times that of the control after 12 h, before decreasing significantly after 18 h and 24 h compared with the level after 12 h (Fig. 8C). The Es-ADAM10 protein level increased obviously after 12 h and reached a peak after 18 h, before decreasing after 24 h. However, the Es-ADAM17 protein level showed no change after 6 h and then increased significantly after 12 h, reached its peak after 18 h, before decreasing after 24 h compared with the level at 18 h (Fig. 8D).
Q. Li et al. / Gene 562 (2015) 117–127
121
Fig. 2. Es-ADAM10 and Es-ADAM17 contain conserved domains of the ADAM family. The numbers correspond to the first amino acid that delimits each domain, which were illustrated using the DOG 2.0 software.
Fig. 3. The predicted transmembrane regions of Es-ADAM10 (A) and Es-ADAM17 (B). Horizontal axis represents the number of amino acids. Longitudinal axis represents the probability of prediction. Both Es-ADAM10 and Es-ADAM17 only have one transmembrane region (red part). The pink part is the outside region and the blue part is the inside region.
122
Q. Li et al. / Gene 562 (2015) 117–127
4. Discussion In present study, the full-length cDNAs of Es-ADAM10 and Es-ADAM17 genes were cloned, and the predicted proteins both contained conserved
domains of the ADAM family (Figs. 1, 2). However, the sequences of conserved domains differed. The metalloprotease sequence of ADAM10 in invertebrates, including E. sinensis, is HEIGHNFGSPHD (Fig. 4A), whereas the sequence is HEVGHNFGSPHD in vertebrates. In invertebrates, the metalloprotease sequence of ADAM17 is HEFGHNWGSEHD (Fig. 4C), while the sequence is HELGHNFGAEHD in vertebrates. Furthermore, the disintegrin sequence also varies; it is GEECD of ADAM10 of invertebrates (Fig. 4B) and GEQCD in vertebrates, such as Anas and Brachyuromys betsileoensis. The disintegrin sequence of ADAM17 is QEECD in invertebrates, but DEECD in golden bees and GEECD in vertebrates (Fig. 4D). It was thought that the sequence of the conserved domains of different subtypes of ADAM family vary and have undergone mutation in different species; however, the last three amino acids, ECD, of the disintegrin domain were completely conserved, which ensured its stability and activity (Zhu and Evans, 2002). Therefore, we can distinguish different subtypes of the ADAM family initially according to the sequence of the conserved domains. The multiple sequence alignment results showed that Es-ADAM10 or Es-ADAM17 shared high levels of sequence identity with insects and some invertebrates. These genes and proteins have not been reported in shrimps or other crabs; therefore, this study provided a reference for the study of ADAM family in Brachyuran. Phylogenetic analysis showed that Es-ADAM10 and Es-ADAM17 were clustered in two branches, respectively, with respective subtypes of invertebrates clustered into one group, consistent with the traditional taxonomy (Fig. 5). The expressions of these two proteins in the Chinese mitten crab were similar to those in mammals, e.g. ADAM10 was first reported distributed in the chicken embryonic epidermis, somites of sarcomere, gut endoderm, kidney, liver, heart and epithelial tissue of nerve cells (Hall and Erickson, 2003), and high levels of ADAM17 were observed in the testis, ovary, heart, placenta, lung and spleen (Sahin et al., 2004). The qRT-PCR results showed that Es-ADAM10 and Es-ADAM17 mRNAs were distributed in all assayed tissues (Fig. 6A). The ubiquitous distribution of Es-ADAM10 and EsADAM17 (such as in the hepatopancreas, intestines, brain, muscle, thoracic ganglia, hemolymph, stomach, testis, ovary, gill and accessory gland) imply that they play important roles in protein hydrolysis, inflammatory response and signal transduction. In addition, the qRT-PCR results showed that Es-ADAM10 and Es-ADAM17 are highly expressed in the testis, accessory gland and related gonadal tissues (Fig. 6A), suggested that the two genes may also be involved in the reproductive process of E. sinensis, as in mammals (Moreno et al., 2011). The expression patterns of Es-ADAM10 and Es-ADAM17 mRNAs during testis development were further analyzed. The qRTPCR results showed that Es-ADAM17 mRNA was steady in July, August and September (Fig. 6B), which represents the spermatocyte stage and the early spermatid stage with meiosis (Du et al., 1988), implying that Es-ADAM17 might be involved in the meiotic and cell migration, and thus in the spermatogenesis of E. sinensis. In October and November, the period representing the end of spermatid stage and sperm stage, when the sperm are formed and gradually mature (Du et al., 1988), the level of Es-ADAM17 mRNA decreased significantly (Fig. 6B), suggesting that the regulation by Es-ADAM17 in
Fig. 4. Multiple alignment of the ADAM10 and ADAM17 amino acid sequences from E. sinensis and other species. (A) Multiple sequence alignment of the metalloproteinase domain of Es-ADAM10 with corresponding structures of other species. (B) Multiple sequence alignment of the disintegrin domain of Es-ADAM10 with corresponding structures of other species. (C) Multiple sequence alignment of the metalloproteinase domain of Es-ADAM17 with corresponding structures of other species. (D) Multiple sequence alignment of the disintegrin domain of Es-ADAM17 with corresponding structures of other species. Red boxes indicate the metalloproteinase domain and disintegrin domain, respectively.
Q. Li et al. / Gene 562 (2015) 117–127
123
Fig. 5. Phylogenetic tree of the amino acid sequences of ADAM10 and ADAM17 from E. sinensis and other species. The neighbor-joining phylogenetic tree was constructed utilizing the sequence analysis tool MEGA 5.1. The numbers at the nodes represent percent bootstrap support for the phylogeny. Red and blue triangles represent the ADAM10 and ADAM17 from E. sinensis, respectively.
this period decreased. However, the level of Es-ADAM17 mRNA increased significantly in December and January (Fig. 6B), suggesting that this gene might participate in the regulation of late sperm quality or capacitation and the acrosome reaction (Deuss et al., 2008; Lizama et al., 2010, 2011, 2012). However, the level of Es-ADAM10
mRNA was constant during testis development, suggesting that this gene may be involved in the regulation at the protein level. Immunofluorescence showed that Es-ADAM10 and Es-ADAM17 proteins were mainly distributed in the cytoplasm and cell membrane of spermatocyte (Fig. 7), which fitted with the result generated by the
124
Q. Li et al. / Gene 562 (2015) 117–127
Fig. 6. QRT-PCR analysis of the relative expression levels of Es-ADAM10 and Es-ADAM17 mRNAs in different tissues and at different stages of testis development. (A) Relative expression levels of Es-ADAM10 and Es-ADAM17 mRNAs in different tissues. The horizontal axis represents 12 tissues sampled in September. Es-ADAM10 mRNA level in the heart, hepatopancreas, intestine, cranial ganglia, muscle, thoracic ganglions, hemocytes, stomach, testis, ovary and accessory gonad was normalized to that of the gill, however, EsADAM17 mRNA level in the hepatopancreas, intestine, cranial ganglia, muscle, thoracic ganglions, hemocytes, stomach, testis, ovary, gills and accessory gonad was normalized to that of the heart. (B) Relative expression levels of Es-ADAM10 and Es-ADAM17 mRNAs at different developmental stages in the testis. The horizontal axis represents seven developmental stages of the testis. Es-ADAM10 and Es-ADAM17 mRNA levels in different developmental stages of the testis were both normalized to that of October. The bars represent the mean ± SEM (n = 5). Significant differences of different developmental stages (P b 0.05) were analyzed by one-way analysis of variance (ANOVA) and indicated by lowercase letters (a, b and c).
Q. Li et al. / Gene 562 (2015) 117–127
125
Fig. 7. Immunofluorescence analysis of the distribution of Es-ADAM10 and Es-ADAM17 proteins in the testis. Nuclei were stained blue by DAPI (A1–A2). Subcellular localization of Es-ADAM10 (B1) and Es-ADAM17 (B2). The merged images (C1–C2) were analyzed by ImageJ 2 × software. The insets in C1 and C2 are higher magnification images of the boxed areas within each corresponding image. Hematoxylin–eosin staining (D1–D2) was performed from the same testis tissue. sc1: primary spermatocyte; sc2: secondary spermatocyte; st: spermatid. Bar = 0.1 mm.
TMHMM Server 2.0 that both proteins had the transmembrane domains (Fig. 3). Furthermore, Es-ADAM10 and Es-ADAM17 proteins were detected in the sperm (Fig. 7B1, B2), and signal of Es-ADAM17 was higher than that of Es-ADAM10, suggesting that both Es-ADAM17 and Es-ADAM10 participated in the sperm spermatogenesis. In mammals, etoposide is often used as an anticancer therapy, where its interaction with topoisomerase causes the fracture of DNA topology, resulting in apoptosis through p53-dependent interrupting of metaphase (Sturgeon et al., 2008; Wu et al., 2011). ADAM17 was one of the first elements reported to trigger physiological germ cell apoptosis during the first wave of spermatogenesis (Lizama et al., 2011). In line with that etoposide-induced apoptosis and upregulation of ADAM17 and ADAM10 in GC-1 and GC-2 male germ cells in vitro (Lizama et al., 2010), the Es-ADAM10 and Es-ADAM17 levels increased gradually at the mRNA and protein levels with increasing concentrations of etoposide; however, the expression pattern of Es-ADAM10 was different from Es-ADAM17. The level of Es-ADAM10 mRNA was decreased at 30 μM etoposide compared with the control (Fig. 8A), suggesting that Es-ADAM10 may be involved in the defense process in vivo at low etoposide concentrations, by the inhibition of spermatid apoptosis. However, the Es-ADAM10 mRNA level increased significantly at 90 μM (Fig. 8A), indicating that Es-ADAM10 might also participate in the regulation of sperm quality. The Es-ADAM10 protein accumulated with etoposide concentration increasing (Fig. 8B). In addition, Es-ADAM10 reached peak at both the mRNA (Fig. 8C) and protein (Fig. 8D) levels after 12 h with 90 μM etoposide, indicating that etoposide induced EsADAM10 in a time- and concentration-dependent manner. Low concentrations of etoposide had no effect on the level of Es-ADAM17 mRNA; however, its level increased as the etoposide concentration increased, reaching a peak at 90 μM (Fig. 8A). Es-ADAM17 protein increased significantly with etoposide concentration (Fig. 8B) and the upward trend was more obvious than that of Es-ADAM10, suggesting that ADAM17 is more sensitive to etoposide than ADAM10. Thus, etoposide's induction of Es-ADAM17 was also time- and concentration-dependent. In conclusion, we demonstrated that Es-ADAM10 and Es-ADAM17 are related with the apoptosis of spermatocyte in E. sinensis, mainly
in the regulation of sperm quality. The Es-ADAM10 and Es-ADAM17 levels responded differently to the administration of etoposide, suggesting that the regulation mechanism of ADAM10 and ADAM17 in germ cell apoptosis is different. ADAM10 showed “inactive” (expression is constant during testis development) may be just assisted on the function of ADAM17, which needs further study.
Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (No. 41376157, No. 31201974 and No. 31172393), the Shanghai Natural Science Fund Committee (No. 12ZR1408900) and the Doctoral Fund of Ministry of Education (No. 20120076120011). Thank for the support of the public experimental platform of School of Life Science in East China Normal University.
References Blobel, C.P., 1997. Metalloprotease-disintegrins: links to cell adhesion and cleavage of TNF-α and Notch. Cell 90, 589–592. Blobel, C.P., 2005. ADAM: key components in EGFR signaling and development. Nat. Rev. Mol. Cell Biol. 6, 32–43. Blobel, C.P., Wolfsberg, T.G., Turck, C.W., Myles, D.G., Primakoff, P., White, J.M., 1992. A potential fusion peptide and an integrin ligand domain in a protein active in sperm–egg fusion. Nature 356, 248-25. Cho, C., Bunch, D.O., Faure, J.E., Goulding, E.H., Eddy, E.M., Primakoff, P., Myles, D.G., 1998. Fertilization defects in sperm from mice lacking fertilin beta. Science 281, 1857–1859. Deuss, M., Reiss, K., Hartmann, D., 2008. Part-time-secretases: the functional biology of ADAM 9, 10 and 17. Curr. Alzheimer Res. 5 (2), 187–201. Du, N.S., Xue, L.Z., Lai, W., 1988. Histology of the male reproductive system in Eriocheir sinensis (Decapoda, Crustacea). Acta Zool. Sin. 34 (4), 329–333. Galan, J.J., De Felici, M., Buch, B., Rivero, M.C., Segura, A., Royo, J.L., Cruz, N., Real, L.M., Ruiz, A., 2006. Association of genetic markers within the KIT and KITLG genes with human male infertility. Hum. Reprod. 21, 3185–3192. Hall, R.J., Erickson, C.A., 2003. ADAM 10: an active metalloprotease expressed during avian epithelial morphogenesis. Dev. Biol. 256 (1), 147–160. Han, C., Park, I., Lee, B., Jin, S., Choi, H., Kwon, J.T., Kwon, Y.I., Kim do, H., Park, Z.Y., Cho, C., 2011. Identification of heat shock protein 5, calnexin and integral membrane protein 2B as Adam7-interacting membrane proteins in mouse sperm. J. Cell. Physiol. 226, 1186–1195.
126
Q. Li et al. / Gene 562 (2015) 117–127
A
B
C
D
Fig. 8. Changes in Es-ADAM10 and Es-ADAM17 at the mRNA and protein expression levels induced by etoposide in the testis. (A) Changes in Es-ADAM10 and Es-ADAM17 mRNA expression levels with different concentrations of etoposide. (B) Changes in Es-ADAM10 and Es-ADAM17 protein expression levels with different concentrations of etoposide. (C) Changes in EsADAM10 and Es-ADAM17 mRNA expression levels induced by etoposide for different periods. (D) Changes in Es-ADAM10 and Es-ADAM17 protein expression levels induced by etoposide for different periods.
He, L., Wang, Q., Jin, X.K., Chen, L.L., Liu, L.H., Wang, Y., 2012. Transcriptome profiling of testis during sexual maturation stages in Eriocher sinensis using Illumina sequencing. PLoS ONE 7 (3), e33735. He, L., Jiang, H., Cao, D.D., Liu, L.H., Hu, S.N., Wang, Q., 2013. Comparative transcriptome analysis of the accessory sex gland and testis from the Chinese mitten crab (Eriocheir sinensis). PLoS ONE 8 (1), e53915. Huovila, A.P., Almeida, E.A., White, J.M., 1996. ADAMs and cell fusion. Curr. Opin. Cell Biol. 8, 692–699. Jiang, H., Cai, Y.M., Chen, L.Q., Zhang, X.W., Hu, S.N., Wang, Q., 2009. Functional annotation and analysis of expressed sequence tags from the hepatopancreas of mitten crab (Eriocheir sinensis). Mar. Biotechnol. 11, 317–326.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(−delta delta C(T)) method. Methods 25, 402–408. Lizama, C., Rojas-Benítez, D., Antonelli, M., Ludwig, A., Bustamante-Marín, X., BrouwerVisser, J., Moreno, R.D., 2010. TACE/ADAM17 is involved in germ cell apoptosis during rat spermatogenesis. Reproduction 140 (2), 305–317. Lizama, C., Ludwig, A., Moreno, R.D., 2011. Etoposide induces apoptosis and upregulation of TACE/ADAM17 and ADAM10 in an in vitro male germ cell line model. Biochim. Biophys. Acta Mol. Cell. Res. 1813 (1), 120–128. Lizama, C., Rojas-benitez, D., Antonelli, M., Ludwig, A., Moreno, R.D., 2012. Involvement of TACE/ADAM17 and ADAM10 in etoposide-induced apoptosis of germ cells in rat spermatogenesis. J. Cell. Physiol. 227 (2), 829–838.
Q. Li et al. / Gene 562 (2015) 117–127 Moreno, R.D., Urriola-Muñoz, P., Lagos-Cabré, R., 2011. The emerging role of matrix metalloproteases of the ADAM family in male germ cell apoptosis. Spermatogenesis 1 (3), 195–208. Primakoff, P., Myles, D.G., 2000. The ADAM gene family: surface proteins with adhesion and protease activity. Trends Genet. 16, 83–87. Primakoff, P., Hyatt, H., Tredick-Kline, J., 1987. Identification and purification of a sperm surface protein with a potential role in sperm–egg membrane fusion. J. Cell Biol. 104, 141–149. Sahin, U., Weskamp, G., Kelly, K., Zhou, H.M., Higashiyama, S., Peschon, J., Hartmann, D., Safting, P., Blobel, C.P., 2004. Distinct roles for ADAM10 and ADAM17 in ectodomain shedding of six EGFR ligands. J. Cell Biol. 164 (5), 769–779. Seals, D.F., Courtneidge, S.A., 2003. The ADAMs family of metalloproteases: multidomain proteins with multiple functions. Genes Dev. 17, 7–30. Sturgeon, C.M., Duffy, M.J., Stenman, U.H., Lilja, H., Brünner, N., Chan, D.W., Babaian, R., Bast Jr., R.C., Dowell, B., Esteva, F.J., et al., 2008. National Academy of Clinical Biochemistry laboratory medicine practice guidelines for use of tumor markers in testicular, prostate, colorectal, breast, and ovarian cancers. Clin. Chem. 54 (12), e11–e79. Takasuga, A., Watanabe, T., Mizoguchi, Y., Hirano, T., Ihara, N., Takano, A., Yokouchi, K., Fujikawa, A., Chiba, K., Kobayashi, N., Tatsuda, K., Oe, T., Furukawa-Kuroiwa, M., Nishimura-Abe, A., Fujita, T., Inoue, K., Mizoshita, K., Ogino, A., Sugimoto, Y., 2007. Identification of bovine QTL for growth and carcass traits in Japanese Black cattle by replication and identical-by-descent mapping. Mamm. Genome 18, 125–136. Wang, Y.M., Lin, X.F., Shi, C.M., Lu, L., Qin, Z.Y., Zhu, G.Z., Cao, X.G., Ji, C.B., Qiu, J., Guo, X.R., 2012. Alpha-lipoic acid protects 3T3-L1 adipocytes from NYGGF4 (PID1) overexpression-induced insulin resistance through increasing phosphorylation of IRS-1 and Akt. J. Bioenerg. Biomembr. 44, 357–363.
127
Wang, J., Fang, D.A., Wang, Y., Wang, Y.L., Cheng, L., He, L., Wang, Q., 2013. Cathepsin A protein from the accessory sex gland of the Chinese mitten crab (Eriocheir sinensis) plays a key role in spermatophore digestion. J. Insect Physiol. 59, 953–960. Wolfsber, T.G., White, J.M., 1996. ADAMs in fertilization and development. Dev. Biol. 180, 389–401. Wolfsberg, T.G., Bazan, J.F., Blobel, C.P., Myles, D.G., Primakoff, P., White, J.M., 1993. The precursor region of a protein active in sperm–egg fusion contains a metalloprotease and a disintegrin domain: structural, functional, and evolutionary implications. Proc. Natl. Acad. Sci. 90, 10783–10787. Wolfsberg, T.G., Primakoff, P., Myles, D.G., White, J.M., 1995a. ADAM, a novel family of membrane proteins containing a disintegrin and metalloprotease domain: multipotential functions in cell–cell and cell–matrix interactions. J. Cell Biol. 131, 275–278. Wolfsberg, T.G., Straight, P.D., Gerena, R.L., Huovila, A.P., Primakoff, P., Myles, D.G., White, J.M., 1995b. ADAM, a widely distributed and developmentally regulated gene family encoding membrane proteins with a disintegrin and metalloprotease domain. Dev. Biol. 169, 378–383. Wu, C.C., Li, T.K., Farh, L., Lin, L.Y., Lin, T.S., Yu, Y.J., Yen, T.J., Chiang, C.W., Chan, N.L., 2011. Structural basis of type II topoisomerase inhibition by the anticancer drug etoposide. Science 333 (6041), 459–462. Zhang, Y.C., Sun, Y., Liu, Y.C., Geng, X.Y., Wang, X.H., Wang, Y.F., Sun, J.S., Yang, W.J., 2011. Molt-inhibiting hormone from Chinese mitten crab (Eriocheir sinensis): cloning, tissue expression and effects of recombinant peptide on ecdysteroid secretion of YOs. Gen. Comp. Endocrinol. 173, 467–474. Zhu, X.L., Evans, J.P., 2002. Analysis of the roles of RGD-binding intergrins, α4/α9 integrins, α6 integrins, and CD9 in the interaction of the fertilin β (ADAM2) disintegrin domain with the mouse egg membrane. Biol. Reprod. 66 (4), 1193–1202.
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Identification of ADAM10 and ADAM17 with potential roles in the spermatogenesis of the Chinese mitten crab, Eriocheir sinensis Qing Li 1, Jing Xie 1, Lin He 1, Yuanli Wang, Zelin Duan, Hongdan Yang, Qun Wang ⁎ Laboratory of Immunological Defense & Reproduction, School of Life Science, East China Normal University, Shanghai, China
a r t i c l e
i n f o
Article history: Received 31 December 2014 Received in revised form 16 February 2015 Accepted 18 February 2015 Available online 19 February 2015 Keywords: Es-ADAM10 Es-ADAM17 Spermatogenesis Apoptosis
a b s t r a c t The ADAM (a disintegrin and metalloprotease) family plays an important role in sperm and egg fusion, development, inflammation, adhesion and migration. ADAM10 and ADAM17 are involved in the spermatogenesis. To better understand the role of ADAM10 and ADAM17 in the Chinese mitten crab, Eriocheir sinensis, the full-length cDNAs of ADAM10 and ADAM17 were cloned, and named Es-ADAM10 and EsADAM17, respectively. Sequence and structural analysis showed that Es-ADAM10 and Es-ADAM17 have the typical structure of the ADAM family. Quantitative real-time reverse transcription polymerase chain reaction analysis showed that Es-ADAM10 and Es-ADAM17 mRNAs were distributed in the heart, hepatopancreas, intestines, brain, muscle, thoracic ganglia, hemolymph, stomach, testis, ovary, gill and accessory gland. Both mRNAs were highly expressed in the muscles, and relatively high in the testis, ovary and accessory gland. In addition, the Es-ADAM17 mRNA level was detected in every stage of testis development, being relatively high from July to September, the lowest during October and November, increasing from December to January, and reached a peak in January. By contrast, the expression of Es-ADAM10 mRNA was constant during testis development. Immunofluorescence further showed that Es-ADAM10 and Es-ADAM17 proteins were present in the cytoplasm and cytomembrane of spermatocytes, and both detected in the sperm. Furthermore, etoposide induced upregulation of Es-ADAM17 and Es-ADAM10 at both the mRNA and protein levels. This study first showed that Es-ADAM10 and Es-ADAM17 were also involved in the spermatogenesis and mainly participated in the later germ cell apoptosis in E. sinensis. © 2015 Elsevier B.V. All rights reserved.
1. Introduction The ADAM family, belonging to the zinc dependent protease family, is a rapidly growing family of cell surface proteins with a transmembrane structure, characterized by a disintegrin and metalloprotease domain (ADAM) (Blobel, 1997; Huovila et al., 1996; Wolfsberg et al., 1995a,b). ADAMs play important roles in protein hydrolysis, sperm and egg fusion, development, inflammation, adhesion and migration (Blobel, 2005; Seals and Courtneidge, 2003). ADAM proteins were first identified in 1987 by the American scientist Primakoff, who studied the sperm membrane surface antigens of guinea pigs, and found the monoclonal antibody PH-30, which has an inhibitory effect on sperm
Abbreviations: ADAM, a disintegrin and metalloprotease domain; BSA, bovine serum albumin; PBST, phosphate buffer solution added Tween-20; HE, hematoxylin–eosin staining; sc1, primary spermatocyte; sc2, secondary spermatocyte; st, spermatid. ⁎ Corresponding author at: Laboratory of Immunological Defense & Reproduction, School of Life Science, East China Normal University, No. 500 Dong-Chuan Road, Shanghai, China. E-mail address: [email protected] (Q. Wang). 1 These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.gene.2015.02.060 0378-1119/© 2015 Elsevier B.V. All rights reserved.
and egg plasma membrane fusion, resulting in a reduction in the rate of the fusion of sperm and egg of 75%. The antigen, PH-30, was named fertilin (Primakoff et al., 1987). In subsequent research, two types of fertilin (Fertilin-α and Fertilin-β) were further analyzed and named ADAM1 and ADAM2, respectively (Blobel et al., 1992; Wolfsberg et al., 1993). ADAMs are typical transmembrane glycoproteins, and almost all members have a similar structure of 750–1200 amino acid with a characteristic set of domains: a pro-domain, serving as a molecular chaperone of metalloproteinase active site, which can not only influence transport, ensuring that the ADAM folds correctly and posttranslational processing, but also has its own catalytic function; a disintegrin domain; a metalloproteinase domain; a cysteine-rich domain, mainly responsible for the combination of proteoglycan molecules; an epidermal growth factor-like domain, which promotes cell membrane fusion; a transmembrane domain; and a cytoplasmic tail domain (Wolfsber and White, 1996). ADAMs are mainly distributed in multicellular organisms, including mammals, Xenopus, Drosophila and nematodes; however, none have been found in unicellular organisms, such as Escherichia coli, Saccharomyces cerevisiae, or in plants (Seals and Courtneidge, 2003). To date, 34 ADAM members have been identified, 21 of them in mammals. The distribution of ADAMs can be divided into two categories, those widely
118
Q. Li et al. / Gene 562 (2015) 117–127
distributed in the somatic cell of different tissues (ADAM7–15, ADAM17, ADAM19, ADAM22–23, ADAM28 and ADAM33); and those expressed specifically in the testis (ADAM1–6, ADAM16, ADAM18, ADAM20–21, ADAM24–26, and ADAM29–30) (Primakoff and Myles, 2000). ADAMs play an important role in the fertilization process. ADAM1 and ADAM2 form heterodimer, and further with ADAM3 to form fertilin. Knockout of one gene encoding ADAM1A, ADAM1B, ADAM2, or ADAM3 caused sperm damage during the mouse fertilization process (Cho et al., 1998). ADAM7 can form a complete plasma membrane protein in the sperm, and form a complex in sperm capacitation process with calnexin, head shock protein 5 and integral membrane protein 2B (Han et al., 2011). ADAM17 was the first member of the ADAM family with an identified role in ectodomain shedding. ADAM17 and ADAM10 are both expressed in mammalian testis, and are involved in the spermatogenesis (Lizama et al., 2010). In addition, ADAM10 and ADAM17 are widely expressed metalloproteases linked to the ectodomain release of ligands and receptors, such as Notch, epidermal growth factor (EGFR), the p75 neurotrophin receptor and ckit, which is dependent on ADAM17 activity. There is a strong link among ADAM17, processing of the c-kit ectodomain and the activation of apoptosis (Blobel, 2005). ADAM17, but not ADAM10, is upregulated in germ cells undergoing physiological apoptosis. Pharmacological inhibitors of ADAM17 significantly prevent apoptosis. KIT, the tyrosine kinase receptor, is fundamental for germ cell survival during mammalian spermatogenesis. During the first wave of spermatogenesis in the rat, extracellular domain shedding of KIT, induced by ADAM17, is associated with germ cell apoptosis (Galan et al., 2006). In addition, ADAM10 and ADAM17 are upregulated at the cell surface upon exposure to etoposide (an inhibitor of topoisomerase-II). Germ cells undergoing meiosis (named spermatocytes) are highly sensitive to DNA damage, and etoposide can induce DNA breaks and promote the activation of several key proteins, such as p73, a transcription factor, ultimately leading to apoptosis. The effect of etoposide has been well characterized in different models in vitro and in vivo, and the contribution of ADAM17 and ADAM10 in etoposide-induced apoptosis using two germ cell-like cell lines has been demonstrated (Lizama et al., 2011). The Chinese mitten crab (Eriocheir sinensis) is very popular in China and abroad, not only for its delicious taste and high nutritional value, but also for its medicinal effects. In addition, it is an important aquaculture species in Southeast Asia (Zhang et al., 2011) and is also often employed as a model organism of Brachyura in reproductive studies (Jiang et al., 2009; Wang et al., 2013). However, with largescale farming, the germplasm of crabs is degrading and causing huge economic loss. The ADAM family not only plays a role in sperm and egg adhesion and fusion, but also in the regulation of sperm quality, which must be guaranteed for normal fertilization (Seals and Courtneidge, 2003). At present, research of ADAM proteins has focused on mammalian and model species, however, little study on the expression and function of ADAM in crustaceans. Is the activation of ADAM10 and ADAM17 involved in germ cell apoptosis under DNA-damaging agents in E. sinensis as in mammals? In light of ADAMs' roles in reproduction, we cloned the full-length cDNA of ADAM10 and ADAM17 and explored their potential role in the spermatogenesis in E. sinensis. 2. Materials and methods 2.1. Experimental animals and tissues All animal procedures were performed according to protocols approved by the Biological Studies Animal Care and Use Committee, Shanghai, P.R. China. Healthy adult Chinese mitten crabs were purchased from the Shanghai aquaculture farm from July 2012 to January 2013. Crabs were allowed to breed in a filtered and aerated freshwater environment for acclimatization. The crabs were anesthetized for 3–
5 min before they were sacrificed or injected intramuscularly with etoposide. The heart, hepatopancreas, intestines, brain, muscle, thoracic ganglia, hemolymph, stomach, testis, ovary, gill and accessory gland tissues were dissected out, flash frozen in liquid nitrogen and then stored at − 80 °C until RNA extraction. Partial testis tissues were fixed in Bouin's solution and cut into 10-μm-thick sections used for immunofluorescence analysis. For in vivo experiments, the crabs were divided into ten groups, with four healthy crabs in every group. The crabs were injected intramuscularly with different concentrations of etoposide (Abmole, Shanghai, China) (0, 30, 60, 90, 120 μM) for 12 h and sacrificed at different time points (0, 6, 12, 18, and 24 h) at 90 μM etoposide. The testis tissues were isolated, frozen and stored at −80 °C for RNA extraction and western blotting. 2.2. RNA extraction Total RNA was isolated from frozen tissues using TRIzol (Invitrogen, California, USA) and quantified based on the absorbance at 260 nm; agarose gel electrophoresis was used to check the integrity of RNA. 2.3. Cloning, bioinformatics analysis, sequence alignment and phylogenetic analysis of ADAM10 and ADAM17 in E. sinensis First strand cDNA was synthesized from 2 μg purified total RNA using the First strand cDNA synthesis kit (TaKaRa, Japan) according to the manufacturer's instructions. The initial cDNA fragments of ADAM10 and ADAM17, obtained from the testes and accessory gland transcriptome (He et al., 2012, 2013), were confirmed using specific primers (Table 1) designed by Primer Premier 5.0 software. The 3′ and 5′ ends of Es-ADAM10 and Es-ADAM17 were then obtained using the rapid amplification of cDNA ends (RACE) method. The primers used are listed in Table 1. Polymerase chain reaction (PCR) was performed in a 25-μL volume with 12.5 μL Taq™ Hot Start premix (TaKaRa), 1 μL 10 μM of each primer, 1 μL of cDNA and 9.5 μL ddH2 O. The PCR conditions were 5 cycles of 94 °C for 30 s, 72 °C for 3 min; 5 cycles of 94 °C for 30 s, 66 °C for 30 s, 72 °C for 3 min; 25 cycles of 94 °C for 30 s, 62 °C for 30 s, 72 °C for 3 min; and 72 °C for 7 min for the final extension step. The purified amplification products were cloned into vector pZeroBack/blunt (Tiangen, Beijing, China), transformed into
Table 1 Primers used in this study. Primer name
Sequences 5′–3′
PCR ADAM10-F ADAM10-R ADAM17-F ADAM17-R ADAM10-5′ ADAM10-3′ ADAM17-5′ ADAM17-3′ UPM-short UPM-long
GACCGCACCACTTGTAAC CACCTTCGTCCCCTCAT GACGGTTCTGGTAATGAGCG TCTCCTTGAAGAAGCGATA AGTTCAAGATGTGGTGGAGCG TGTCTTCCAAAAGTGTCGTGCTGTG AGACAGCAGGCAGAGGCATACAACT CAACTTCCAGCAGTCTCGGGTCAT CTAATACGACTCACTATAGGGC CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT
QRT-PCR ADAM10-F ADAM10-R ADAM17-F ADAM17-R β-Actin-F β-Actin-R
GCACCACTTGTAACTTTGTC GGTTGCCGCCAAAGATA TGGTGGAGCGTTTCTGGGACAT GATGTCCCAGAAACGCTCCAC CTCCTGCTTGCTGATCCACATC GCATCCACGAGACCACTTACA
Sequencing T7 primer SP6 primer
TAATACGACTCACTATAGG ATTTAGGTGACACTATAGAA
Q. Li et al. / Gene 562 (2015) 117–127
competent E. coli Top10 cells (Tiangen), and sequenced in both directions, using T7 and SP6 primers, by Sangon Biotech Co. Ltd (Shanghai, China). The Es-ADAM10 and Es-ADAM17 full cDNA sequences were deposited into GenBank with accession numbers KF732871 and KC007532, respectively. The ORFs were detected using the National Center for Biotechnology Information (NCBI) ORF Finder tool (http://www. ncbi.nlm.nih.gov/projects/gorf/). The Simple Modular Architecture Research Tool (SMART, http://smart.embl-heidelberg.de/) was used to predict the protein domains. Signal peptide was predicted using the SignalP 4.1 Server (http://www.cbs.dtu.dk/ services/SignalP). The isoelectric point and molecular weight were predicted using ExPASy (http://web.expasy.org/protparam/). The TMpred program (http://www.ch.embnet.org/software/TMPRED_form. html/) and TMHMM Server 2.0 (http://www.cbs.dtu.dk/services/ TMHMM-2.0/) were used to detect transmembrane helices, and to calculate hydrophobicity and hydrophilicity. Multiple alignments of the EsADAM10 and Es-ADAM17 using the ClustalX multiple alignment program and the phylogenetic analyses of Es-ADAM10 and Es-ADAM17 were carried out using the MEGA5.1 software with 1000 bootstrap repeats (Takasuga et al., 2007). 2.4. Quantitative real-time reverse transcription PCR analysis of EsADAM10 and Es-ADAM17 mRNA expression QRT-PCR was used to explore the expression pattern of EsADAM10 and Es-ADAM17 mRNAs in various tissues and during testis development; every tissue had five samples and three replicates per sample. The Chinese mitten crab β-actin (HM053699.1) gene was used to calibrate the cDNA template as an internal control. Firststrand cDNA was carried out using a One Step SYBR® PrimeScript™ RT-PCR kit (TaKaRa). QRT-PCR was carried out on a CFX96™ realtime system (Bio-Rad) and each sample was run in a total volume of 25 μL with 12.5 μL SYBR® Premix Ex Taq™ II (2 ×) (TaKaRa), 1 μL of each PCR Primer (10 μM), 1 μL of diluted cDNA, and 9.5 μL ddH2 O. Primer Premier 5.0 software designed a pair of primers (Table 1) based on the conserved regions of Es-ADAM10 and EsADAM17, respectively. The PCR program was 95 °C for 3 min; followed by 40 cycles of 95 °C for 10 s, 60 °C for 30 s, 65 °C for 5 s, and 95 °C for 5 s. Dissociation curve analysis was performed at the end of each PCR reaction to verify the amplification of a single product. The 2− ΔΔCt method was used to analyze the relative expression levels of Es-ADAM10 and Es-ADAM17 (Livak and Schmittgen, 2001). All data are presented as means ± standard deviation, and were evaluated by one-way analysis of variance (ANOVA) using the SPSS 17.0 program. Differences were considered statistically significant at P b 0.05. 2.5. Western blotting analysis of Es-ADAM10 and Es-ADAM17 proteins expression Total proteins extracted from different tissues were prepared using a whole protein extraction kit (Sangon Biotech), and the protein concentration was determined using a BCA Protein Assay kit (Beyotime, Jiangsu, China). The protein homogenates (500 μg) was separated on a 10% SDS-PAGE gel and transferred to a methanol-activated polyvinylidene fluoride membrane (PVDF, CWBIO, Beijing, China) by electroblotting. The membrane was then blocked with 5% Bovine Serum Albumin (BSA, CWBIO) in 10 mM PBST (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2nM KH2PO4, 1 mM 20% Tween-20) for 2 h at room temperature, before being incubated with primary antibodies ADAM10 (source of rabbit) (1/500 dilution, bs-3574R, Bioss, China) and ADAM17 (source of rabbit) (1/500 dilution, bs-4236R, Bioss, China), respectively. As a negative control for the specificity, the anti-ADAM10 and antiADAM17 antisera were further preadsorbed with excessive corresponding immunogen (data not shown). As a loading control,
119
membranes were also incubated with anti-β-actin monoclonal antibodies (source of mouse) (1/1000 dilution, 60008-1-lg, Proteintech, USA) overnight at 4 °C. After washing, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody (1/1000 dilution, CWBIO) for 1 h at 37 °C. Immunoreactive bands were revealed using cECL western blotting kit (CWBIO), according to the manufacturer's instructions. The relative protein expression levels of Es-ADAM10 and Es-ADAM17 were analyzed using the Grey value method (Wang et al., 2012). 2.6. Immunofluorescence The spatial distribution of Es-ADAM10 and Es-ADAM17 proteins was determined using immunofluorescence. Paraffin-embedded sections of the testis tissue was dewaxed, incubated with xylene twice for every 5 min, with absolute ethyl alcohol twice for 5 min, with 95%, 85% and 75% ethyl alcohol for 5 min, respectively, and with ddH2O for 10 min. The sections were boiled for 10 min in 10 mM sodium citrate buffer (pH 6.0) for antigen retrieval and blocked in goat serum (SP-9001, SUNBIO) for 15 min at room temperature. The sections were then incubated with primary antibodies ADAM10 (1/100 dilution) and ADAM17 (1/100 dilution) overnight at 4 °C, respectively. The sections were then incubated with fluorescein isothiocyanate (FITC)-conjugated secondary antibody at a dilution of 1:100 for 1 h at room temperature. After washing three times in PBS for 10 min, the sections were counterstained with HelixGen Anti-fade Fluorescence Mounting Medium containing 4,6-diamidino-2-phenylindole (DAPI), a nuclear counterstain, and observed under a fluorescence microscope (Leica, Germany). 3. Results 3.1. Characterization of Es-ADAM10 and Es-ADAM17 full-length cDNA The complete sequence of Es-ADAM10 cDNA contained a 5′ UTR of 100 bp, a 3′ UTR of 409 bp, and an ORF of 2790 bp, encoding a polypeptide of 929 amino acids (Fig. 1A). The predicted molecular weight of EsADAM10 was 103.6 kDa and its isoelectric point (pI) was 6.99. The EsADAM17 full-length cDNA contained a 5′ UTR of 102 bp, a 3′ UTR of 207 bp with a poly(A) tail, and an ORF of 2274 bp encoding a 757 amino acid (Fig. 1B). The predicted molecular weight of Es-ADAM17 was 86.8 kDa and isoelectric point (pI) was 5.78. SignalP software analysis revealed that the deduced protein of Es-ADAM10 contained a putative signal peptide (11–165 nt). SMART analysis indicated that Es-ADAM10 contained the metalloprotease domain (302–486 nt), a disintegrin domain (558–653 nt), a cysteine-rich domain (575–683 nt), an epidermal growth factor repeat sequence (658–712 nt) and transmembrane domains (778–800 nt) (Fig. 2A). Es-ADAM17 also contained a putative signal peptide (11–165 nt), a metalloprotease domain (305–457 nt), a disintegrin domain (494–57 nt), a cysteine-rich domain (597–619 nt), an epidermal growth factor repeat sequence (544–579 nt) and transmembrane domains (678–700 nt) (Fig. 2B). Thus, the structures of EsADAM10 and Es-ADAM17 were typical of the ADAM family. In addition, the presence of putative transmembrane regions in Es-ADAM10 and EsADAM17 indicated that both proteins were integral membrane proteins (Fig. 3). 3.2. Multiple alignment and phylogenetic analysis of Es-ADAM10 and EsADAM17 The amino acid sequences of Es-ADAM10 and Es-ADAM17 shared homology with other reported ADAM10 and ADAM17 proteins. EsADAM10 shared 63% identity with that of Ceratitis capitata, 60% identity with that of Acyrthosiphon pisum, 56% identity with that of Apis florea, 54% identity with that of Harpegnathos saltator, 44% identity with that of
120
Q. Li et al. / Gene 562 (2015) 117–127
ADAMs conserved in other species, were also found in Es-ADAM10 (Fig. 4A, B) and Es-ADAM17 (Fig. 4C, D). A neighbor-joining phylogenetic tree was constructed based on the amino acid sequences of EsADAM10 and Es-ADAM17 and those of other species. Es-ADAM10 and Es-ADAM17 were firstly clustered with insects, and then clustered with vertebrate (Fig. 5), which agreed with the traditional taxonomy. 3.3. The expression pattern of Es-ADAM10 and Es-ADAM17 in E. sinensis The qRT-PCR results showed that Es-ADAM10 and Es-ADAM17 mRNAs were distributed in the heart, hepatopancreas, intestines, brain, muscle, thoracic ganglia, hemolymph, stomach, testis, ovary, gill and accessory gland. Both Es-ADAM10 and Es-ADAM17 mRNAs were highly expressed in the muscle, and relatively high in the testis, ovary and accessory gland. Furthermore, Es-ADAM17 mRNA was abundant in the hepatopancreas (Fig. 6A). In addition, qRT-PCR results of EsADAM10 and Es-ADAM17 mRNA expression patterns during testis development showed that the Es-ADAM17 mRNA level was detected in every stage of testis development, with relatively high expression from July to September, the lowest during October and November, then increased from December to January, and reached a peak in January. However, the Es-ADAM10 mRNA level remained steady during testis development (Fig. 6B). Immunofluorescence was used to examine the distribution of Es-ADAM10 and Es-ADAM17 proteins in the testis. Both Es-ADAM10 and Es-ADAM17 proteins were mainly located in the cytoplasm and cytomembrane of spermatocyte. Furthermore, according to histological analysis of hematoxylin–eosin staining, positive signal of Es-ADAM17 was higher than the level of Es-ADAM10 in mature sperm (Fig. 7). 3.4. Expression changes of Es-ADAM10 and Es-ADAM17 induced by etoposide in E. sinensis
Fig. 1. Nucleotide and deduced amino acid sequences of Es-ADAM10 (A) and EsADAM17 (B) genes. An asterisk (*) indicates the stop codon; the light gray region indicates the metalloproteinase-like domain; the underline region indicates the disintegrin-like domain; the red region indicates the cysteine-rich domain; the yellow region is the epidermal growth factor-like domain; the blue region is the transmembrane domain; and the end region is the cytoplasmic tail domain.
Crassostrea gigas, and 41% identity with that of Saccoglossus kowalevskii. Es-ADAM17 shared 66% identity with those of C. capitata, Tribolium castaneum and Bombyx mori, 65% identity with those of Aedes aegypti and Bombus impatiens, 63% identity with that of Drosophila melanogaster and 42% identity with that of Pseudopodoces humilis. The metalloprotease and disintegrin domains, two highly conserved and important domains of
The qRT-PCR results indicated that the Es-ADAM10 mRNA level decreased at 30 μM etoposide and showed no significant change at 60 μM, compared with the control. Its level increased significantly and reached a peak at 90 μM etoposide; however, its level decreased at 120 μM. Es-ADAM17 showed no significant change under 30 μM etoposide compared with the control. Thereafter, the Es-ADAM17 mRNA level increased with increasing concentrations of etoposide: its level was six times that of the control at 90 μM etoposide. The EsADAM17 mRNA level decreased significantly at 120 μM compared with its level at 90 μM, but was still higher than the level of the control (Fig. 8A). The Es-ADAM10 protein level increased slowly with increasing concentration of etoposide, showing no change at 30 μM, a significant increase at 60 μM, but no significant change at 90 and 120 μM, compared with the level at 60 μM. However, the EsADAM17 protein expression pattern was different. With increasing concentration of etoposide, the Es-ADAM17 protein level continued to increase, reaching a peak at 120 μM (Fig. 8B). The level of Es-ADAM10 and Es-ADAM17 were both high at 90 μM, so we treated crabs with 90 μM etoposide for different times to detect the change of Es-ADAM10 and ES-ADAM17 at the mRNA and protein levels. The Es-ADAM10 mRNA level increased significantly to three times that of the control after 6 h and six times that of the control after 12 h. For Es-ADAM17, its level increased after 6 h and reached a peak of eight times that of the control after 12 h, before decreasing significantly after 18 h and 24 h compared with the level after 12 h (Fig. 8C). The Es-ADAM10 protein level increased obviously after 12 h and reached a peak after 18 h, before decreasing after 24 h. However, the Es-ADAM17 protein level showed no change after 6 h and then increased significantly after 12 h, reached its peak after 18 h, before decreasing after 24 h compared with the level at 18 h (Fig. 8D).
Q. Li et al. / Gene 562 (2015) 117–127
121
Fig. 2. Es-ADAM10 and Es-ADAM17 contain conserved domains of the ADAM family. The numbers correspond to the first amino acid that delimits each domain, which were illustrated using the DOG 2.0 software.
Fig. 3. The predicted transmembrane regions of Es-ADAM10 (A) and Es-ADAM17 (B). Horizontal axis represents the number of amino acids. Longitudinal axis represents the probability of prediction. Both Es-ADAM10 and Es-ADAM17 only have one transmembrane region (red part). The pink part is the outside region and the blue part is the inside region.
122
Q. Li et al. / Gene 562 (2015) 117–127
4. Discussion In present study, the full-length cDNAs of Es-ADAM10 and Es-ADAM17 genes were cloned, and the predicted proteins both contained conserved
domains of the ADAM family (Figs. 1, 2). However, the sequences of conserved domains differed. The metalloprotease sequence of ADAM10 in invertebrates, including E. sinensis, is HEIGHNFGSPHD (Fig. 4A), whereas the sequence is HEVGHNFGSPHD in vertebrates. In invertebrates, the metalloprotease sequence of ADAM17 is HEFGHNWGSEHD (Fig. 4C), while the sequence is HELGHNFGAEHD in vertebrates. Furthermore, the disintegrin sequence also varies; it is GEECD of ADAM10 of invertebrates (Fig. 4B) and GEQCD in vertebrates, such as Anas and Brachyuromys betsileoensis. The disintegrin sequence of ADAM17 is QEECD in invertebrates, but DEECD in golden bees and GEECD in vertebrates (Fig. 4D). It was thought that the sequence of the conserved domains of different subtypes of ADAM family vary and have undergone mutation in different species; however, the last three amino acids, ECD, of the disintegrin domain were completely conserved, which ensured its stability and activity (Zhu and Evans, 2002). Therefore, we can distinguish different subtypes of the ADAM family initially according to the sequence of the conserved domains. The multiple sequence alignment results showed that Es-ADAM10 or Es-ADAM17 shared high levels of sequence identity with insects and some invertebrates. These genes and proteins have not been reported in shrimps or other crabs; therefore, this study provided a reference for the study of ADAM family in Brachyuran. Phylogenetic analysis showed that Es-ADAM10 and Es-ADAM17 were clustered in two branches, respectively, with respective subtypes of invertebrates clustered into one group, consistent with the traditional taxonomy (Fig. 5). The expressions of these two proteins in the Chinese mitten crab were similar to those in mammals, e.g. ADAM10 was first reported distributed in the chicken embryonic epidermis, somites of sarcomere, gut endoderm, kidney, liver, heart and epithelial tissue of nerve cells (Hall and Erickson, 2003), and high levels of ADAM17 were observed in the testis, ovary, heart, placenta, lung and spleen (Sahin et al., 2004). The qRT-PCR results showed that Es-ADAM10 and Es-ADAM17 mRNAs were distributed in all assayed tissues (Fig. 6A). The ubiquitous distribution of Es-ADAM10 and EsADAM17 (such as in the hepatopancreas, intestines, brain, muscle, thoracic ganglia, hemolymph, stomach, testis, ovary, gill and accessory gland) imply that they play important roles in protein hydrolysis, inflammatory response and signal transduction. In addition, the qRT-PCR results showed that Es-ADAM10 and Es-ADAM17 are highly expressed in the testis, accessory gland and related gonadal tissues (Fig. 6A), suggested that the two genes may also be involved in the reproductive process of E. sinensis, as in mammals (Moreno et al., 2011). The expression patterns of Es-ADAM10 and Es-ADAM17 mRNAs during testis development were further analyzed. The qRTPCR results showed that Es-ADAM17 mRNA was steady in July, August and September (Fig. 6B), which represents the spermatocyte stage and the early spermatid stage with meiosis (Du et al., 1988), implying that Es-ADAM17 might be involved in the meiotic and cell migration, and thus in the spermatogenesis of E. sinensis. In October and November, the period representing the end of spermatid stage and sperm stage, when the sperm are formed and gradually mature (Du et al., 1988), the level of Es-ADAM17 mRNA decreased significantly (Fig. 6B), suggesting that the regulation by Es-ADAM17 in
Fig. 4. Multiple alignment of the ADAM10 and ADAM17 amino acid sequences from E. sinensis and other species. (A) Multiple sequence alignment of the metalloproteinase domain of Es-ADAM10 with corresponding structures of other species. (B) Multiple sequence alignment of the disintegrin domain of Es-ADAM10 with corresponding structures of other species. (C) Multiple sequence alignment of the metalloproteinase domain of Es-ADAM17 with corresponding structures of other species. (D) Multiple sequence alignment of the disintegrin domain of Es-ADAM17 with corresponding structures of other species. Red boxes indicate the metalloproteinase domain and disintegrin domain, respectively.
Q. Li et al. / Gene 562 (2015) 117–127
123
Fig. 5. Phylogenetic tree of the amino acid sequences of ADAM10 and ADAM17 from E. sinensis and other species. The neighbor-joining phylogenetic tree was constructed utilizing the sequence analysis tool MEGA 5.1. The numbers at the nodes represent percent bootstrap support for the phylogeny. Red and blue triangles represent the ADAM10 and ADAM17 from E. sinensis, respectively.
this period decreased. However, the level of Es-ADAM17 mRNA increased significantly in December and January (Fig. 6B), suggesting that this gene might participate in the regulation of late sperm quality or capacitation and the acrosome reaction (Deuss et al., 2008; Lizama et al., 2010, 2011, 2012). However, the level of Es-ADAM10
mRNA was constant during testis development, suggesting that this gene may be involved in the regulation at the protein level. Immunofluorescence showed that Es-ADAM10 and Es-ADAM17 proteins were mainly distributed in the cytoplasm and cell membrane of spermatocyte (Fig. 7), which fitted with the result generated by the
124
Q. Li et al. / Gene 562 (2015) 117–127
Fig. 6. QRT-PCR analysis of the relative expression levels of Es-ADAM10 and Es-ADAM17 mRNAs in different tissues and at different stages of testis development. (A) Relative expression levels of Es-ADAM10 and Es-ADAM17 mRNAs in different tissues. The horizontal axis represents 12 tissues sampled in September. Es-ADAM10 mRNA level in the heart, hepatopancreas, intestine, cranial ganglia, muscle, thoracic ganglions, hemocytes, stomach, testis, ovary and accessory gonad was normalized to that of the gill, however, EsADAM17 mRNA level in the hepatopancreas, intestine, cranial ganglia, muscle, thoracic ganglions, hemocytes, stomach, testis, ovary, gills and accessory gonad was normalized to that of the heart. (B) Relative expression levels of Es-ADAM10 and Es-ADAM17 mRNAs at different developmental stages in the testis. The horizontal axis represents seven developmental stages of the testis. Es-ADAM10 and Es-ADAM17 mRNA levels in different developmental stages of the testis were both normalized to that of October. The bars represent the mean ± SEM (n = 5). Significant differences of different developmental stages (P b 0.05) were analyzed by one-way analysis of variance (ANOVA) and indicated by lowercase letters (a, b and c).
Q. Li et al. / Gene 562 (2015) 117–127
125
Fig. 7. Immunofluorescence analysis of the distribution of Es-ADAM10 and Es-ADAM17 proteins in the testis. Nuclei were stained blue by DAPI (A1–A2). Subcellular localization of Es-ADAM10 (B1) and Es-ADAM17 (B2). The merged images (C1–C2) were analyzed by ImageJ 2 × software. The insets in C1 and C2 are higher magnification images of the boxed areas within each corresponding image. Hematoxylin–eosin staining (D1–D2) was performed from the same testis tissue. sc1: primary spermatocyte; sc2: secondary spermatocyte; st: spermatid. Bar = 0.1 mm.
TMHMM Server 2.0 that both proteins had the transmembrane domains (Fig. 3). Furthermore, Es-ADAM10 and Es-ADAM17 proteins were detected in the sperm (Fig. 7B1, B2), and signal of Es-ADAM17 was higher than that of Es-ADAM10, suggesting that both Es-ADAM17 and Es-ADAM10 participated in the sperm spermatogenesis. In mammals, etoposide is often used as an anticancer therapy, where its interaction with topoisomerase causes the fracture of DNA topology, resulting in apoptosis through p53-dependent interrupting of metaphase (Sturgeon et al., 2008; Wu et al., 2011). ADAM17 was one of the first elements reported to trigger physiological germ cell apoptosis during the first wave of spermatogenesis (Lizama et al., 2011). In line with that etoposide-induced apoptosis and upregulation of ADAM17 and ADAM10 in GC-1 and GC-2 male germ cells in vitro (Lizama et al., 2010), the Es-ADAM10 and Es-ADAM17 levels increased gradually at the mRNA and protein levels with increasing concentrations of etoposide; however, the expression pattern of Es-ADAM10 was different from Es-ADAM17. The level of Es-ADAM10 mRNA was decreased at 30 μM etoposide compared with the control (Fig. 8A), suggesting that Es-ADAM10 may be involved in the defense process in vivo at low etoposide concentrations, by the inhibition of spermatid apoptosis. However, the Es-ADAM10 mRNA level increased significantly at 90 μM (Fig. 8A), indicating that Es-ADAM10 might also participate in the regulation of sperm quality. The Es-ADAM10 protein accumulated with etoposide concentration increasing (Fig. 8B). In addition, Es-ADAM10 reached peak at both the mRNA (Fig. 8C) and protein (Fig. 8D) levels after 12 h with 90 μM etoposide, indicating that etoposide induced EsADAM10 in a time- and concentration-dependent manner. Low concentrations of etoposide had no effect on the level of Es-ADAM17 mRNA; however, its level increased as the etoposide concentration increased, reaching a peak at 90 μM (Fig. 8A). Es-ADAM17 protein increased significantly with etoposide concentration (Fig. 8B) and the upward trend was more obvious than that of Es-ADAM10, suggesting that ADAM17 is more sensitive to etoposide than ADAM10. Thus, etoposide's induction of Es-ADAM17 was also time- and concentration-dependent. In conclusion, we demonstrated that Es-ADAM10 and Es-ADAM17 are related with the apoptosis of spermatocyte in E. sinensis, mainly
in the regulation of sperm quality. The Es-ADAM10 and Es-ADAM17 levels responded differently to the administration of etoposide, suggesting that the regulation mechanism of ADAM10 and ADAM17 in germ cell apoptosis is different. ADAM10 showed “inactive” (expression is constant during testis development) may be just assisted on the function of ADAM17, which needs further study.
Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (No. 41376157, No. 31201974 and No. 31172393), the Shanghai Natural Science Fund Committee (No. 12ZR1408900) and the Doctoral Fund of Ministry of Education (No. 20120076120011). Thank for the support of the public experimental platform of School of Life Science in East China Normal University.
References Blobel, C.P., 1997. Metalloprotease-disintegrins: links to cell adhesion and cleavage of TNF-α and Notch. Cell 90, 589–592. Blobel, C.P., 2005. ADAM: key components in EGFR signaling and development. Nat. Rev. Mol. Cell Biol. 6, 32–43. Blobel, C.P., Wolfsberg, T.G., Turck, C.W., Myles, D.G., Primakoff, P., White, J.M., 1992. A potential fusion peptide and an integrin ligand domain in a protein active in sperm–egg fusion. Nature 356, 248-25. Cho, C., Bunch, D.O., Faure, J.E., Goulding, E.H., Eddy, E.M., Primakoff, P., Myles, D.G., 1998. Fertilization defects in sperm from mice lacking fertilin beta. Science 281, 1857–1859. Deuss, M., Reiss, K., Hartmann, D., 2008. Part-time-secretases: the functional biology of ADAM 9, 10 and 17. Curr. Alzheimer Res. 5 (2), 187–201. Du, N.S., Xue, L.Z., Lai, W., 1988. Histology of the male reproductive system in Eriocheir sinensis (Decapoda, Crustacea). Acta Zool. Sin. 34 (4), 329–333. Galan, J.J., De Felici, M., Buch, B., Rivero, M.C., Segura, A., Royo, J.L., Cruz, N., Real, L.M., Ruiz, A., 2006. Association of genetic markers within the KIT and KITLG genes with human male infertility. Hum. Reprod. 21, 3185–3192. Hall, R.J., Erickson, C.A., 2003. ADAM 10: an active metalloprotease expressed during avian epithelial morphogenesis. Dev. Biol. 256 (1), 147–160. Han, C., Park, I., Lee, B., Jin, S., Choi, H., Kwon, J.T., Kwon, Y.I., Kim do, H., Park, Z.Y., Cho, C., 2011. Identification of heat shock protein 5, calnexin and integral membrane protein 2B as Adam7-interacting membrane proteins in mouse sperm. J. Cell. Physiol. 226, 1186–1195.
126
Q. Li et al. / Gene 562 (2015) 117–127
A
B
C
D
Fig. 8. Changes in Es-ADAM10 and Es-ADAM17 at the mRNA and protein expression levels induced by etoposide in the testis. (A) Changes in Es-ADAM10 and Es-ADAM17 mRNA expression levels with different concentrations of etoposide. (B) Changes in Es-ADAM10 and Es-ADAM17 protein expression levels with different concentrations of etoposide. (C) Changes in EsADAM10 and Es-ADAM17 mRNA expression levels induced by etoposide for different periods. (D) Changes in Es-ADAM10 and Es-ADAM17 protein expression levels induced by etoposide for different periods.
He, L., Wang, Q., Jin, X.K., Chen, L.L., Liu, L.H., Wang, Y., 2012. Transcriptome profiling of testis during sexual maturation stages in Eriocher sinensis using Illumina sequencing. PLoS ONE 7 (3), e33735. He, L., Jiang, H., Cao, D.D., Liu, L.H., Hu, S.N., Wang, Q., 2013. Comparative transcriptome analysis of the accessory sex gland and testis from the Chinese mitten crab (Eriocheir sinensis). PLoS ONE 8 (1), e53915. Huovila, A.P., Almeida, E.A., White, J.M., 1996. ADAMs and cell fusion. Curr. Opin. Cell Biol. 8, 692–699. Jiang, H., Cai, Y.M., Chen, L.Q., Zhang, X.W., Hu, S.N., Wang, Q., 2009. Functional annotation and analysis of expressed sequence tags from the hepatopancreas of mitten crab (Eriocheir sinensis). Mar. Biotechnol. 11, 317–326.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(−delta delta C(T)) method. Methods 25, 402–408. Lizama, C., Rojas-Benítez, D., Antonelli, M., Ludwig, A., Bustamante-Marín, X., BrouwerVisser, J., Moreno, R.D., 2010. TACE/ADAM17 is involved in germ cell apoptosis during rat spermatogenesis. Reproduction 140 (2), 305–317. Lizama, C., Ludwig, A., Moreno, R.D., 2011. Etoposide induces apoptosis and upregulation of TACE/ADAM17 and ADAM10 in an in vitro male germ cell line model. Biochim. Biophys. Acta Mol. Cell. Res. 1813 (1), 120–128. Lizama, C., Rojas-benitez, D., Antonelli, M., Ludwig, A., Moreno, R.D., 2012. Involvement of TACE/ADAM17 and ADAM10 in etoposide-induced apoptosis of germ cells in rat spermatogenesis. J. Cell. Physiol. 227 (2), 829–838.
Q. Li et al. / Gene 562 (2015) 117–127 Moreno, R.D., Urriola-Muñoz, P., Lagos-Cabré, R., 2011. The emerging role of matrix metalloproteases of the ADAM family in male germ cell apoptosis. Spermatogenesis 1 (3), 195–208. Primakoff, P., Myles, D.G., 2000. The ADAM gene family: surface proteins with adhesion and protease activity. Trends Genet. 16, 83–87. Primakoff, P., Hyatt, H., Tredick-Kline, J., 1987. Identification and purification of a sperm surface protein with a potential role in sperm–egg membrane fusion. J. Cell Biol. 104, 141–149. Sahin, U., Weskamp, G., Kelly, K., Zhou, H.M., Higashiyama, S., Peschon, J., Hartmann, D., Safting, P., Blobel, C.P., 2004. Distinct roles for ADAM10 and ADAM17 in ectodomain shedding of six EGFR ligands. J. Cell Biol. 164 (5), 769–779. Seals, D.F., Courtneidge, S.A., 2003. The ADAMs family of metalloproteases: multidomain proteins with multiple functions. Genes Dev. 17, 7–30. Sturgeon, C.M., Duffy, M.J., Stenman, U.H., Lilja, H., Brünner, N., Chan, D.W., Babaian, R., Bast Jr., R.C., Dowell, B., Esteva, F.J., et al., 2008. National Academy of Clinical Biochemistry laboratory medicine practice guidelines for use of tumor markers in testicular, prostate, colorectal, breast, and ovarian cancers. Clin. Chem. 54 (12), e11–e79. Takasuga, A., Watanabe, T., Mizoguchi, Y., Hirano, T., Ihara, N., Takano, A., Yokouchi, K., Fujikawa, A., Chiba, K., Kobayashi, N., Tatsuda, K., Oe, T., Furukawa-Kuroiwa, M., Nishimura-Abe, A., Fujita, T., Inoue, K., Mizoshita, K., Ogino, A., Sugimoto, Y., 2007. Identification of bovine QTL for growth and carcass traits in Japanese Black cattle by replication and identical-by-descent mapping. Mamm. Genome 18, 125–136. Wang, Y.M., Lin, X.F., Shi, C.M., Lu, L., Qin, Z.Y., Zhu, G.Z., Cao, X.G., Ji, C.B., Qiu, J., Guo, X.R., 2012. Alpha-lipoic acid protects 3T3-L1 adipocytes from NYGGF4 (PID1) overexpression-induced insulin resistance through increasing phosphorylation of IRS-1 and Akt. J. Bioenerg. Biomembr. 44, 357–363.
127
Wang, J., Fang, D.A., Wang, Y., Wang, Y.L., Cheng, L., He, L., Wang, Q., 2013. Cathepsin A protein from the accessory sex gland of the Chinese mitten crab (Eriocheir sinensis) plays a key role in spermatophore digestion. J. Insect Physiol. 59, 953–960. Wolfsber, T.G., White, J.M., 1996. ADAMs in fertilization and development. Dev. Biol. 180, 389–401. Wolfsberg, T.G., Bazan, J.F., Blobel, C.P., Myles, D.G., Primakoff, P., White, J.M., 1993. The precursor region of a protein active in sperm–egg fusion contains a metalloprotease and a disintegrin domain: structural, functional, and evolutionary implications. Proc. Natl. Acad. Sci. 90, 10783–10787. Wolfsberg, T.G., Primakoff, P., Myles, D.G., White, J.M., 1995a. ADAM, a novel family of membrane proteins containing a disintegrin and metalloprotease domain: multipotential functions in cell–cell and cell–matrix interactions. J. Cell Biol. 131, 275–278. Wolfsberg, T.G., Straight, P.D., Gerena, R.L., Huovila, A.P., Primakoff, P., Myles, D.G., White, J.M., 1995b. ADAM, a widely distributed and developmentally regulated gene family encoding membrane proteins with a disintegrin and metalloprotease domain. Dev. Biol. 169, 378–383. Wu, C.C., Li, T.K., Farh, L., Lin, L.Y., Lin, T.S., Yu, Y.J., Yen, T.J., Chiang, C.W., Chan, N.L., 2011. Structural basis of type II topoisomerase inhibition by the anticancer drug etoposide. Science 333 (6041), 459–462. Zhang, Y.C., Sun, Y., Liu, Y.C., Geng, X.Y., Wang, X.H., Wang, Y.F., Sun, J.S., Yang, W.J., 2011. Molt-inhibiting hormone from Chinese mitten crab (Eriocheir sinensis): cloning, tissue expression and effects of recombinant peptide on ecdysteroid secretion of YOs. Gen. Comp. Endocrinol. 173, 467–474. Zhu, X.L., Evans, J.P., 2002. Analysis of the roles of RGD-binding intergrins, α4/α9 integrins, α6 integrins, and CD9 in the interaction of the fertilin β (ADAM2) disintegrin domain with the mouse egg membrane. Biol. Reprod. 66 (4), 1193–1202.