Identification and characterization of Tube in the Chinese mitten crab Eriocheir sinensis

Gene 541 (2014) 41–50

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Identification and characterization of Tube in the Chinese mitten crab Eriocheir sinensis Ai-Qing Yu, Xing-Kun Jin, Min-Hao Wu, Xiao-Nv Guo, Shuang Li, Lin He, Wei-Wei Li ⁎, Qun Wang ⁎ School of Life Science, East China Normal University, Shanghai, China

a r t i c l e

i n f o

Article history: Accepted 6 March 2014 Available online 11 March 2014 Keywords: Chinese mitten crab Innate immunity Toll signaling Tube

a b s t r a c t As a key component of the Toll signaling pathway, Tube plays central roles in many biological activities, such as survival, development and innate immunity. Tube has been found in shrimps, but has not yet been reported in the crustacean, Eriocheir sinensis. In this study, we cloned the full-length cDNA of the adaptor Tube for the first time from E. sinensis and designated the gene as EsTube. The full-length cDNA of EsTube was 2247-bp with a 1539-bp open reading frame (ORF) encoding a 512-amino acid protein. The protein contained a 116-residue death domain (DD) at its N-terminus and a 272-residue serine/threonine-protein kinase domain (S_TKc) at its C-terminus. Phylogenetic analysis clustered EsTube initially in one group with other invertebrate Tube and Tube-like proteins, and then with the vertebrate IRAK-4 proteins, finally with other invertebrate Pelle proteins. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis results showed that EsTube was highly expressed in the ovary and testis, and moderately expressed in the thoracic ganglia and stomach. EsTube was expressed at all selected stages and was highly expressed in the spermatid stage (October, testis) and the stage III-2 (November, ovary). EsTube was differentially induced after injection of lipopolysaccharides (LPS), peptidoglycan (PG) or zymosan (β-1,3-glucan). Our study indicated that EsTube might possess multiple functions in immunity and development in E. sinensis. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Invertebrates lack antibodies and complements, but can initiate a rapid and effective response to pathogenic organisms through an innate immune response (Uematsu and Akira, 2008). Those immunity sensors mainly include some pattern-recognition receptors (PRRs), such as Tolllike receptors (TLRs), C-type lectins, gram-negative binding proteins (GNBPs) and peptidoglycan recognition proteins (PGRPs) (Bischoff et al., 2004; Royet, 2004). Those PPRs can recognize conserved pathogen-associated molecular patterns (PAMPs) (Kawai and Akira, 2010), including lipopolysaccharide (LPS) from gram-negative bacteria, peptidoglycan (PG) from gram-positive bacteria, double-stranded RNA (dsRNA) and β-1,3-glucans from fungi (Imler and Zheng, 2004), and then induce certain evolutionarily conserved intracellular signaling cascades, especially Toll signal transduction (Imler and Hoffmann, 2001). In Drosophila, MyD88, Tube and Pelle are central to the Toll signal transduction pathway. Briefly, upon ligand binding MyD88 recruits Abbreviations: DD, death domain; dsRNA, double-stranded RNA; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GNBPs, gram-negative binding proteins; LPS, lipopolysaccharides; ORF, open reading frame; PAMPs, pathogen-associated molecular patterns; PG, peptidoglycan; PGRPs, peptidoglycan recognition proteins; PPRs, pattern-recognition receptors; RACE, rapid amplification of cDNA ends; TLRs, Toll-like receptors. ⁎ Corresponding authors at: School of Life Science, East China Normal University, No. 500 Dong-Chuan Road, Shanghai 200241, China. E-mail addresses: [email protected] (W.-W. Li), [email protected] (Q. Wang).

http://dx.doi.org/10.1016/j.gene.2014.03.009 0378-1119/© 2014 Elsevier B.V. All rights reserved.

the activated Toll receptor and the cytosolic adaptor Tube to permit Toll signaling, and then forms a trimeric complex (MyD88-Tube-Pelle) by recruiting Pelle to the vicinity of Tube. Finally, the signal is transmitted to the Dorsal/Cactus complex that regulates the Toll-dependent gene expression, such as antimicrobial peptides and many other innate immune responsive genes (Imler and Hoffmann, 2000; Tauszig et al., 2000; Wang et al., 2009). Pelle is regarded as the mammalian interleukin-1 receptor associated kinase-1 (IRAK-1) homolog, containing a death domain (DD) at its N-terminus and a catalytic kinase domain in its C-terminus. Tube, is regarded as the mammalian interleukin-1 receptor associated kinase-4 (IRAK-4) homolog and has five evolutionarily conserved eightamino acid repeats in the C-terminus in addition to an N-terminal DD (C. Li et al., 2013; Gosu et al., 2012; Towb et al., 2009). The Tube DD acts as a bridge between the death domains of MyD88 and Pelle, while the repeat-containing domain mediates the stable association of Dorsal and Tube (Towb et al., 2009). In Drosophila melanogaster, DmTube not only participates in dorsoventral axis formation during development, but also is involved in regulating diverse downstream signaling and the response against gram-positive bacteria and fungi in the Toll signaling cascade (Lemaitre et al., 1996; Wang et al., 2006). The mammalian IRAK-4 differs from DmTube by mainly being involved in immune responses to gram-negative bacterial infections (Swantek et al., 2000; Takeda and Akira, 2005). The bacterial defense function of IRAK-4 has been confirmed in IRAK-4 deficient mice, which showed increased mortality upon a bacterial infection (Suzuki et al., 2002). Recently, in the pacific white shrimp, Litopenaeus vannamei, and the mud crab, Scylla paramamosain, both

42

A.-Q. Yu et al. / Gene 541 (2014) 41–50

LvTubes and SpTube were shown to be involved in immunity against diverse pathogens to varying degrees (C. Li et al., 2013; Li et al., 2013b). However, until now, no Tube homologs have been identified and characterized in the Chinese mitten crab, Eriocheir sinensis. The Chinese mitten crab E. sinensis is one of the most important crustacean species and widely cultivated in Southeast Asia (Ying et al., 2006); however, frequent outbreaks of diseases have caused decreased production and catastrophic economic losses in the past decade (Gai et al., 2009a). Therefore, studying the structure and transcriptional responses of potential immune-related genes, such as Toll signal pathway-related genes, could provide a better understanding of the crab immune defense and recognition mechanisms, and support the sustainable development of better disease management strategies in the Chinese mitten crab farming industry. Recently, several research groups, including our own, have made efforts to screen immunerelated genes from E. sinensis by constructing cDNA libraries (Gai et al., 2009b; Guo et al., 2011; H. Zhang et al., 2011; Jiang et al., 2009a; Jin et al., 2011, 2012; Mu et al., 2010; Qin et al., 2010; Zhao et al., 2009), with the ultimate aim of designing efficient strategies for disease control. The main objectives of this current study were: (1) to clone the full-length cDNAs of EsTube from E. sinensis; (2) to investigate the mRNA expression patterns of EsTube in different tissues; (3) to detect the temporal profiles of EsTube in different developmental stages of the testis and ovary; and (4) to detect the temporal responses of EsTube in the hemocytes and hepatopancreas induced by LPS, PG and β-1,3-glucan challenge. Taken together, our results indicated that EsTube might play important roles in the development of the gonads and the innate immune response to exogenous pathogenic stimulation in E. sinensis. 2. Materials and methods 2.1. Animal immune challenge and sample collection Healthy adult Chinese mitten crabs (n = 200; 80 ± 20 g wet weight) were collected from the Tong Chuan Aquatic Product Market in Shanghai, China. Crabs were acclimatized for one week at 20–25 °C in filtered, aerated freshwater before the beginning of the experiment. To be sure of the health status of the crabs in the intermolting stage (C stage) before the experiment, we not only confirmed the external carapace (noting lesions, intact appendages and mandibles), but also determined that no infectious organisms were present evaluating hemolymph proteins, culturing hemolymphs and checking for few hemocytic encapsulations containing yeast-like cells in certain immune-related tissues, according to a previous study (Boeger et al., 2007). In addition, during and after the completed experiments, the control group was not found to have any clinical signs of infection. Crabs were immersed in an ice-water bath for 1–2 min until each was anesthetized before humanely extracting the selected tissues. All procedures for crabs were approved by the Animal Ethics and Experimentation Committee of East China Normal University (Shanghai, China) and were performed in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 8523, revised 1996) as well as in compliance with the report of the policies and regulations on animal experimentation (Drummond, 2009). Hemolymph was drawn from the hemocoel in the arthrodial membrane of the last pair of walking legs using a syringe (~2.0 mL per crab), to which was added to an equal volume of anticoagulant solution (Söderhäll and Smith, 1983) (0.1 M glucose, 30 mM citrate, 26 mM citric acid, 0.14 M NaCl and 10 mM EDTA in 100 mL double distilled water) before centrifugation at 500 ×g at 4 °C to isolate hemocytes. The other tissues (hepatopancreas, gills, muscle, stomach, intestine, testis, ovary, thoracic ganglia, brain and heart) were harvested, snap frozen in liquid nitrogen, and stored at −80 °C before nucleic acid analysis. In addition, the testis and ovary at various developmental stages from male and female crabs were obtained from July to the following January and stored as described above. For cloning and subsequent in-depth analyses,

tissues from selected crabs were pooled, and ground with a mortar and pestle before extraction. For stimulation by PAMPs, 120 crabs were divided equally into four groups. The three experimental groups were injected into the arthrodial membrane of the last pair of walking legs with approximately 100 μl of LPS (50 μg) from Escherichia coli (Sigma-Aldrich, St. Louis, MO, USA), 100 μl of PG (50 μg) from Staphylococcus aureus (Sigma-Aldrich) and 100 μl of zymosan (β-1,3-glucan) (50 μg) from Saccharomyces cerevisiae (Sigma-Aldrich) resuspended (500 μg/mL) in E. sinensis saline (ESS, 0.2 M NaCl, 5.4 mM KCl, 10.0 mM CaCl2, 2.6 mM MgCl2, 2.0 mM NaHCO3; pH 7.4). Meanwhile, the control group crabs were each administered 100 μl ESS (pH 7.4) in the same manner. Five crabs were randomly selected at each time interval of 0 (as blank control), 2, 6, 12 and 24 h after injection of each type of PAMP. Hemocytes and hepatopancreas were harvested as described above and stored at − 80 °C after the addition of 1 mL Trizol reagent (Invitrogen, Carlsbad, CA, USA) for subsequent RNA extraction. 2.2. Total RNA extraction and first-strand cDNA synthesis Total RNA was extracted from E. sinensis tissues, sampled as described in Section 2.1, using Trizol® reagent (RNA Extraction Kit, Invitrogen), according to the manufacturer's protocol. The extracted RNA was treated with DNase I (Qiagen, China) to remove potential genomic DNA contamination and purified using RNeasy Mini Kit (Qiagen). The integrity of the representative RNA samples was detected by agarose-gel electrophoresis and then quantified by UV spectrophotometry. A NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, DE) measured the total RNA concentration and purity (in duplicate), and the absorbance A260/A280 determined the purity and quality of the samples. Only the RNA samples with A260/A280 ratio between 1.8 and 2.0 were used for the analysis. Total RNA (5 μg) isolated from hemocytes was reverse transcribed using the SMARTer™ RACE cDNA Amplification kit (Clontech, Mountain View, CA, USA) for cDNA cloning. For RT-PCR and quantitative real-time RT-PCR (qRT-PCR) expression analysis, total RNA (4 μg) was reverse transcribed using the PrimeScript™ real-time PCR kit (Takara, Shiga, Japan). 2.3. Expressed sequence tag (EST) analysis and cloning of full-length EsTube cDNA A partial cDNA sequence of EsTube was obtained from the transcriptome data of the hepatopancreas (Jiang et al., 2009b; W. Zhang et al., 2011) and the testis (He et al., 2013) from E. sinensis. The EsTube partial cDNA sequence was extended using 5′ and 3′ rapid amplification of cDNA ends (RACE) (SMARTer™ RACE cDNA Amplification kit, Clontech). Gene-specific primers (Table 1) were designed based on the original cDNA sequence. The 3′ RACE PCR reaction was carried out in a total volume of 50 μl, containing 2.5 μl (800 ng/μl) of the firststrand cDNA reaction as the template, 5 μl of 10× Advantage 2 PCR buffer, 1 μl of 10 mM dNTPs, 5 μl (10 μM) of gene-specific primers (EsTube-3′ RACE, Table 1), 1 μl of Universal Primer A Mix (UPM; Clonetech, USA), 34.5 μl of sterile deionized water and 1 U 50× Advantage 2 polymerase mix (Clonetech, USA). For the 5′ RACE, UPM was used as the forward primers in PCR reactions in conjunction with reverse gene-specific primers (EsTube-5′ RACE, Table 1). PCR amplification conditions for both the 3′ and 5′ RACE were as follows: 5 cycles at 94 °C for 30 s, 72 °C for 3 min; 5 cycles at 94 °C for 30 s, 70 °C for 30 s, and 72 °C for 3 min; and 20 cycles at 94 °C for 30 s, 68 °C for 30 s, and 72 °C for 3 min. PCR amplicons were size separated and visualized on an ethidium bromide stained 1.2% agarose gel. Amplicons of the expected sizes were purified with a Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) and inserted into the pMD19T vector (Takara, Japan). Positive clones containing inserts of the expected size were sequenced using T7 and SP6 primers (Table 1).

A.-Q. Yu et al. / Gene 541 (2014) 41–50 Table 1 PCR primer sequences used for EsTube analysis. Primer name

Sequences (5′ → 3′)

5′-RACE EsTube-5′-1 EsTube-5′-2 EsTube-5′-3 EsTube-5′-4

ACCAGCCCAAAGTCACCAACC CCAGCAGCACAATGCCAAAGC CACCCGCATCATCCATTCCAG TTGATGTCTCGGTGGACCAAAGG

3′-RACE EsTube-3′-1 EsTube-3′-2 EsTube-3′-3 EsTube-3′-4 UPM-long UPM-short

GTCCTTTGGTCCACCGAGACATCA TCGCCTGCCTGGGTGGAACT TGGCATTGTGCTGCTGGAGTT TGCTGCTGGAGTTGCTGACCG CTAATACGACTCACTATAGGGCAAG CAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC

qRT-PCR EsTube-F EsTube-R β-actin-F β-actin-R GAPDH-F GAPDH-R

ATTGTGCTGCTGGAGTTGCTGAC CATCGTCGGTCGCTTCTTCTTGG GCATCCACGAGACCACTTACA CTCCTGCTTGCTGATCCACATC TGGTGGAGCCAAGAAGGTG ACGGGAGCCAGGCAGTT

Sequencing T7 SP6

TAATACGACTCACTATAGG ATTTAGGTGACACTATAGAA

2.4. Sequence analysis and phylogenetic analysis Full-length cDNAs of EsTube and the deduced amino acid sequences were compared against sequences from other representative vertebrates and invertebrates deposited in the National Center for Biotechnology Information (NCBI) GenBank, using the BLAST program (BLAST: Basic Local Alignment Search Tool). SMART (Simple Modular Architecture Research Tool, http://smart.emblheidelberg.de) identified the homologous conserved domains. The Protein Mol. Wt & AA Composition Calculator (http://www. proteomics.com.cn/proteomics/pi_tool.asp) calculated the molecular masses and theoretical isoelectric points. ClustalX and ClustalW2 programs (http://www.ebi.ac.uk/Tools/msa/clustalw2/) performed the multiple sequence alignment. MEGA5.0 software (http://www.megasoftware.net/) constructed an unrooted neighborjoining (NJ) phylogenetic tree, based on selected amino-acid sequences and the reliability of the branching was tested using bootstrap resampling (with 1000 pseudo-replicates). 2.5. Tissue distribution and the expression profiles of EsTube in hemocytes and hepatopancreas after LPS, PG and β-1,3-glucan challenge and in gonads among different months 2.5.1. Primers Gene-specific primers (EsTube-RT-F, EsTube-RT-R, Esβ-actin-F, Esβactin-R, EsGAPDH-F and EsGAPDH-R) (Table. 1) were designed and checked by Premier Primer 5.0 for their lack of primer-dimer formation, false priming sites and secondary structures. The length of the amplified product of EsTube, Esβ-actin and EsGAPDH was 207 bp, 266 bp and 141 bp, respectively. The melting temperature of EsTube, Esβ-actin and EsGAPDH was 58 °C, 58 °C and 58 °C, respectively. The PCR amplification efficiency of EsTube, Esβ-actin and EsGAPDH was 95.2%, 97.5% and 95.3%, respectively. 2.5.2. Real-time quantitative PCR Real-time quantitative PCR was conducted using the CFX96TM RealTime System (Bio-Rad, Hercules, CA, USA) to investigate the distribution of EsTube in different tissues, the expression profiles in hemocytes and hepatopancreas upon LPS, PG and β-1,3-glucan stimulation and the

43

expression profiles in the testis and ovary (from July to January of the next year). All samples were run in triplicate, and all qRT-PCR experiments, including both no-reverse transcriptase (RT) and no-template controls (NTC), were normalized to the control genes (β-actin and GAPDH). EsTube expression levels were calculated by the 2−ΔΔCt comparative CT method (Livak and Schmittgen, 2001). qRT-PCR amplification reactions were carried out in a final volume of 25 μl, which contained 12.5 μl 2 × SYBR Premix Ex Taq (Takara, Japan), 0.5 μl (500 ng/μl) diluted cDNA template, 11.0 μl PCR-grade water (RNase free, Takara, Japan), and 1 μl of primer pairs (10 μM). The thermal cycling conditions included an initial denaturation for 10 min at 95 °C; and 40 cycles at 95 °C for 30 s, 58 °C for 60 s. Fluorescent measurements were taken after the extension step under conditions of: a 0.5 °C/5 s incremental increases from 60 °C to 95 °C that lasted 30 s per cycle. In all experiments, the same amount of cDNA was amplified for single measurement fluorescence and all PCR efficiencies were above 95%. After PCR amplification, the amplification products were analyzed on a 1.5% agarose gel and confirmed by two-way sequencing. Finally, CFX Manager™ software (Bio-Rad) performed melting-curve and dissociativecurve analysis to verify that only a single product was amplified. Data were analyzed using the CFX Manager™ software (ver. 1.0). 2.6. Statistical analysis Statistical analysis was performed using the SPSS software (ver. 20.0). Data are represented as the mean ± standard error (S.E.). Statistical significance was determined by one-way analysis of variance (ANOVA) (Snedecor and Cochran, 1971) and post hoc Duncan multiple range tests. In this study, differences were considered to be significant at P b 0.05 and very significant at P b 0.01. 3. Results 3.1. Identification and characterization of EsTube The full-length cDNA encoding the Tube protein of E. sinensis was deposited in the GenBank database under accession number KC011815, and named as EsTube. The full-length cDNA comprises 2247 bp, with a 1539bp open reading frame ORF encoding a 512-amino acid protein, a 198-bp 5′ UTR and a 510-bp 3′ UTR containing a canonical polyadenylation signal site (AATAAA) (Fig. 1). In addition, the theoretical pI and MW of EsTube were 4.74 and 56.99 kDa, respectively. The SMART program predicted that EsTube had a 116-residue deathdomain (DD) at the N-terminus, and a 272-residue threonine/tyrosineprotein kinase (S_TKc) domain at the C-terminus (Fig. 1). No aminoterminal signal peptide sequence was predicted in EsTube, suggesting that it is not a secreted protein. 3.2. Multiple sequence alignments and phylogenetic analysis Sequence conservation was detected in the death domain and serine/threonine-protein kinase domain among the Tube proteins, especially around the activation site. For example, the N-terminal DD of EsTube had a MyD88 binding site similar to mammalian IRAK-4s (Fig. 2A). Moreover, two typical motifs, an ATP-binding site with a pivotal tyrosine residue (also known as “Hinge”) and a serine/threonineprotein kinase activation site, also were found in the serine/threonineprotein kinase domain. Additionally, multiple alignments reveal that several residues and the DFG motif (DFGXXR) were conserved in the activation site of these Tube proteins (Fig. 2B). The alignments of the S_TKc domain sequences demonstrated that invertebrate Tube proteins and human IRAK-4 are RD kinases with an the characteristic RD dipeptide in the kinase domain, which has been accepted as a criterion for distinguishing RD kinase proteins from non-RD kinases (Towb et al., 2009) (Fig. 2B).

44

A.-Q. Yu et al. / Gene 541 (2014) 41–50

Fig. 1. Nucleotide and deduced amino acid sequences of EsTube. (A) The nucleotide (upper row) and deduced amino acid (lower row) sequences are shown and numbered on the left. The nucleotide sequence is numbered from the first base at the 5′ end. The first methionine (M) is the first deduced amino acid. The single underlined letters represent the N-terminal death domain (amino acids 14–129). The serine/threonine-protein kinase domain (amino acids 237–508) is shaded; while the letters representing the start codons (ATG), the stop codons (TGA) and the polyadenylation signal (AATAAA) are shown in bold.

Considering that not all invertebrate Tube homologs have the kinase domain, an NJ tree was constructed with the DD sequences of Tube homologs from insects to humans to determine the evolutionary relationship among these homologs, based on the Protein Blast results (Fig. 3). In this tree, EsTube was clustered with invertebrate Tube homologs initially, and then with vertebrate IRAK-4s, and finally with the invertebrate Pelle homologs. 3.3. Tissue distribution and expression profiles of EsTube in hemocytes and hepatopancreas after LPS, PG and β-1,3-glucan immune stimulation Information on tissue distribution can offer useful clues for gene functions. As determined by qRT-PCR, EsTube was widely expressed in all the tissues of healthy crabs, but with significant differences in levels between the tissues (Fig. 4). Following qRT-PCR, the dissociation curves of EsTube and β-actin and GAPDH (controls) each showed a single, sharp peak and single bands also were found from the corroborating gel analysis, which confirmed that the amplifications were specific. The mRNA expression level of EsTube was high in the ovary and testis, moderate in the thoracic ganglia and stomach, and low in the gill and heart (Fig. 4). To determine whether immune challenge could induce higher expression levels of EsTube in crab hemocytes and hepatopancreas, LPS, PG and β-1,3-glucan were used as immune elicitors. The results of

qRT-PCR analysis revealed that the levels of EsTube mRNA in hemocytes and hepatopancreas were differentially induced by LPS, PG and β-1,3glucan post-injection compared to controls (Figs. 5 and 6). EsTube was very significantly upregulated at 6 h, 12 h and 24 h postinjection (~2.3, 3.4 and 3.7-fold compared with the control, respectively, P b 0.01) after β-1,3-glucan challenge in hemocytes (Fig. 5A). After LPS challenge, EsTube was very significantly upregulated at 6 h and 12 h in hemocytes (~12.3 and 17.5-fold compared with the control, respectively, P b 0.01),before finally recovering to the normal level at 24 h post-injection (Fig. 5B). The expression of EsTube was very significantly increased at 2 h and 6 h (~3.2 and 2.6-fold compared with the control, respectively, P b 0.01) and was significantly increased at 12 h and 24 h (both ~ 2.4-fold compared with the control, P b 0.05) postinjection with PG in hemocytes (Fig. 5C). EsTube was significantly upregulated at 12 h and 24 h post-injection (~2.3 and 6.8-fold compared with the control, respectively, P b 0.01) after β-1,3-glucan stimulation in the hepatopancreas (Fig. 6A). After LPS stimulation, EsTube was very significantly upregulated at 2–12 h (P b 0.01), before finally recovering to the normal level at 24 h post-injection in hepatopancreas (Fig. 6B). The expression of EsTube was significantly upregulated at 6 h (~2.7-fold compared with the control, P b 0.01). No significant increases were observed in the other selected time points post-injection with PG in the hepatopancreas (Fig. 6C).

A.-Q. Yu et al. / Gene 541 (2014) 41–50

45

Fig. 2. Multiple sequence alignment of the DD domain (A) and S_TKc domain (B) of EsTube with Tube homologs from other selected invertebrate species. Identical or highly conserved residues are shaded in black, while similar residues are shaded in gray. Identical (*) and similar (. or :) residues are indicated at the bottom of the sequences. Gaps (−) were introduced to maximize the alignment. The Myd88 binding segment in the N-terminal death domain (DD) is boxed, the ATP-binding segment with one tyrosine as a gatekeeper and the activation segment with DFGXXR motif in the serine/threonine-protein kinase (S_TKc) domain are also boxed. Sequences for the alignment were obtained from GenBank (accession numbers are in brackets): EsTube, E. sinensis Tube (accession no. JX295852); LvTube, L. vannamei Tube (accession no. AEK86521.1); SpTube, Scylla paramamosain Tube (accession no. AGY49576.1); DmTube D. melanogaster Tube (accession no. NP_001189164.1); TcTube, Tribolium castaneum Tube (accession no. EFA09756.1); CqTube, Culex quinquefasciatus Tube (accession no. XP_001864521.1); AaTube, Aedes aegypti Tube (accession no. XP_001658540.1); DpTube, Daphnia pulex Tube (accession no. EFX85081.1); AgTube, Anopheles gambiae Tube (accession no. XP_001237485.2); MmIRAK-4, Mus musculus IRAK-4 NP_084202.2; HsIRAK-4, Homo sapiens IRAK-4 (accession no. NP_001107654.1); and PhcTube, Pediculus humanus corporis Tube (accession no. XP_002425367.1).

46

A.-Q. Yu et al. / Gene 541 (2014) 41–50

Fig. 3. Unrooted NJ phylogenetic tree of EsTube. Death domain sequences of EsTube (labeled with black triangles) showed high similarity with other invertebrate Tube orthologous and vertebrate IRAK-4s, as assessed by BLASTp homology searches. The branches of E. sinensis Tube are shown in bold. Amino acid sequences for the cluster analysis were obtained from GenBank.

3.4. The expression profiles of the EsTube in different developmental stages The highest mRNA expression level of EsTube was detected in the crab gonads; therefore, we also examined the expression levels of EsTube from July to January of the next year in the testis and ovary to provide clues to the possible function of EsTube during the crab gonad development. qRT-PCR analysis showed that EsTube appeared to be developmentally regulated. The high expression of EsTube was observed in

Fig. 4. qPCR analyses of the mRNA relative transcription level of EsTube in different tissues of E. sinensis. β-actin and GAPDH gene expressions were used as internal references and the expression of EsTube in hemocytes was used as a reference sample. Error bars represent the mean ± S.D. of three independent investigations. Differences were considered statistically significant (*) at P b 0.05, and very significant (**) at P b 0.01.

October (spermatid stage, testis) and then decreased gradually, reaching the lowest level in December (sperm stage, testis) (Fig. 7). The highest mRNA expression was found in November (stage III-2, ovary) and the minimum expression level was also observed in December (stage IV, ovary) (Fig. 8). 4. Discussion The Toll signal pathway plays an important role in inducing the innate immune response to microbial infection through the transcriptional induction of a battery of gene encoding antimicrobial peptides in Drosophila (Anderson, 2000). As the central components of Toll signaling pathways, Tolls and other genes related to Toll signaling pathway (e.g., Toll, Myd88, Pelle, Tube, Dorsal) have been proven to participate in the crustaceans' innate immunity and defense against several pathogens (C. Li et al., 2013; Li et al., 2014; Chen et al., 2011; Lin et al., 2012; Wang et al., 2011, 2012; Watthanasurorot et al., 2012b; Yu et al., 2013a). In L. vannamei, LvTube functions as an adaptor to connect LvMyD88/ LvMyD88-1 and LvPelle, and plays essential roles in the shrimp innate immune responses against diverse pathogens (C. Li et al., 2013). In the mud crab Scylla paramamosain, SpTube expression was significantly increased in hemocytes challenged by gram-negative or gram-positive bacteria (Li et al., 2013b). In our previous work, we found that EsTolls and EsDorsal were involved in innate immunity against diverse PAMPs in the Chinese mitten crab (Yu et al., 2013a; Yu et al., 2013b). In this study, we further identified and characterized a downstream component of EsTolls, namely, EsTube from E. sinensis. The putative amino acid sequence of EsTube possesses the canonical DD domain and kinase domain similar to most of invertebrate Tube homologs and belongs to the RD kinase family. In addition, the phylogenetic analysis also showed that EsTube was clustered with LvTube and SpTube, which suggested that EsTube exert the same function in the Toll signaling pathway. In L. vannamei and Scylla

A.-Q. Yu et al. / Gene 541 (2014) 41–50

47

Fig. 5. Analysis of EsTube mRNA expression by qRT-PCR in hemocytes after injection with β-1,3-glucan, LPS and PG (black bars). Hemocytes collected from crabs injected with PAMPs (black bars) or vehicle control (white bars), were compared with respect to EsTube mRNA expression (relative to β-actin and GAPDH) using Student's t-tests. Error bars represent the mean ± S.D. of three independent investigations. Differences were considered statistically significant (*) at P b 0.05, and very significant (**) at P b 0.01.

paramamosain, the expression profiles of LvTubes and SpTube were diverse when challenged by various immune stimulants, even in the same tissues, indicating that they play important roles in the Toll signaling transduction and crustacean innate immune responses against gram-negative and gram-positive bacteria (C. Li et al., 2013; Li et al., 2013b). Similar immunity functions of Tube were observed in the black tiger shrimp (Penaeus monodon) (Watthanasurorot et al., 2012a). qRT-PCR analyses reveal that EsTube was ubiquitously expressed in the crab tissues tested in this study, which suggests that it may be involved in a wide variety of physiological processes. Moreover, EsTube was highly expressed in development-related organs (ovary and testis)

Fig. 6. Analysis of EsTube mRNA expression by qRT-PCR in hepatopancreas after injection with β-1,3-glucan, LPS and PG (black bars). Hepatopancreases collected from crabs injected with PAMPs (black bars) or vehicle control (white bars), were compared with respect to EsTube mRNA expression (relative to β-actin and GAPDH) using Student's t-tests. Error bars represent the mean ± S.D. of three independent investigations. Differences were considered statistically significant (*) at P b 0.05, and very significant (**) at P b 0.01.

48

A.-Q. Yu et al. / Gene 541 (2014) 41–50

Fig. 7. Analysis of EsTube mRNA expression by qRT-PCR in different development stages of the testis. β-actin and GAPDH gene expressions were used as internal controls and the expression of EsTube in December was used as the reference sample. EsTube mRNA expression (relative to β-actin and GAPDH) was assessed using Student's t-tests. Error bars represent the mean ± S.D. of three independent investigations. Differences were considered statistically significant (*) at P b 0.05, and very significant (**) at P b 0.01.

and was moderately expressed in the thoracic ganglia and the stomach. Considering the high expression levels of EsTube in the rapid phase of testis and ovary development, we speculate that EsTube may be also involved in gonadal development of the crab. In Drosophila, both DmPelle and DmTube are involved in dorsal-ventral patterning during development and their mutations can cause dorsalized Drosophila embryos, in addition to their important roles in innate immunity (MüllerHoltkamp et al., 1985). Similar phenomena were also found for Haliotis diversicolor IRAK-4 (Ge et al., 2011) and Danio rerio IRAK-4 (Phelan et al., 2005). In humans, particular high levels of IRAK-4 were observed in the testis (Nishimura and Naito, 2005). In fact, besides IRAKs, other immune-related genes involved in TLR signaling transduction are also highly expressed in the gonads (Chaves-Pozo et al., 2008; Palladino et al., 2007). These results suggested that the immune-related genes may also play important roles in the homeostasis of the gonads and in gametogenesis in those animals (Yu et al., 2012). As the representative PAMPs of gram-negative bacterium, grampositive bacterium and fungi, LPS, PG and β-1,3-glucan have been widely used in immunity-related experiments (Chettri et al., 2011; Kravchenko and Kaufmann, 2013; Vollmer et al., 2008; Watthanasurorot et al., 2011). As the effector immune cells of crab, hemocytes not only participate directly in pathogen recognition and elimination by phagocytes, encapsulation, nodule formation and melanization, but also produce

humoral defense components, including protease inhibitors, anti-LPS factor, antimicrobial peptides and lysosomal enzymes (Hong et al., 2013; Söderhäll and Cerenius, 1992; Wu et al., 2012). On the other hand, the hepatopancreas, which is homologous to the insect fat body, also plays major roles in metabolism and immune responses. Considering the importance of the hemocytes and hepatopancreas in the crab innate immunity, we detected the transcriptional expression profiles of EsTube in these two organs after PG, LPS and β-1,3-glucan challenge using qRT-PCR. Bacterial infection can increased the expression level of Tube homologs, as reported for H. diversicolor (Ge et al., 2011), D. rerio (Phelan et al., 2005), D. melanogaster (De Gregorio et al., 2002) and Mya arenaria (Mateo et al., 2010). Although these identified Tube homologs shared higher identity in their amino-acid sequences, diverse responses to experimental challenges were observed among these species. In this study, we detected the expression profiles of EsTube in hemocytes and hepatopancreas after PG, LPS and β-1,3-glucan challenge. The results indicated that the mRNA expression level of EsTube was significantly upregulated at specific time points. The comparison of the expression profiles of EsTube in crabs stimulated by different PAMPs showed that the mRNA expression levels of EsTube increased to their highest level at 12 h post-LPS challenge, 24 h post-β-1,3-glucan challenge and 2 h post-PG challenge, compared with controls in hemocytes, while the expression levels of EsTube increased the highest at 6 h post-LPS challenge, 24 h post-β-1,3-glucan challenge and 6 h post-PG challenge, comparing with controls in hepatopancreas. Similar results were found in other crustaceans (C. Li et al., 2013; Watthanasurorot et al., 2012a; Li et al., 2013b). According to the data above, we suggested that the transcription of EsTube was responsive to both bacterial and fungal challenge in different immune tissues in varying degrees. These analyses showed that EsTube expression can be induced by the stimulation of the three PAMPs, which might indicate that EsTube is involved in the bacterial and fungal innate immune defense activities. In summary, EsTube was identified from E. sinensis for the first time. EsTube was highly expressed in the ovary and testis, and moderately expressed in the thoracic ganglia and the stomach. EsTube transcripts in different immune tissues exhibited diverse levels of induction by various PAMPs in order to mount appropriate innate immune responses against them. In addition, the transcript levels of EsTube were induced to different levels during the development stages of the gonads. Taken together, the results above indicated that EsTube not only is involved in anti-bacterial and anti-fungal immune responses, but also participates in the development of crab gonads. Further investigations are necessary to clarify the function and regulation mechanism of further Toll signaling pathway members of E. sinensis and identify the possible multiple functions of immune-related genes in crabs. Conflict of interest The authors declare that they have no competing interests. Acknowledgments This work was supported by grants from the National Science and Technology Support Program of China (2012BAD26B04-04), the National Research Foundation for the Doctoral Program of Higher Education of China (20110076110016) and the Innovation Program of Shanghai Municipal Education Commission (13zz031). References

Fig. 8. Analysis of EsTube mRNA expression by qRT-PCR in different development stages of ovary. β-actin and GAPDH gene expressions were used as internal controls and the expression of EsTube in December was used as the reference sample. EsTube mRNA expression (relative to β-actin and GAPDH) was assessed by Student's t-tests. Error bars represent the mean ± S.D. of three independent investigations. Differences were considered statistically significant (*) at P b 0.05, and very significant (**) at P b 0.01.

Anderson, K.V., 2000. Toll signaling pathways in the innate immune response. Current Opinion in Immunology 12, 13–19. Bischoff, V., Vignal, C., Boneca, I.G., Michel, T., Hoffmann, J.A., Royet, J., 2004. Function of the Drosophila pattern-recognition receptor PGRP-SD in the detection of grampositive bacteria. Nature Immunology 5, 1175–1180. Boeger, W.A., Pie, M.R., Vicente, V., Ostrensky, A., Hungria, D., Castilho, G.G., 2007. Histopathology of the mangrove land crab Ucides cordatus (Ocypodidae) affected by lethargic crab disease. Diseases of Aquatic Organisms 78, 73.

A.-Q. Yu et al. / Gene 541 (2014) 41–50 Chaves-Pozo, E., Liarte, S., Fernández-Alacid, L., Abellán, E., Meseguer, J., Mulero, V., García-Ayala, A., 2008. Pattern of expression of immune-relevant genes in the gonad of a teleost, the gilthead seabream (Sparus aurata L.). Molecular Immunology 45, 2998–3011. Chen, Y.-H., Jia, X.-T., Huang, X.-D., Zhang, S., Li, M., Xie, J.-F., Weng, S.-P., He, J.-G., 2011. Two Litopenaeus vannamei HMGB proteins interact with transcription factors LvSTAT and LvDorsal to activate the promoter of white spot syndrome virus immediate-early gene ie1. Molecular Immunology 48, 793–799. Chettri, J.K., Raida, M.K., Holten-Andersen, L., Kania, P.W., Buchmann, K., 2011. PAMP induced expression of immune relevant genes in head kidney leukocytes of rainbow trout (Oncorhynchus mykiss). Developmental and Comparative Immunology 35, 476–482. De Gregorio, E., Spellman, P.T., Tzou, P., Rubin, G.M., Lemaitre, B., 2002. The Toll and Imd pathways are the major regulators of the immune response in Drosophila. The EMBO Journal 21, 2568–2579. Drummond, G.B., 2009. Reporting ethical matters in the Journal of Physiology: standards and advice. The Journal of Physiology 587, 713–719. Gai, Y., Qiu, L., Wang, L., Song, L., Mu, C., Zhao, J., Zhang, Y., Li, L., 2009a. A clip domain serine protease (cSP) from the Chinese mitten crab Eriocheir sinensis: cDNA characterization and mRNA expression. Fish and Shellfish Immunology 27, 670–677. Gai, Y., Wang, L., Zhao, J., Qiu, L., Song, L., Li, L., Mu, C., Wang, W., Wang, M., Zhang, Y., Yao, X., Yang, J., 2009b. The construction of a cDNA library enriched for immune genes and the analysis of 7535 ESTs from Chinese mitten crab Eriocheir sinensis. Fish and Shellfish Immunology 27, 684–694. Ge, H., Wang, G., Zhang, L., Zhang, Z., Wang, S., Zou, Z., Yan, S., Wang, Y., 2011. Molecular cloning and expression of interleukin-1 receptor-associated kinase 4, an important mediator of Toll-like receptor signal pathway, from small abalone Haliotis diversicolor. Fish and Shellfish Immunology 30, 1138–1146. Gosu, V., Basith, S., Durai, P., Choi, S., 2012. Molecular evolution and structural features of IRAK family members. PloS One 7, e49771. Guo, H.Z., Zou, P.F., Fu, J.P., Guo, Z., Zhu, B.K., Nie, P., Chang, M.X., 2011. Characterization of two C-type lectin-like domain (CTLD)-containing proteins from the cDNA library of Chinese mitten crab Eriocheir sinensis. Fish and Shellfish Immunology 30, 515–524. He, L., Jiang, H., Cao, D., Liu, L., Hu, S., Wang, Q., 2013. Comparative transcriptome analysis of the accessory sex gland and testis from the Chinese mitten crab (Eriocheir sinensis). PLoS One 8, e53915. Hong, Y., Yang, X., Cheng, Y., Liang, P., Zhang, J., Li, M., Shen, C., Yang, Z., Wang, C., 2013. Effects of pH, temperature, and osmolarity on the morphology and survival rate of primary hemocyte cultures from the mitten crab, Eriocheir sinensis. In Vitro Cellular & Developmental Biology — Animal 1–12. Imler, J.-L., Hoffmann, J.A., 2000. Signaling mechanisms in the antimicrobial host defense of Drosophila. Current Opinion in Microbiology 3, 16–22. Imler, J.-L., Hoffmann, J.A., 2001. Toll receptors in innate immunity. Trends in Cell Biology 11, 304–311. Imler, J.-L., Zheng, L., 2004. Biology of Toll receptors: lessons from insects and mammals. Journal of Leukocyte Biology 75, 18–26. Jiang, H., Cai, Y.-M., Chen, L.-Q., Zhang, X.-W., Hu, S.-N., Wang, Q., 2009a. Functional annotation and analysis of expressed sequence tags from the hepatopancreas of mitten crab (Eriocheir sinensis). Marine Biotechnology 11, 317–326. Jiang, H., Yin, Y., Zhang, X., Hu, S., Wang, Q., 2009b. Chasing relationships between nutrition and reproduction: a comparative transcriptome analysis of hepatopancreas and testis from Eriocheir sinensis. Comparative Biochemistry and Physiology Part D: Genomics and Proteomics 4, 227–234. Jin, X.-K., Li, W.-W., He, L., Lu, W., Chen, L.-L., Wang, Y., Jiang, H., Wang, Q., 2011. Molecular cloning, characterization and expression analysis of two apoptosis genes, caspase and nm23, involved in the antibacterial response in Chinese mitten crab, Eriocheir sinensis. Fish and Shellfish Immunology 30, 263–272. Jin, X.-K., Li, W.-W., Cheng, L., Li, S., Guo, X.-N., Yu, A.-Q., Wu, M.-H., He, L., Wang, Q., 2012. Two novel short C-type lectin from Chinese mitten crab, Eriocheir sinensis, are induced in response to LPS challenged. Fish and Shellfish Immunology 33, 1149–1158. Kawai, T., Akira, S., 2010. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nature Immunology 11, 373–384. Kravchenko, V.V., Kaufmann, G.F., 2013. Bacterial inhibition of inflammatory responses via TLR-independent mechanisms. Cellular Microbiology 15, 527–536. Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J.-M., Hoffmann, J.A., 1996. The dorsoventral regulatory gene cassette spätzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86, 973–983. Li, X.-C., Zhang, X.-W., Zhou, J.-F., Ma, H.-Y., Liu, Z.-D., Zhu, L., Yao, X.-J., Li, L.-G., Fang, W.H., 2013a. Identification, characterization, and functional analysis of tube and pelle homologs in the mud crab Scylla paramamosain. PloS One 8, e76728. Li, X.-C., Zhu, L., Li, L.-G., Ren, Q., Huang, Y.-Q., Lu, J.-X., Fang, W.-H., Kang, W., 2013b. A novel myeloid differentiation factor 88 homolog, SpMyD88, exhibiting SpTollbinding activity in the mud crab Scylla paramamosain. Developmental and Comparative Immunology 39, 313–322. Li, C., Chen, Y., Weng, S., Li, S., Zuo, H., Yu, X., Li, H., He, J., Xu, X., 2014. Presence of tube isoforms in Litopenaeus vannamei suggests various regulatory patterns of signal transduction in invertebrate NF-κB pathway. Developmental and Comparative Immunology 42, 174–185. Lin, Z., Qiao, J., Zhang, Y., Guo, L., Huang, H., Yan, F., Li, Y., Wang, X., 2012. Cloning and characterisation of the SpToll gene from green mud crab, Scylla paramamosain. Developmental and Comparative Immunology 37, 164–175. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−[delta][delta]CT method. Methods 25, 402–408. Mateo, D.R., Greenwood, S.J., Araya, M.T., Berthe, F.C., Johnson, G.R., Siah, A., 2010. Differential gene expression of γ-actin, Toll-like receptor 2 (TLR-2) and interleukin-1 receptor-associated kinase 4 (IRAK-4) in Mya arenaria haemocytes induced by

49

in vivo infections with two Vibrio splendidus strains. Developmental and Comparative Immunology 34, 710–714. Mu, C., Zheng, P., Zhao, J., Wang, L., Zhang, H., Qiu, L., Gai, Y., Song, L., 2010. Molecular characterization and expression of a crustin-like gene from Chinese mitten crab, Eriocheir sinensis. Developmental and Comparative Immunology 34, 734–740. Müller-Holtkamp, F., Knipple, D., Seifert, E., Jäckle, H., 1985. An early role of maternal mRNA in establishing the dorsoventral pattern in pelle mutant Drosophila embryos. Developmental Biology 110, 238–246. Nishimura, M., Naito, S., 2005. Tissue-specific mRNA expression profiles of human toll-like receptors and related genes. Biological and Pharmaceutical Bulletin 28, 886–892. Palladino, M., Johnson, T., Gupta, R., Chapman, J., Ojha, P., 2007. Members of the Toll-like receptor family of innate immunity pattern-recognition receptors are abundant in the male rat reproductive tract. Biology of Reproduction 76, 958–964. Phelan, P.E., Mellon, M.T., Kim, C.H., 2005. Functional characterization of full-length TLR3, IRAK-4, and TRAF6 in zebrafish (Danio rerio). Molecular Immunology 42, 1057–1071. Qin, C., Chen, L., Qin, J.G., Zhao, D., Zhang, H., Wu, P., Li, E., 2010. Characterization of a serine proteinase homologous (SPH) in Chinese mitten crab Eriocheir sinensis. Developmental and Comparative Immunology 34, 14–18. Royet, J., 2004. Infectious non-self recognition in invertebrates: lessons from Drosophila and other insect models. Molecular Immunology 41, 1063–1075. Snedecor, G., Cochran, W., 1971. Statistical Methods. The Iowas State University Press, Ames, Iowa. Söderhäll, K., Cerenius, L., 1992. Crustacean immunity. Annual Review of Fish Diseases 2, 3–23. Söderhäll, K., Smith, V.J., 1983. Separation of the haemocyte populations of Carcinusmaenas and other marine decapods, and prophenoloxidase distribution. Developmental and Comparative Immunology 7, 229–239. Suzuki, N., Suzuki, S., Duncan, G.S., Millar, D.G., Wada, T., Mirtsos, C., Takada, H., Wakeham, A., Itie, A., Li, S., 2002. Severe impairment of interleukin-1 and Toll-like receptor signalling in mice lacking IRAK-4. Nature 416, 750–756. Swantek, J.L., Tsen, M.F., Cobb, M.H., Thomas, J.A., 2000. IL-1 receptor-associated kinase modulates host responsiveness to endotoxin. The Journal of Immunology 164, 4301–4306. Takeda, K., Akira, S., 2005. Toll-like receptors in innate immunity. International Immunology 17, 1–14. Tauszig, S., Jouanguy, E., Hoffmann, J.A., Imler, J., 2000. Toll-related receptors and the control of antimicrobial peptide expression in Drosophila. Proceedings of the National Academy of Sciences 97, 10520–10525. Towb, P., Sun, H., Wasserman, S.A., 2009. Tube Is an IRAK-4 homolog in a Toll pathway adapted for development and immunity. Journal of Innate Immunity 1, 309–321. Uematsu, S., Akira, S., 2008. Toll-Like Receptors (TLRs) and Their Ligands, Toll-Like Receptors (TLRs) and Innate Immunity. Springer, Berlin Heidelberg 1–20. Vollmer, W., Blanot, D., De Pedro, M.A., 2008. Peptidoglycan structure and architecture. FEMS Microbiology Reviews 32, 149–167. Wang, Z., Liu, J., Sudom, A., Ayres, M., Li, S., Wesche, H., Powers, J.P., Walker, N.P., 2006. Crystal structures of IRAK-4 kinase in complex with inhibitors: a serine/threonine kinase with tyrosine as a gatekeeper. Structure 14, 1835–1844. Wang, P.-H., Gu, Z.-H., Huang, X.-D., Liu, B.-D., Deng, X.-x, Ai, H.-S., Wang, J., Yin, Z.-X., Weng, S.-P., Yu, X.-Q., He, J.-G., 2009. An immune deficiency homolog from the white shrimp, Litopenaeus vannamei, activates antimicrobial peptide genes. Molecular Immunology 46, 1897–1904. Wang, P.-H., Gu, Z.-H., Wan, D.-H., Zhang, M.-Y., Weng, S.-P., Yu, X.-Q., He, J.-G., 2011. The shrimp NF-κB pathway is activated by white spot syndrome virus (WSSV) 449 to facilitate the expression of WSSV069 (ie1), WSSV303 and WSSV371. PLoS One 6, e24773. Wang, P.-H., Liang, J.-P., Gu, Z.-H., Wan, D.-H., Weng, S.-P., Yu, X.-Q., He, J.-G., 2012. Molecular cloning, characterization and expression analysis of two novel Tolls (LvToll2 and LvToll3) and three putative spätzle-like Toll ligands (LvSpz1–3) from Litopenaeus vannamei. Developmental and Comparative Immunology 36, 359–371. Watthanasurorot, A., Jiravanichpaisal, P., Liu, H., Söderhäll, I., Söderhäll, K., 2011. Bacteriainduced Dscam isoforms of the crustacean, Pacifastacus leniusculus. PLoS Pathogens 7, e1002062. Watthanasurorot, A., Söderhäll, K., Jiravanichpaisal, P., 2012a. A mammalian like interleukin-1 receptor-associated kinase 4 (IRAK-4), a TIR signaling mediator in intestinal innate immunity of black tiger shrimp (Penaeus monodon). Biochemical and Biophysical Research Communications 417, 623–629. Watthanasurorot, A., Soderhall, K., Jiravanichpaisal, P., 2012b. A mammalian like interleukin-1 receptor-associated kinase 4 (IRAK-4), a TIR signaling mediator in intestinal innate immunity of black tiger shrimp (Penaeus monodon). Biochemical and Biophysical Research Communications 417, 623–629. Wu, S.-H., Chen, Y.-J., Huang, S.-Y., Tsai, W.-S., Wu, H.-J., Hsu, T.-T., Lee, C.-Y., 2012. Demonstration of expression of a neuropeptide-encoding gene in crustacean hemocytes. Comparative Biochemistry and Physiology Part A: Molecular and Integrative Physiology 161, 463–468. Ying, X.-P., Yang, W.-X., Zhang, Y.-P., 2006. Comparative studies on fatty acid composition of the ovaries and hepatopancreas at different physiological stages of the Chinese mitten crab. Aquaculture 256, 617–623. Yu, Y., Zhong, Q., Li, C., Jiang, L., Wang, Y., Sun, Y., Wang, X., Wang, Z., Zhang, Q., 2012. Identification and characterization of IL-1 receptor-associated kinase-4 (IRAK-4) in half-smooth tongue sole Cynoglossus semilaevis. Fish and Shellfish Immunology 32, 609–615. Yu, A.-Q., Jin, X.-K., Guo, X.-N., Li, S., Wu, M.-H., Li, W.-W., Wang, Q., 2013a. Two novel Toll genes (EsToll1 and EsToll2) from Eriocheir sinensis are differentially induced by lipopolysaccharide, peptidoglycan and zymosan. Fish and Shellfish Immunology 35, 1282–1292.

50

A.-Q. Yu et al. / Gene 541 (2014) 41–50

Yu, A.-Q., Jin, X.-K., Li, S., Guo, X.-N., Wu, M.-H., Li, W.-W., Wang, Q., 2013b. Molecular cloning and expression analysis of a dorsal homologue from Eriocheir sinensis. Developmental and Comparative Immunology 41, 723–727. Zhang, H., Chen, L., Qin, J., Zhao, D., Wu, P., Qin, C., Yu, N., Li, E., 2011a. Molecular cloning, characterization and expression of a C-type lectin cDNA in Chinese mitten crab, Eriocheir sinensis. Fish and Shellfish Immunology 31, 358–363.

Zhang, W., Wan, H., Jiang, H., Zhao, Y., Zhang, X., Hu, S., Wang, Q., 2011b. A transcriptome analysis of mitten crab testes (Eriocheir sinensis). Genetics and Molecular Biology 34, 136–141. Zhao, D., Song, S., Wang, Q., Zhang, X., Hu, S., Chen, L., 2009. Discovery of immune-related genes in Chinese mitten crab (Eriocheir sinensis) by expressed sequence tag analysis of haemocytes. Aquaculture 287, 297–303.