The characterization of hematopoietic tissue in adult Chinese mitten crab Eriocheir sinensis

Developmental and Comparative Immunology 60 (2016) 12e22

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

The characterization of hematopoietic tissue in adult Chinese mitten crab Eriocheir sinensis Zhihao Jia a, c, Sharath Kavungal a, c, Shuai Jiang a, Depeng Zhao d, Mingzhe Sun a, c, Lingling Wang a, Linsheng Song b, * a

Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China Key Laboratory of Mariculture & Stock Enhancement in North China's Sea, Ministry of Agriculture, Dalian Ocean University, Dalian 116023, China University of Chinese Academy of Sciences, Beijing 100049, China d Dalian Polytechnic University, Dalian 116034, China b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 18 September 2015 Received in revised form 2 February 2016 Accepted 2 February 2016 Available online 8 February 2016

Invertebrates rely on the efficient innate immune mechanisms against invaders, in which the continuous production of hemocytes (hematopoiesis) is indispensable. In the present study, the hematopoietic tissue (HPT) from Chinese mitten crab Eriocheir sinensis was identified and characterized. It was a thin and nontransparent sheet located at the dorsolateral side of the stomach, which was composed of a series of ovoid lobules. Each lobule was surrounded by connective tissue containing a large amount of spherical cells with big nucleus. In HPT, the cells were full of mitochondria and granules, and DNA replication was detected in some cells by EdU labeling technique. Cell proliferation was observed in HPT by transmission electron microscope (TEM). The distribution of two transcription factors, GATA1 and RUNX1, were examined by human GATA1 and RUNX1 antibodies, respectively. Three homologues of RUNX1 were detected in the HPT while no signal of RUNX1 was observed in hemocytes, and GATA1 was detected in both HPT and some hemocytes. The mRNA transcript of a novel hematopoiesis related cytokine EsAst was detected in hepatopancreas and hemocytes, but it was no detectable in HPT. The mRNA expression level of EsAst in hepatopancreas was 1.38-fold higher than that in hemocytes. Total hemocytes counts were related to the mRNA expression level of EsAst post Aeromonas hydrophila challenge. The results suggested that the stem cells in the hematopoietic tissue of Chinese mitten crab E. sinensis were regulated by transcriptional and humoral factors to generate hemocytes. © 2016 Elsevier Ltd. All rights reserved.

Keywords: Eriocheir sinensis Hematopoietic tissue Morphology Histology Immunohistochemistry EdU

1. Introduction Immunity is a universal and evolutionarily mechanism of host defense against infection, and it is classified into innate immunity and adaptive immunity. Innate immunity is the first line against infections (Medzhitov and Janeway, 1997) which is comprised of multiple immune cells and molecules while adaptive immunity is mostly referred as specific immunity or immune memory (Beck and Habicht, 1996; Janeway Jr and Medzhitov, 2002). The innate immunity is especially important for invertebrate because no true components of adaptive immunity have been identified in invertebrates (Kurtz, 2005; Zhang et al., 2014). Cellular response mediated by hemocytes plays crucial roles in the host defense of

* Corresponding author. Dalian Ocean University, 52 Heishijiao Street, Dalian 116023, China. E-mail address: [email protected] (L. Song). http://dx.doi.org/10.1016/j.dci.2016.02.002 0145-305X/© 2016 Elsevier Ltd. All rights reserved.

invertebrates which involves nodule formation, encapsulation and phagocytosis of the pathogen (Williams, 2007). The continuously production of hemocytes originates from self-renewing populations of pluripotent stem cells that are housed in specialized hematopoietic organ in adult animal (Hartenstein, 2006). The explorations of genesis, differentiation, maturation and classification of the invertebrate hemocytes are dominated by model organisms and with little attention to other species (Little et al., 2005). Hematopoiesis is a complex process by which different kinds of blood cells are formed and released from hematopoietic tissue (Lin € derh€ and So all, 2011). The process has been studied extensively in vertebrates and the blood cells can be distinguished according to their morphologic and functional characteristics. In invertebrates, there are no oxygen-carrying erythrocytes and lymphoid lineages cells involved in the adaptive immune defense, and the hematopoiesis provides a good model to study the regulation mechanism of the hemocytes in innate immune system. The hematopoiesis of Pacifastacus leniusculus and Drosophila melanogaster are well

Z. Jia et al. / Developmental and Comparative Immunology 60 (2016) 12e22

studied and they are the representatives of hematopoiesis processes in invertebrates. In P. leniusculus, hematopoiesis is an ongoing process for the continuous synthesis of blood cells, which support the crayfish for the up to 20 years life span (Chaga et al., 1995). In contrast, in the short-lived insects such as D. melanogaster, the hematopoiesis only occurs at the embryonic and larval stages (Crozatier and Meister, 2007). Hematopoiesis generally contains the formation and development of mature hemocytes which involves proliferation, differentiation and maturation from undifferentiated HPT cells. Numerous transcription factors and cytokines are involved in these processes. Hematopoiesis is regulated by both transcription factors and humoral factors. Among these factors, GATA and RUNX are of vital importance, which take part in many biological processes at transcriptional level. GATA proteins comprise a family of transcription factors that have highly conserved zinc finger DNA binding domains. GATA1 transcription factor has been extensively characterized and it plays crucial roles in the development of erythroid cells, megakaryocytes, eosinophils, and mast cells (Ferreira et al., 2005; Martin et al., 1990; Romeo et al., 1990). RUNX1 is a pivotal transcription factor required for hematopoietic stem cells generation (Chen et al., 2009). Runx protein homologues in crayfish and Drosophila are closely associated with the differentiation of cells that express the proPO gene. In crayfish, Runx1 is crucial for the final differentiation of SGCs and GCs while the Drosophila Runx homologue Lozenge (Lz) is needed for the development of crystal cells (Crozatier and Meister, 2007; Martinez-Agosto et al., 2007; Radtke et al., 2005). Recently, some conserved function of transcription factors and signaling pathways have also been revealed in both D. melanogaster and vertebrates, which regulate proliferation and lineage commitment in hematopoietic development, such as JAK-STAT pathway (Evans et al., 2003). In addition, Astakines, the homologues of vertebrate PROKs found in crustacean have been reported to participate in proliferation and differentiation of HPT €derha €ll et al., cells, and production of new-born hemocytes (So 2005). Chinese mitten crab Eriocheir sinensis is one of the most economically important aquaculture species in East Asia (Sun et al., 2013b), and the knowledge of its immunity is of important for the management and sustainable development of crab aquaculture. Even there are increasing reports on the immune system of crabs (Gai et al., 2009; Wang et al., 2013a,b), the information about the hematopoiesis, differentiation and classification of hemocytes is still very limited. In the present study, the morphological and histological features of hematopoietic tissue in Chinese mitten crab was characterized, and the distributions of transcription factors GATA1, RUNX1 and the cytokine EsAst, as well as the new-born hemocytes in hematopoietic tissue and circulating hemocytes were examined in order to provide new insights into the crustacean cellular immunity. 2. Methods and materials 2.1. Crabs and sample collection Chinese mitten crabs Eriocheir sinensis were collected from a commercial farm in Lianyungang, China with the approximate weight of 20 g and cultured at 20 ± 1
C in tanks for 10 days before processing. Hematopoietic tissue (HPT) was collected as previously described in freshwater crayfish Pacifastacus leniusculus (Johansson €derha €ll, 2011). Briefly, the HPT was dissected et al., 2000; Lin and So from the dorsolateral side of the stomach from crabs and washed with filtrated saline (0.85% NaCl). The tissues were incubated in 500 mL of 0.1% collagenase (type I and IV) (Sigma, Steinheim,

13

Germany) prepared with anticoagulant solution of crabs (510 mmol/L NaCl, 100 mmol/L glucose, 200 mmol/L citric acid, 30 mmol/L sodium citrate, 10 mmol/L EDTA$2Na, pH 7.3) at room temperature for 45 min to dissociate the HPT cells. After twice of washing, the separated cells were centrifuged at 1000g, 4
C for 15 min to harvest the single cells of HPT. The hemolymph was isolated as previously described (Sun et al., 2015). In short, a syringe was used to collect the hemolymph from the last walking legs of the crabs with the present of half volume of pre-cooled anticoagulant solution (510 mmol/L NaCl, 100 mmol/L glucose, 200 mmol/L citric acid, 30 mmol/L sodium citrate, 10 mM EDTA$2Na, pH 7.3) and immediately centrifuged at 1000g, 4
C for 10 min to harvest the hemocytes. 2.2. The histological characterization of HPT For histological studies, the tissues were prepared as previously described (Jemaa et al., 2014; Jiang et al., 2013) and fixed using Bouin's fixative (Saturated picric acid solution: formaldehyde: glacial acetic acid ¼ 15:5:1) at room temperature for 24 h. After faded in 70% ethanol for 2e4 times, the tissue samples were dehydrated in 80, 95, and 100% successive ethanol baths, and finally dehydrated twice in Xylene before being embedded in paraffin. Cross-sections (5 mm thick) were cut using an RM-2016 microtome (LEIKA, Germany), and the Paraffin in the sections was eliminated in Xylene bath. The sections were rehydrated in successive 95 to 30% ethanol baths and then in distilled water. After treated with hematoxylin for 5 min, the sections were rinsed 3 min and stained in eosin for 1 min. The sections were covered by coverslips using buffered glycerin to fix the cover slide before observed under microscopy (Olympus). 2.3. Scanning electron microscope (SEM) and transmission electron microscope (TEM) imaging of tissue and cell samples For scanning electron microscope (SEM) imaging, cells and tissues of HPT were fixed in 4% glutaraldehyde after adhered to the Poly-L-lysine (Sigma, USA) pre-coated coverslips (Ishigaki et al., 2011). After three times of washing, the specimens were dehydrated using 50, 70, 80, 90, and 100% graded ethanol, and then continuous isoamyl acetate was used to replace the ethanol with a proportion of 1:3, 1:2, 1:1 and pure isoamyl acetate for 10, 10, 10, 30 min, respectively. After treated by the method of critical point drying and platinum-coated with an E-1010 ion sputter (Hitachi Science Systems, Tokyo, Japan), the samples were view by S3400 N Scanning Electron Microscope (Hitachi Science Systems, Tokyo, Japan). For transmission electron microscope (TEM), cells and HPT tissues were fixed in 4% glutaraldehyde (Lugo-Villarino et al., 2010), embedded in 12% gelatin/PBS, and centrifuged to reform a pellet in a microfuge tube. The gelatin/pellets were cut out of the microfuge tubes, and post-fixed in buffered 1% osmium tetroxide. After three times washing with buffer, the samples were transitioned through propylene oxide, dehydrated in a graded ethanol series, and embedded in Embed 812/Araldite (Electron Microscopy Sciences). Thin (60 nm) sections of the pellets were cut, mounted on parlodion-coated copper slot grids, and stained with uranyl acetate and lead citrate for examination on a JEM-1200 electron microscope (JEOL). 2.4. Flow cytometry analysis of HPT cells and hemocytes Flow cytometry was used to characterize the HPT cells and hemocytes. The side scatter (SSC) and forward scatter (FSC) analyses were conducted to measure the size and granularity. Briefly, HPT

14

Z. Jia et al. / Developmental and Comparative Immunology 60 (2016) 12e22

and hemolymph were collected from five crabs, and the HPTs were digested as above mentioned. After digestion, the mixture of HPT digestion and the hemolymph were centrifuged at 1000g, 4
C for 15 min and 10 min respectively to harvest the cells. The cells were re-suspended in crab anticoagulant solution after three times of washing, and then detected by FACS Arial II flow cytometer (Becton, Dickinson and Company). 2.5. Western-blot analysis of RUNX1 and GATA1 After 12% SDS-PAGE, the protein samples of HPT and hemocytes from crabs were electrophoretically transferred onto nitrocellulose membrane. The membrane was blocked with 5% milk in PBST at room temperature for 1 h, and incubated with polyclonal antibodies of human RUNX1 and human GATA1 (BBI, diluted at 1:1000) at 4
C overnight, followed by three times of washes with PBST. Membranes were incubated with HRP-labeled goat-anti-rabbit IgG (Abclonal; diluted at 1:4000) at room temperature for 1 h with rocking, followed by three times of washes with PBST. At last, membranes were incubated briefly in Western lighting-ECL substrate system (Perkin Elmer) before exposure to X-OMAT AR X-ray film (Esatman Kodak, Rochester, NY). Human Tubulin polyclonal antibody (Abclonal; diluted at 1:3000) was set as internal reference. 2.6. Immunohistochemistry analysis of RUNX1 and GATA1 Immunohistochemistry were done as previously described with some modification (Jia et al., 2015). After being blocked in 3% BSA, the sections were first incubated with primary antibodies of human RUNX1 and human GATA1 (BBI, diluted at 1:1000 with 3% BSA, PBS) at 37
C for 1 h. And then incubated with Alexa Fluor 488-labeled goat-anti-rabbit antibody (Abclonal, diluted at 1:500 with 3% BSA, PBS with Evans blue dye) as the second antibody at 37
C for 50 min. After three times of washing with PBST, the sections were covered by cover slide and observed under fluorescence microscopy (Olympus). For the immunohistochemistry analysis of single cell from digested HPT and hemocytes, the cell suspensions were added into confocal dishes. After the cells adhered to the wall at room temperature for 3 h, the supernatant was dislodged and 4% PFA (Paraformaldehyde diluted in TBS) was used to fix the simples at room temperature for 15 min. The dishes were treated with 0.1% Triton X-100 in TBS after three times of washing with TBST, and then blocked with 500 ml of 3% BSA in PBS at 37
C for 30 min. The supernatant was removed, and the dishes were incubated with 500 ml antibody of human RUNX1 and human GATA1 (BBI, diluted at 1:1000) as the primary antibody at 37
C for 1 h. After washed three times with PBST, the dishes were incubated with Alexa Fluor 488-labeled goat-anti-rabbit antibody (Abclonal, diluted 1:1000 in blocking buffer) as the second antibody at 37
C for 1 h. The dishes were washed three times with PBST, and incubated with 500 ml DAPI (diluted 1:10000 in PBS) to stain the nucleus. After the last three times of washing, the dishes were mounted in buffered glycerin for observation by Laser Scan Confocal Microscope (ZEISS). 2.7. Detection of DNA replication by EdU labeling EdU labeling assay was performed as previously described (Aparicio et al., 2009). Briefly, 100 ml EdU (Life technologies, 0.2 mg/ mL in sterilized saline) was injected into the last walking legs of each crab using a syringe, and sterilized saline was used as blank control. After 48 h, HPT and hemocytes were collected to prepare paraffin sections as described above. Hepatopancreas was collected as control group.

For the detection of EdU, HPT was digested as mentioned above. The HPT cells and hemocytes were adhered to the pre-coated (PolyL-Lysine, Sigma) slides at room temperature for 3 h. Cross sections of HPT and hepatopancreas were made as described above, and fixed with 4% PFA (Paraformaldehyde diluted in TBS) at room temperature for 15 min. After three times washing with 3% BSA in TBS, 0.1% Triton® X-100 in TBS was used to treat the samples at room temperature for 10 min. After the final three times washing in 3% BSA in TBS, the EdU was detected using the Click-iT® EdU Alexa Fluor® 488 Imaging Kit (Life technologies) under fluorescence microscopy (Olympus). 2.8. Sample collection, RNA isolation, cDNA synthesis and real-time PCR Aeromonas hydrophila was cultured in LB medium and resuspended in sterile saline (OD ¼ 0.1). Ninety crabs were randomly divided into two groups stimulation group and one untreated group. Crab received an injection of 100 mL A. hydrophila were employed as treatment group. The rest received the injection of same volume of sterile saline were employed as control group. The crabs were continued to culture in water tanks after treatment. Six individuals from each group were randomly collected at 3, 6, 9, 12 and 24 h after injection, respectively. The hemolymph from these crabs were collected and centrifuged at 1000 g, 4
C for 10 min to harvest the hemocytes. Total hemocytes counts (THC) were measured using a blood counting chamber. The rest hemocytes were stored in Trizol reagent (Invitrogen) at 80
C for RNA extraction. HPT, hemocytes and hepatopancreas were collected from six healthy crabs. Trizol reagent (Life technologies) was used to extract the total RNA from samples according to the manufacturer's protocol. The RNase-free DNase I (Promega) was used to digest the genomic DNA from the total RNA, and the first-strand cDNA synthesis was carried out based on Promega M-MLV reverse transcriptase using oligo (dT)-adaptor as primer (Table 1). The reverse transcription reaction was performed at 42
C for 1 h, and terminated by heating at 95
C for 5 min. The cDNA was diluted to 1:40 and stored at 80
C for gene cloning and SYBR Green fluorescent quantitative real-time RT-PCR. The mRNA expression of EsAst (GenBank accession no.GU002534) was examined by SYBR Green fluorescent quantitative real-time PCR (RT-PCR). Two gene specific primers for EsAst, P1 and P2 (Table 1), were used to amplify a fragment of 146 bp. The crab actin fragment, amplified with primers P3 and P4 (Table 1), was chosen as reference gene to calibrate the cDNA template as an internal standardization. The expression level of EsAst was analyzed by comparative Ct method (2△△Ct method) (Schmittgen and Livak, 2008). 2.9. Statistical analysis All the data were expressed as mean ± standard deviation

Table 1 Primers used in this paper. Primer

Sequence(50 d30 )

Oligo(dT)-adaptor RT primers P1 P2 Actin primers P3 (Actin-RTF) P4 (Actin-RTR)

GGCCACGCGTCGACTAGTACT17 GTGGTGGTGTTGGTGCTG ATGTCGTTGGGGTAGTGC GCATCCACGAGACCACTTAC CTCCTGCTTGCTGATCCACATC

Z. Jia et al. / Developmental and Comparative Immunology 60 (2016) 12e22

(N ¼ 6), and analyzed with Statistical Package for Social Sciences (SPSS) 16.0. The significant differences among groups were tested by one-way analysis of variance (ANOVA) and multiple comparisons. Statistically significant differences were designated at P < 0.05 and extremely significant at P < 0.01.

15

apical end and diffuse distal region, and it was filled with small cells. The cells were approximately 5 mm in size with big and deeply colored nucleus (Fig. 2B). Most of the cells were connected by connective tissue while some were dissociative. Different types of cells with diverse shapes and nucleus staining were also detected in HPT (Fig. 2C).

3. Results 3.1. Localization and histology of HPT

3.2. Morphological and Ultrastructural Characters of HPT and HPT cells

The hematopoietic tissue was collected from the dorsolateral side of the stomach of crabs, which was a thin and non-transparent sheet (Fig 1A, B). It was composed of a series of ovoid lobules and each lobule was surrounded by connective tissues. There were a large amount of spherical cells with big nucleus in the lobules. The lobules in the upper part were bigger and more inerratic than the lower part. Cells in the upper lobules were deeper in nuclear staining and the lobules in the lower part contained more connective tissue (Fig 1C, D). After keeping in resuspension buffer for 8 h, Trypan Blue (Sigma) was used to stain the digested HPT cells and over 90% of the cells were live for the positive signal of Trypan Blue (data not shown). After stained by Hematoxylin-eosin, a large amount of irregular and small ovoid lobules were observed in HPT, which were surrounded by connective tissues (Fig. 2A). Each lobule had a sharp

The surface and the shape of HPT and its digested cells were detected by scanning electron microscope (SEM). HPT contained irregularly shaped lobules wrapped in connective tissue. There were a lot of spherical cells surrounded by connective tissue (Fig. 3A) and many small vesicles in HPT (Fig. 3B). Suspected cell division could also be detected by SEM for the undivided cells with linked cytoskeleton responsible for mitotic anaphase (Fig. 3C). The ultrastructure properties of HPT were examined by transmission electron microscope (TEM). The chromosomes condense and nuclear membrane broken down were observed to occur in most of HPT cells (Fig. 3D), and chromosomes were found to be arranged in the equatorial plate of some cells (Fig. 3E, I). A lot of mitochondria and granules were also found in HPT cells (Fig. 3FeH). The relative size and granularity of HPT cells and hemocytes were determined by flow cytometry. The average size of HPT cells was uniform, which was smaller than that of hemocytes. The HPT

Fig. 1. The HPT of Chinese mitten crab Eriocheir sinensis. A, B: Localization of the HPT in crab underneath the carapace (the thin connective tissue covering the dorsolateral surface of the stomach). C: The ovoid lobules in hematopoietic tissue, the lobules in the upper part were bigger compared to the lower part, bar ¼ 50 mm. D: Each lobule contained a large amount of spherical cells which was approximately 5 mm in size and with big nucleus, bar ¼ 50 mm.

Fig. 2. Hematoxylin-eosin staining of the HPT. A: The hematopoietic tissue was composed of a series of ovoid lobules, bar ¼ 50 mm. B: lobule, spherical cells and connective tissue, bar ¼ 10 mm. C: Different types of cells (black arrows) in HPT, bar ¼ 10 mm.

16

Z. Jia et al. / Developmental and Comparative Immunology 60 (2016) 12e22

Fig. 3. Morphological and Ultrastructural Characters of HPT. A: Spherical cells were observed which was surrounded by connective tissue, bar ¼ 4 mm. B: Different shapes of cells were in HPT and many small vesicles were seen, bar ¼ 4 mm. C: Suspected cell division, bar ¼ 4 mm. D: Internal structures and organelles of HPT, chromosomes condense and nuclear membrane broken down were detected (black arrows), bar ¼ 2 mm. E: Mitotic metaphase cell from HPT, bar ¼ 2 mm. F, G: HPT cells contained a lot of granules (red arrows) and mitochondria (white arrows), bar ¼ 2 mm. H: Mitochondria (white arrows), bar ¼ 0.5 mm. I: Chromosomes are arranged in the equatorial plate, bar ¼ 2 mm.

cells were of less granular and their internal organelles were simple, while the hemocytes could be divided into agranulocytes and granulocytes depending on the granules in the cells (Fig. 4A). Hemocytes with different granularity and size were also detected by Hematoxylin-eosin (Fig. 4B). HPT cells were relatively smaller than hemocytes and contained little granulars (Fig. 4C).

3.3. Analyses of homologous proteins for GATA1 and RUNX1 The distributions of hematopoietic transcription factors RUNX1 and human GATA1 in HPT and hemocytes were determined by western blotting with human polyclonal antibodies, respectively. For RUNX1, three distinct bands (90, 72 and 34 KDa, respectively) were detected in HPT samples, while no signal was found in

Z. Jia et al. / Developmental and Comparative Immunology 60 (2016) 12e22

17

Fig. 4. A: Side scatter (SSC) and forward scatter (FSC) of HPT cells and hemocytes detected by flow cytometry. B: Hematoxylin-eosin staining of hemocytes, bar ¼ 10 mm. C: Hematoxylin-eosin staining of HPT cells, bar ¼ 10 mm.

hemocytes. For human GATA1, there were two bands of 30 and 25 KDa detected in HPT and hemocytes, and the signal of GATA1 was stronger in hemocytes than that in HPT. Anti-human b-tubulin polyclonal antibody was used as internal reference (Fig. 5).

3.4. Immunohistochemistry localization of GATA1 and RUNX1 Immunohistochemistry assay was performed to detect the localization of GATA1 and RUNX1, and the positive signal was of

green. GATA1 was detected in the cells which located at the lacuna of the ovoid lobules in HPT (Fig. 6A, B, C) while no signal was detected in other cells. RUNX1 were found to exist in almost all the HPT cells with no evident regularities of distribution (Fig. 6D, E). Rabbit' pre-immune serum was set as control and no signal was detected. The signals of GATA1 were detected in both digested HPT cells and hemocytes (Fig. 7A), but only a few cells were GATA1-positive. In the digested HPT cells, GATA1 was located in nuclear while it was in the cytoplasm of hemocytes. RUNX1 was mostly found to be in the nuclear of the digested HPT cells, but no signal was detected in hemocytes (Fig. 7B). 3.5. The DNA replication in HPT cells DNA replications in hemocytes and HPT were detected at 48 h after EdU injection. Only a few hemocytes were detected to be EdUpositive, which accounted for approximately 8.3% of the total hemocytes, and the signal was week (Fig. 8A). For the digested HPT cells, approximately 35.2% of the cells were EdU-positive (Fig. 8C), and the EdU signals were presented in a concentrated distribution (Fig. 8B). The EdU imaging kit was employed to observe DNA replication, and the EdU signals were detected universally in HPT, which was strong in some cells but weak in other cells (Fig. 9). No EdU signal was detected in hepatopancreas. 3.6. The mRNA expression of EsAst in hemocytes and hepatopancreas

Fig. 5. Western blot analysis of GATA1 and RUNX1. GATA1 was detected to be expressed both in HPT and hemocytes while RUNX1 only expressed in HPT. Anti-bTubulin polyclonal antibody was employed as internal reference.

The expression of EsAst mRNA in hemocytes and hepatopancreas was examined by SYBR Green Real-time PCR analysis. EsAst mRNA was higher expressed in hepatopancreas, and the expression

18

Z. Jia et al. / Developmental and Comparative Immunology 60 (2016) 12e22

Fig. 6. Immunohistochemistry of GATA1 and RUNX1 in HPT. A, B, C: GATA1 was expressed in the cells which located at the lacuna of the ovoid lobules in HPT, bar ¼ 20 mm. D, E: RUNX1 were found to express at almost every cells of HPT, bar ¼ 20 mm. F: Negative control using rabbit IgG, bar ¼ 20 mm. GATA1 and RUNX1 were visualized by Alexa Fluor 488labeled goat-anti-rabbit antibody. The tissues were stained with Evans blue dye (red). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Fig. 7. Localization of GATA1 and RUNX1. A: GATA1 was only detected in a few hemocytes and digested HPT cells, bar ¼ 10 mm. B: RUNX1 was only expressed in digested HPT cells, bar ¼ 10 mm. GATA1 and RUNX1 were visualized by Alexa Fluor 488-labeled goat-anti-rabbit antibody. Nucleus was stained with DAPI (blue). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

level was 1.38-fold than that in hemocytes. There was no EsAst mRNA detected in HPT (Fig. 10).

3.7. The mRNA expression of EsAst in hemocytes and total hemocytes counts after A. hydrophila challenge The expression of EsAst mRNA in hemocytes after A. hydrophila

Z. Jia et al. / Developmental and Comparative Immunology 60 (2016) 12e22

19

Fig. 8. Detection of EdU in hemocytes and HPT cells at 48 h after injection. A: EdU was only detected in a few hemocytes, bar ¼ 10 mm. B: A large numbers of cells with positive EdU signal were observed in digested HPT cells, bar ¼ 10 mm. C: Percentage of EdU-positive cells.

p < 0.01), 6 h (7.271-fold, p < 0.01), 9 h (3.2145-fold, p < 0.01) and 12 h (2.182-fold, p < 0.05) post stimulation compared with control group (Fig. 11A). Total hemocytes counts were measured by blood counting chamber. After A. hydrophila challenge, the THC was first downregulated at 3 h (5.312-fold, p < 0.01) and 6 h (6.375-fold, p < 0.05), and then up-regulated at 9 h (8.475-fold, p < 0.01), 12 h (8.74-fold, p < 0.01) and 24 h (7.2353-fold, p < 0.05) (Fig. 11B). 4. Discussion

Fig. 9. Detection of DNA replication by EdU. Numerous EdU-positive cells detected in HPT, bar ¼ 10 mm. No signal was detected in hepatopancreas, bar ¼ 10 mm. The tissues were stained with Evans blue dye (red). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Fig. 10. Real-time PCR analysis of EsAst mRNA expression level. EsAst mRNA transcript (relative to Esactin) from hepatopancreas, hemocytes and HPT from five crabs were normalized to hemocytes. Vertical bars represent the mean ± S.D. (N ¼ 6).

challenge was examined by SYBR Green Real-time PCR analysis. EsAst mRNA was significantly up-regulated at 3 h (5.378-fold,

Cellular processes, such as melanization, coagulation and phagocytosis, are rapid immune reactions in invertebrates mediated by hemocytes in response to microorganisms (Lin and € derh€ So all, 2011). A rapid recovery of hemocytes, hematopoiesis is of vital importance for the animal to response against an infection (Sequeira et al., 1996). The knowledge about invertebrate hematopoiesis is mainly come from the fruit fly D. melanogaster (Williams, € derha €ll et al., 2007), and the freshwater crayfish P. leniusculus (So 2005). In decapod crustaceans, the hematopoietic tissue is identified as a thin sheet from the dorsal part of stomach of shore crab Carcinus maenas and the lobster Homarus americanus (Johansson et al., 2000; Martin et al., 1993), but it is completely unknown in Chinese mitten crab E. sinensis. In the present study, the hematopoietic tissue (EsHPT) in Chinese mitten crab E. sinensis was identified as a thin sheet with a few cells at the dorsolateral part of stomach (Fig. 1A, B). Similar to the HPT from freshwater crayfish P. leniusculus, EsHPT contained a series of ovoid lobules and each lobule was surrounded by connective tissues (Fig. 1C). Cells in EsHPT, approximately 5 mm in size, were of less granular (Fig. 4) with big nucleus (Fig. 1D). There were different types of cell in EsHPT (Fig. 2C), which were not well differentiated, or in different developmental stages of pro-hemocytes. In freshwater crayfish P. leniusculus, HPT encompasses at least 5 different cell types corresponding to the developmental stages of GCs and SGCs (Lin and € derh€ So all, 2011). The suspected cell division could be observed by SEM (Fig. 3C), and the cells in different stages of mitosis were also detected via TEM (Fig. 3D, E). A lot of mitochondria (Fig. 3G, H) were observed in the cells, which were responsible for the cell division. Interestingly, no anaphase cells were found in EsHPT, which were suspected to be released from the tissue before maturation. The

20

Z. Jia et al. / Developmental and Comparative Immunology 60 (2016) 12e22

Fig. 11. EsAst mRNA expression level detected by real-time PCR and total hemocytes counts post A. hydrophila challenge. A: Temporal expression of the EsAst transcripts in hemocytes after A. hydrophila stimulation was measured by Real-time PCR. Comparison of the level of EsAst mRNA (relative to EsActin) was normalized to 0 h. B: 100 mL A. hydrophila in sterile saline was injected into each crabs and the hemocytes were collected and counted at the indicated time course. Vertical bars represent the mean ± S.D. (N ¼ 6). *p < 0.05, **p < 0.01.

results suggested that cells from EsHPT had similar morphological features with stem cells and also had strong proliferative ability. Hematopoiesis is a process to continuously produce hemocytes, and the cells in HPT exhibit strong proliferative ability. The cell proliferation can be measured by BrdU or EdU labeling assays (Li and Darzynkiewicz, 1995; Wilson et al., 2008). In the crayfish, the BrdU could be detected at 90 min after injection and lasted to 24 € derh€ days (So all et al., 2003). The regeneration of hemocytes in shrimp Litopenaeus vannamei could be observed by BrdU labeling at 48 h after injection (Sun et al., 2013a). In the present study, EdU could be observed ubiquitously in HPT at 48 h after injection, (Fig. 9). The EdU signal intensity in cells indicated the DNA replication, and the EdU-positive cells were approximately 35.2% in HPT (Fig. 8). Similar result was reported in freshwater crayfish P. leniusculus, and about 35% of HPT cells were labeled in the first € derh€ day after BrdU injection (So all et al., 2003). Meanwhile, EdU signal was also detected in hemocytes (8.3%), indicating that the HPT contained a large number of stem cells and the pro-hemocytes could be released into the hemolymph.

Hematopoiesis is tightly regulated by numerous transcription factors (Cumano and Godin, 2001; Denk et al., 2000), and RUNX and GATA are two main transcription factor families which play critical roles during hematopoiesis from Drosophila to mammals (Ferjoux et al., 2007). In mammals, three RUNX genes were reported to participate in one or more stages of hematopoiesis (Cameron and Neil, 2004), and RUNX factor Lozenge (Lz) was also found to be indispensable for the crystal cell formation during hematopoiesis in D. Melanogaster (de Bruijn and Speck, 2004). In the present study, three homologues of human RUNX1 were revealed from EsHPT by using anti-human RUNX1 antibody (Fig. 4). It was suspected that they were the different isoforms of RUNX1, or there were three RUNX gene families like mammalians, and the detailed mechanism should be further investigated. RUNX1 was found to exist in the nucleus of almost every HPT cells, while no signal was detected in hemocytes (Figs. 5 and 6). RUNX1 is also known as core-binding factor (Elagib et al., 2003), and it is essential for the development of hematopoietic stem cells, as well as for lymphocyte and megakaryocyte differentiation (North et al., 1999). The present results suggested that RUNX could serve as important regulators during the proliferation and differentiation of crab hemocytes, and it should be a potential marker for HPT. The GATA transcription factors family contains evolutionarily conserved proteins that are of vital importance in regulating the development and differentiation of eukaryotic organisms, especially hematopoiesis. GATA1 is mainly expressed in terminal differentiated erythroid, megakaryocytic, eosinophilic and mast cells, playing essential roles in regulating the development of these cells (Fujiwara et al., 1996; Leonard et al., 1993; Migliaccio et al., 2003; Shivdasani et al., 1997). In the present study, homologues of human GATA1 were detected from both HPT and hemocytes with different molecular weights (Fig. 4). It was suspected that there were different homologues of GATA1 or GATA1 was modified during the maturation of hemocytes. In HPT, GATA1 was detected to be expressed in the lacuna of the ovoid lobules in (Fig. 5), and only a few cells specifically expressed GATA1 in HPT as well as hemocytes (Fig. 6). In crustacean P. leniusculus, GATA could bind to transglutaminase to regulate the release of the hematopoietic stem cells into the hemolymph (Lin et al., 2008). In Drosophila, the GATA factor Serpent (Srp) was expressed in blood cell progenitors and maintained in the two main classes of differentiated hemocytes (Ferjoux et al., 2007). The results indicated that GATA1 was involved in the development of some kinds of hemocytes, and the GATA1 positive cells in the HPT were pro-hemocytes which would be released into the hemolymph Although RUNX1 and GATA1 were important regulators in the hematopoiesis, they have not been identified from E. sinensis, and their exact molecular features and functions are in urgent needed to be further investigated. It has been reported that the development of hematopoietic cell is regulated by transcription factors in invertebrates, such as insects and crustaceans, and vertebrates, but the information about the regulation of humoral factors in hematopoiesis is still very limited (Sricharoen et al., 2005). In crustacean, a kind of novel cytokine, astakine, has been reported to participate in hematopoiesis (Lin et al., 2011). Astakine is the homologue of vertebrate PROKs that take part in numerous biological processes such as neurogenesis, pain perception, food uptake, appetite regulation, and regulation of circadian clocks (Zhou, 2006). In the present study, the mRNA transcripts of EsAst were detected in both hepatopancreas and hemocytes, and its expression level was 1.38-fold in hepatopancreas than that in hemocytes, while it was not detectable in HPT. It has been reported that an astakine from shrimp Penaeus monodon could be released from the hemocytes to HPT to promote the cell proliferation (Hsiao and Song, 2010). In E. sinensis, the mRNA of EsAst was also found to be expressed in hepatopancreas and

Z. Jia et al. / Developmental and Comparative Immunology 60 (2016) 12e22

hemocytes, but it was not detectable in HPT. The mRNA expression level of EsAst was up-regulated while the total hemocytes counts were first down-regulated and the up-regulated post A. hydrophila challenge. Similar phenomenon was observed in oyster Crassostrea gigas and CgAstakine was significantly up-regulated post Vibrio anguillarum challenge (Li et al., 2016). Since astakine is an important regulator of hematopoiesis in crustaceans, EsAst is suggested to be released from hemocytes to promote the hematopoiesis. The detailed mechanism should be further investigated. In summary, the hematopoietic tissue of Chinese mitten crab E. sinensis was isolated and identified from the dorsolateral side of the stomach. It was a thin sheet composed of a series of ovoid lobules containing a series of stem cells. The transcription factors GATA1 and RUNX1 were expressed in EsHPT, and RUNX could be selected as a potential marker for HPT. The transcript of a novel crustacean cytokine EsAst was not detected in the hematopoietic tissue of E. sinensis. Total hemocytes counts were related to the mRNA expression level of EsAst post A. hydrophila challenge. Acknowledgements The authors are grateful to all the laboratory members for continuous technical advice and helpful discussions. This research was supported by the National Natural Science Foundation of China (No. 31530069), fund from National & Local Joint Engineering Laboratory of Ecological Mariculture and the Taishan Scholar Program of Shandong, China. References ndez, J., 2009. The human GINS Aparicio, T., Guillou, E., Coloma, J., Montoya, G., Me complex associates with Cdc45 and MCM and is essential for DNA replication. Nucl. Acids Res. 37, 2087e2095. Beck, G., Habicht, G.S., 1996. Immunity and the invertebrates. Sci. Am. 275, 60e66. Cameron, E.R., Neil, J.C., 2004. The Runx genes: lineage-specific oncogenes and tumor suppressors. Oncogene 23, 4308e4314. €derha €ll, K., 1995. The haemopoietic cells of the freshwater Chaga, O., Lignell, M., So crayfish Pacifastacus leniusculus. Anim. Biol. 4, 59e70. Chen, M.J., Yokomizo, T., Zeigler, B.M., Dzierzak, E., Speck, N.A., 2009. Runx1 is required for the endothelial to haematopoietic cell transition but not thereafter. Nature 457, 887e891. Crozatier, M., Meister, M., 2007. Drosophila haematopoiesis. Cell. Microbiol. 9, 1117e1126. Cumano, A., Godin, I., 2001. Pluripotent hematopoietic stem cell development during embryogenesis. Curr. Opin. Immunol. 13, 166e171. de Bruijn, M.F., Speck, N.A., 2004. Core-binding factors in hematopoiesis and immune function. Oncogene 23, 4238e4248. Denk, A., Wirth, T., Baumann, B., 2000. NF-kB transcription factors: critical regulators of hematopoiesis and neuronal survival. Cytokine Growth Factor Rev. 11, 303e320. Elagib, K.E., Racke, F.K., Mogass, M., Khetawat, R., Delehanty, L.L., Goldfarb, A.N., 2003. RUNX1 and GATA-1 coexpression and cooperation in megakaryocytic differentiation. Blood 101, 4333e4341. Evans, C.J., Hartenstein, V., Banerjee, U., 2003. Thicker than blood: conserved mechanisms in Drosophila and vertebrate hematopoiesis. Dev. Cell 5, 673e690. , B., Boyer, K., Haenlin, M., Waltzer, L., 2007. A GATA/RUNX cisFerjoux, G., Auge regulatory module couples Drosophila blood cell commitment and differentiation into crystal cells. Dev. Biol. 305, 726e734. Ferreira, R., Ohneda, K., Yamamoto, M., Philipsen, S., 2005. GATA1 function, a paradigm for transcription factors in hematopoiesis. Mol. Cell Biol. 25, 1215e1227. Fujiwara, Y., Browne, C.P., Cunniff, K., Goff, S.C., Orkin, S.H., 1996. Arrested development of embryonic red cell precursors in mouse embryos lacking transcription factor GATA-1. Proc. Natl. Acad. Sci. U. S. A. 93, 12355e12358. Gai, Y., Wang, L., Zhao, J., Qiu, L., Song, L., Li, L., et al., 2009. The construction of a cDNA library enriched for immune genes and the analysis of 7535 ESTs from Chinese mitten crab Eriocheir sinensis. Fish. Shellfish Immunol. 27, 684e694. Hartenstein, V., 2006. Blood cells and blood cell development in the animal kingdom. Annu. Rev. Cell Dev. Biol. 22, 677e712. Hsiao, C.Y., Song, Y.L., 2010. A long form of shrimp astakine transcript: molecular cloning, characterization and functional elucidation in promoting hematopoiesis. Fish. Shellfish Immunol. 28, 77e86. Ishigaki, Y., Nakamura, Y., Takehara, T., Nemoto, N., Kurihara, T., Koga, H., et al., 2011. Ionic liquid enables simple and rapid sample preparation of human culturing cells for scanning electron microscope analysis. Microsc. Res. Tech. 74, 415e420.

21

Janeway Jr., C.A., Medzhitov, R., 2002. Innate immune recognition. Annu. Rev. Immunol. 20, 197e216. Jemaa, M., Morin, N., Cavelier, P., Cau, J., Strub, J.M., Delsert, C., 2014. Adult somatic progenitor cells and hematopoiesis in oysters. J. Exp. Biol. 217, 3067e3077. Jia, Z., Zhang, T., Jiang, S., Wang, M., Cheng, Q., Sun, M., et al., 2015. An integrin from oyster Crassostrea gigas mediates the phagocytosis toward Vibrio splendidus through LPS binding activity. Dev. Comp. Immunol. 53, 253e264. Jiang, Q., Zhou, Z., Wang, L., Wang, L., Yue, F., Wang, J., et al., 2013. A scallop nitric oxide synthase (NOS) with structure similar to neuronal NOS and its involvement in the immune defense. PloS One 8, e69158. € derh€ Johansson, M.W., Keyser, P., Sritunyalucksana, K., So all, K., 2000. Crustacean haemocytes and haematopoiesis. Aquaculture 191, 45e52. Kurtz, J., 2005. Specific memory within innate immune systems. Trends Immunol. 26, 186e192. Leonard, M., Brice, M., Engel, J.D., Papayannopoulou, T., 1993. Dynamics of GATA transcription factor expression during erythroid differentiation. Blood 82, 1071e1079. Li, X., Darzynkiewicz, Z., 1995. Labelling DNA strand breaks with BrdUTP. Detection of apoptosis and cell proliferation. Cell Prolif. 28, 571e579. Li, Y., Jiang, S., Li, M., Xin, L., Wang, L., Wang, H., et al., 2016. A cytokine-like factor astakine accelerates the hemocyte production in Pacific oyster Crassostrea gigas. Dev. Comp. Immunol. 55, 179e187. € derha €ll, I., 2011. Crustacean hematopoiesis and the astakine cytokines. Lin, X., So Blood 117, 6417e6424. € derh€ €derha €ll, I., 2008. Transglutaminase activity in the hematoLin, X., So all, K., So poietic tissue of a crustacean, Pacifastacus leniusculus, importance in hemocyte homeostasis. BMC Immunol. 9, 58. €derha €ll, K., So € derh€ Lin, X., So all, I., 2011. Invertebrate hematopoiesis: an astakinedependent novel hematopoietic factor. J. Immunol. 186, 2073e2079. Little, T.J., Hultmark, D., Read, A.F., 2005. Invertebrate immunity and the limits of mechanistic immunology. Nat. Immunol. 6, 651e654. Lugo-Villarino, G., Balla, K.M., Stachura, D.L., Banuelos, K., Werneck, M.B., Traver, D., 2010. Identification of dendritic antigen-presenting cells in the zebrafish. Proc. Natl. Acad. Sci. U. S. A. 107, 15850e15855. Martin, D.I., Zon, L.I., Mutter, G., Orkin, S.H., 1990. Expression of an erythroid transcription factor in megakaryocytic and mast cell lineages. Nature 344, 444e447. Martin, G.G., Hose, J.E., Choi, M., Provost, R., Omori, G., McKrell, N., et al., 1993. Organization of hematopoietic tissue in the intermolt lobster, Homarus americanus. J. Morphol. 216, 65e78. Martinez-Agosto, J.A., Mikkola, H.K., Hartenstein, V., Banerjee, U., 2007. The hematopoietic stem cell and its niche: a comparative view. Genes Dev. 21, 3044e3060. Medzhitov, R., Janeway, C.A., 1997. Innate immunity: impact on the adaptive immune response. Curr. Opin. Immunol. 9, 4e9. Migliaccio, A.R., Rana, R.A., Sanchez, M., Lorenzini, R., Centurione, L., Bianchi, L., et al., 2003. GATA-1 as a regulator of mast cell differentiation revealed by the phenotype of the GATA-1low mouse mutant. J. Exp. Med. 197, 281e296. North, T., Gu, T.L., Stacy, T., Wang, Q., Howard, L., Binder, M., Marin-Padilla, M., Speck, N.A., 1999. Cbfa2 is required for the formation of intra-aortic hematopoietic clusters. Development 126, 2563e2575. Radtke, F., Wilson, A., MacDonald, H.R., 2005. Notch signaling in hematopoiesis and lymphopoiesis: lessons from Drosophila. Bioessays 27, 1117e1128. Romeo, P.H., Prandini, M.H., Joulin, V., Mignotte, V., Prenant, M., Vainchenker, W., et al., 1990. Megakaryocytic and erythrocytic lineages share specific transcription factors. Nature 29, 447e449. € derh€ €derh€ So all, I., Bangyeekhun, E., Mayo, S., So all, K., 2003. Hemocyte production and maturation in an invertebrate animal; proliferation and gene expression in hematopoietic stem cells of Pacifastacus leniusculus. Dev. Comp. Immunol. 27, 661e672. € derh€ €derha €ll, K., 2005. An ancient So all, I., Kim, Y.A., Jiravanichpaisal, P., Lee, S.Y., So role for a prokineticin domain in invertebrate hematopoiesis. J. Immunol. 174, 6153e6160. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 3, 1101e1108. Sequeira, T., Tavares, D., Arala-Chaves, M., 1996. Evidence for circulating hemocyte proliferation in the shrimp Penaeus japonicus. Dev. Comp. Immunol. 20, 97e104. Shivdasani, R.A., Fujiwara, Y., McDevitt, M.A., Orkin, S.H., 1997. A lineage-selective knockout establishes the critical role of transcription factor GATA-1 in megakaryocyte growth and platelet development. EMBO J. 16, 3965e3973. €derha €ll, I., 2005. Exocytosis and proteSricharoen, S., Kim, J.J., Tunkijjanukij, S., So omic analysis of the vesicle content of granular hemocytes from a crayfish. Dev. Comp. Immunol. 29, 1017e1031. Sun, M., Wang, L., Jiang, S., Liu, R., Zhao, D., Chen, H., et al., 2015. CpG ODNs induced autophagy via reactive oxygen species (ROS) in Chinese mitten crab, Eriocheir sinensis. Dev. Comp. Immunol. 52, 1e9. Sun, R., Qiu, L., Yue, F., Wang, L., Liu, R., Zhou, Z., et al., 2013a. Hemocytic immune responses triggered by CpG ODNs in shrimp Litopenaeus vannamei. Fish. Shellfish Immunol. 34, 38e45. Sun, R., Yue, F., Qiu, L., Zhang, Y., Wang, L., Zhou, Z., et al., 2013b. The CpG ODNs enriched diets enhance the immuno-protection efficiency and growth rate of Chinese mitten crab, Eriocheir sinensis. Fish. Shellfish Immunol. 35, 154e160. Wang, M., Wang, L., Zhou, Z., Gao, Y., Shi, X., Gai, Y., et al., 2013a. The molecular characterization of a catalase from Chinese mitten crab Eriocheir sinensis. Int. J.

22

Z. Jia et al. / Developmental and Comparative Immunology 60 (2016) 12e22

Immunogenet 40, 230e240. Wang, M., Zhang, D., Wang, L., Gai, Y., Zhou, Z., Zhang, H., et al., 2013b. The molecular characterization of a cyclophilin A from Chinese mitten crab Eriocheir sinensis and the antifungal activity of its recombinant protein. Electron J. Biotechnol. 16, 2. Williams, M.J., 2007. Drosophila hemopoiesis and cellular immunity. J. Immunol. 178, 4711e4716. Wilson, A., Laurenti, E., Oser, G., van der Wath, R.C., Blanco-Bose, W., Jaworski, M.,

et al., 2008. Hematopoietic stem cells reversibly switch from dormancy to selfrenewal during homeostasis and repair. Cell 135, 1118e1129. Zhang, T., Qiu, L., Sun, Z., Wang, L., Zhou, Z., Liu, R., et al., 2014. The specifically enhanced cellular immune responses in Pacific oyster (Crassostrea gigas) against secondary challenge with Vibrio splendidus. Dev. Comp. Immunol. 45, 141e150. Zhou, Q.Y., 2006. The prokineticins: a novel pair of regulatory peptides. Mol. Interv. 6, 330.