Identification of amino acids in auxiliary replicase protein p27 critical for its RNA-binding activity and the assembly of the replicase complex in Red clover necrotic mosaic virus

Virology 413 (2011) 300–309

Contents lists available at ScienceDirect

Virology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y v i r o

Identification of amino acids in auxiliary replicase protein p27 critical for its RNA-binding activity and the assembly of the replicase complex in Red clover necrotic mosaic virus Kiwamu Hyodo 1, Akira Mine 1, Hiro-oki Iwakawa 2, Masanori Kaido, Kazuyuki Mise, Tetsuro Okuno ⁎ Laboratory of Plant Pathology, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606–8502, Japan

a r t i c l e

i n f o

Article history: Received 11 January 2011 Returned to author for revision 4 February 2011 Accepted 20 February 2011 Available online 26 March 2011 Keywords: Red clover necrotic mosaic virus Dianthovirus Positive-strand RNA virus RNA replication Replicase proteins Replicase complex RNA-binding RNA recognition

a b s t r a c t The specific recognition of genomic RNAs by viral replicase proteins is a key regulatory step during the early replication process in positive-strand RNA viruses. In this study, we characterized the RNA-binding activity of the auxiliary replicase protein p27 of Red clover necrotic mosaic virus (RCNMV), which has a bipartite genome consisting of RNA1 and RNA2. Aptamer pull-down assays identified the amino acid residues of p27 involved in its specific interaction with RNA2. The RNA-binding activity of p27 correlated with its activity in recruiting RNA2 to membranes. We also identified the amino acids required for the formation of the 480-kDa replicase complex, a key player of RCNMV RNA replication. These amino acids are not involved in the functions of p27 that bind viral RNA or replicase proteins, suggesting an additional role for p27 in the assembly of the replicase complex. Our results demonstrate that p27 has multiple functions in RCNMV replication. © 2011 Elsevier Inc. All rights reserved.

Introduction Positive-strand RNA viruses are replicated by the viral replicase complex on intracellular membranes (Ahlquist, 2006). The replicase complex consists of viral replication templates, viral replicase proteins, such as RNA-dependent RNA polymerase (RdRP) and auxiliary proteins, and host-derived proteins (Ahlquist et al., 2003). In host cells, viral replicase proteins selectively recruit viral replication templates and other components of the replicase complex into intracellular membranes for the assembly of the viral replicase complex (Ahlquist et al., 2003; Nagy and Pogany, 2008). For example, the auxiliary replicase protein p33 of the tombusviruses (Tomato bushy stunt virus [TBSV] and Cucumber necrosis virus) recruits a replicon RNA and p92 RdRP into the peroxisomal membranes in yeast, a model host for the study of virus replication (Panavas et al., 2005). p33 binds directly to an internal replication element present in the replicon RNA (Pogany et al., 2005) and interacts with p92 via a ⁎ Corresponding author at: Laboratory of Plant Pathology, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kitashirakawa, Kyoto 606–8502, Japan. Fax: +81 75 753 6131. E-mail address: [email protected] (T. Okuno). 1 These authors contributed equally to this work. 2 Present address: Institute of Molecular and Cellular Biosciences, The University of Tokyo, IMCB Main Building, Room 205 and 206, 1-1-1, Yayoi, Bunkyo-ku, Tokyo 113– 0032, Japan. 0042-6822/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2011.02.017

protein−protein interaction (Rajendran and Nagy, 2004 and 2006). Both these interactions are required for the assembly of the Tombusvirus replicase complex (Panaviene et al., 2004 and 2005; Pogany et al., 2005; Rajendran and Nagy, 2006). In Brome mosaic virus (BMV), the 1a auxiliary protein recruits replication templates and 2a RdRP to the endoplasmic reticulum (ER) membrane, which is the site of replication in BMV (Liu et al., 2009; Schwartz et al., 2002 and 2004; Wang et al., 2005). The specific recognition of the replication templates by 1a depends on 1a-responsive elements, which are present at the 5′ end of RNA2 and in the intergenic region of RNA3 (Chen et al., 2001; Schwartz et al., 2002; Sullivan and Ahlquist, 1999). 1a, 2a, and the viral nucleotide sequences of RNA3, including the 1aresponsive element, are required for the assembly of the functional BMV replicase complex in yeast (Quadt et al., 1995). All these data imply that the viral auxiliary protein is a key player in the recognition of viral replication templates and the assembly of the viral replicase complex. Despite intensive studies of several viral auxiliary proteins, their functions in viral RNA replication are not fully understood. Red clover necrotic mosaic virus (RCNMV) is a positive-strand RNA plant virus and a member of the genus Dianthovirus in the family Tombusviridae. Dianthovirus is taxonomically distinct from the other viruses of Tombusviridae because of the bipartite nature of its genome. RCNMV genomic RNA1 and RNA2 have neither cap structures at their 5′ ends nor poly (A) tails at their 3′ ends (Lommel et al., 1988; Mizumoto et al., 2003). Instead, the 3′ untranslated region (3′ UTR) of

K. Hyodo et al. / Virology 413 (2011) 300–309

RNA1 contains a cis-acting RNA element that is responsible for capindependent translation (Mizumoto et al., 2003; Sarawaneeyaruk et al., 2009). Although RNA2 has no such RNA element, efficient capindependent translation occurs after the replication of RNA2 (Mizumoto et al., 2006). RNA1 encodes two replicase component proteins, a 27-kDa auxiliary protein (p27) and its N-terminally overlapping − 1 frameshifted product, an 88-kDa RdRP (p88) (Kim and Lommel, 1994 and 1998; Xiong et al., 1993b). RNA1 also encodes a coat protein, which is translated from the subgenomic RNA (sgRNA) (Xiong and Lommel, 1989). The transcription of sgRNA requires an intermolecular interaction between RNA1 and RNA2 (Sit et al., 1998; Tatsuta et al., 2005). RNA2 encodes a movement protein that is required for viral movement in plants (Kaido et al., 2009; Xiong et al., 1993a). p27, together with p88 and some host proteins, forms the 480-kDa replicase complex of RCNMV, which is a key player in the replication of both RNA1 and RNA2 (Mine et al., 2010a and b). p27 binds to the Y-shaped RNA element (YRE) located in the 3′ UTR of RNA2 via a direct RNA−protein interaction and to RNA1 in a translation-coupled manner (Iwakawa et al., 2011). The former interaction is essential for the membrane association and subsequent negative-strand synthesis of RNA2 (An et al., 2010; Iwakawa et al., 2011). The latter interaction, in combination with the translation-coupled interaction of p88 with RNA1, is important for the synthesis of negative-strand RNA1 (Iwakawa et al., 2011; Okamoto et al., 2008). Both p27 and p88 are localized to the ER membranes (Turner et al., 2004). These findings suggest that the auxiliary protein p27 plays important roles in the early replication processes of RCNMV, including the recruitment of the replication templates to the ER membranes, the formation of the 480kDa replicase complex, and negative-strand RNA synthesis. However, the RNA-binding domain(s) of p27 have not been investigated and the functions of p27 in RCNMV infection are not fully understood. In this study, to characterize the functions of p27 and its role in the early replication processes of RCNMV, we first identified the regions and critical amino acid residues in p27 that are involved in its specific YRE-mediated interaction with RNA2, using an aptamer pull-down assay. We then analyzed the p27-mediated membrane association of RNA2 and the formation of the 480-kDa replicase complex using in vitro fractionation and blue-native polyacrylamide gel electrophoresis (BN-PAGE). We found that the recruitment of RNA2 to the membrane fraction depends on the binding of p27 to YRE. We also showed that the binding of p27 to RNA and to the replicase proteins, including itself, are insufficient but necessary to facilitate the formation of the functional 480-kDa replicase complex, which is essential for the negative-strand synthesis of RNA2. In this study, we also identified the amino acids whose mutations abolished the formation of the 480kDa replicase complex, but did not affect the binding of p27 to the viral RNA or replicase proteins, suggesting an additional role for p27 in the assembly of the replicase complex. These results indicate that p27 plays multiple roles during the early replication processes of RCNMV.

301

at 21,000g of BYL (BYLS20) expressing wild-type or truncated p27FLAG proteins, and the STagT-fused RNA–protein complexes were affinity purified with streptomycin-conjugated beads (Iwakawa et al., 2011). The purified RNA and copurified p27-FLAG proteins were analyzed with ethidium bromide staining and immunoblotting, using an anti-FLAG antibody, respectively. The STagT-fused YRE was purified efficiently in all incubations (Fig. 1B, bottom panels). Wildtype p27-FLAG protein, but not RLuc-FLAG protein, was copurified with YRE in the affinity-purified fraction (Fig. 1B, lanes 1 and 2, middle panels), confirming the specific interaction of p27 with YRE (Iwakawa et al., 2011). p27-FLAGΔ21–40, p27-FLAGΔ114–136, and p27FLAGΔ137–156 were negligibly or not detected before affinity purification (Fig. 1B, lanes 4, 11, and 12, top panels), suggesting the importance of these deleted amino acids for the stability of p27. p27FLAGΔ41–60, p27-FLAGΔ81–100, p27-FLAGΔ157–176, and p27FLAGΔ177–196 were negligibly or not detected in the affinity-purified fractions (Fig. 1B, lanes 5, 7, 13, and 14, middle panels). The remaining deletion derivatives of p27-FLAG were copurified with YRE as efficiently as was wild-type p27-FLAG (Fig. 1B, lanes 3, 6, 8, and 15, middle panels). These results demonstrate that the N-terminal amino acids 21–60 and 81–100 and the C-terminal amino acids 157–196 are required for the p27−YRE interaction. Identification of the amino acid residues in p27 critical for the p27–YRE interaction To identify the amino acid residues within the N- and C-terminal regions of p27 that are critical for the p27−YRE interaction (Fig. 1), we generated alanine-scanning mutants of p27-FLAG. The introduced mutations included single amino acid substitutions: lysine to alanine (K25A, K43A, and K86A); arginine to alanine (R42A and R164A); histidine to alanine (H53A, H179A, and H180A); glutamic acid to alanine (E178A); and a double amino acid substitution (HH179–180AA). We selected these amino acids because positively charged amino acids are expected to be exposed on the protein surface and therefore to be involved in interactions with other macromolecules, such as RNA and proteins (Auweter et al., 2006; Draper, 1999; Panaviene et al., 2003; Rajendran and Nagy, 2003), and because these amino acids are conserved among the dianthoviruses (Fig. 2A). The p27-FLAG mutants with these mutations were tested for the p27−YRE interaction using STagT affinity purification, as described above. p27-FLAG/R164A, p27FLAG/H179A, p27-FLAG/H180A, and p27-FLAG/HH179–180AA were negligibly detected in the affinity-purified fractions (Fig. 2B, lanes 10 and 12–14, middle panels), whereas the remaining mutants were copurified with YRE as efficiently as was wild-type p27 (Fig. 2B, lanes 3–7, and 11, middle panels). These results indicate that the arginine residue at position 164 (R164) and the histidine residues at positions 179 and 180 (H179 and H180) are important for the p27−YRE interaction. Binding activity of p27 to YRE is required for recruiting RNA2 to the membranes

Results Mapping the region(s) in p27 involved in its specific binding to YRE To determine the domains in p27 responsible for its specific interaction with YRE of RNA2, we constructed a series of deletion mutants of C-terminally FLAG-tagged p27 (p27-FLAG; Fig. 1A) and tested their binding activities to YRE using modified StreptoTag (STagT) affinity purification methods. STagT affinity purification has been used successfully to analyze RNA–protein interactions (Dangerfield et al., 2006), including the interaction between p27 and YRE (Iwakawa et al., 2011). In this assay, we used a cell-free in vitro translation/replication system prepared from evacuolated tobacco BY-2 protoplasts (BYL; Komoda et al., 2004). The STagT-fused YRE was incubated in the supernatant fractions produced by the centrifugation

We previously reported that the p27−YRE interaction is required for the membrane association of RNA2 (Iwakawa et al., 2011). To test the effects of the introduced mutations described above on the recruitment of RNA2 to the membranes, we performed a fractionation assay using BYL. BYL expressing p27-FLAG or its derivatives in the presence of RNA2 were centrifuged at 21,000g to yield a membranecontaining pelleted fraction and a supernatant fraction. The proteins and RNAs extracted from the total, pelleted, and supernatant fractions were analyzed with immuno- and northern blotting, respectively. Sec61, an integral ER membrane protein, was detected in the pelleted fraction but not in the supernatant fraction (data not shown), confirming that the pelleted fraction contained the ER. All the p27FLAG mutants accumulated to similar levels in the membrane fraction (Fig. 3A). When the p27-FLAG proteins with mutations that

302

K. Hyodo et al. / Virology 413 (2011) 300–309

Fig. 1. Mapping the regions within p27 required for the p27–YRE interaction. (A) A schematic representation of the deleted derivatives of p27-FLAG. The deletions are represented as bent lines. All the mutants have a FLAG-tag sequence at their C-termini. (B) In vitro pull-down assay of FLAG-tagged p27 or its derivatives by Strepto-tagged YRE. (Top) Input of the indicated FLAG-tagged p27 proteins. (Middle) FLAG-tagged p27 proteins copurified with Strepto-tagged RNA. Immunoblots were probed with an anti-FLAG antibody. (Bottom) Purified Strepto-tagged YRE. The gel was stained with ethidium bromide.

compromised their interactions with YRE (R164A, H179A, H180A, and HH179–180AA; Fig. 3B) were tested, the levels of RNA2 accumulated in the membrane fractions were greatly reduced whereas the remaining p27-FLAG proteins with mutations that did not affect the p27−YRE interaction supported the recruitment of RNA2 to the membrane fraction at levels similar to that recruited by wild-type p27 (Fig. 3B). The correlation between the levels of RNA2 accumulated in the membrane fraction and the binding activity of the p27-FLAG mutants to YRE (Figs. 2B and 3B) indicates that the binding of p27 to YRE plays an essential role in the recruitment of RNA2 to the membrane fraction and confirms the importance of the p27−YRE interaction in RNA2 recruitment to the membranes (Iwakawa et al., 2011). Roles of the binding activity of p27 to YRE in negative-strand RNA synthesis To investigate whether there is a functional relationship between the binding of p27 to YRE and negative-strand RNA synthesis, the p27FLAG mutants were incubated with RNA2 together with RNA1-p88,

which expresses p88 alone, in BYL. The total RNAs and proteins were extracted after incubation for 4 h. Northern blot analysis showed that the p27-FLAG proteins with mutations that compromised the p27−YRE interaction abolished or greatly reduced the accumulation of negative-strand RNA2 (Fig. 4A, lanes 8 and 10–12). All p27 proteins accumulated to similar levels in BYL (Fig. 4A). Similar results were obtained in BY-2 protoplasts, in which p88 was expressed from a plasmid that encodes an mRNA containing the open reading frame of p88 (Fig. 4B). These results suggest that the binding of p27 to YRE is important for the negative-strand synthesis of RNA2. Interestingly, however, p27-FLAG/R42A, p27-FLAG/K86A, and p27-FLAG/E178A, which can interact with YRE, dramatically reduced the accumulated levels of negative-strand RNA2 in BYL (Fig. 4A, lanes 4, 7, and 9), as well as the levels of positive-strand RNA2 in BY-2 protoplasts (Fig. 4B, lanes 4, 7, and 9). These mutants were not copurified with YRE-M that possesses a substitution mutation in the loop sequence of SL8 in YRE (refer to R2-3′-84M-S in Iwakawa et al., 2011; data not shown). These results indicate that these mutations impair the function(s) of p27 required for the negative-strand synthesis of RNA2 other than its binding to YRE and the recruitment of RNA2 to the membranes.

Fig. 2. Residues R164, H179, and H180 in p27 are important for its binding to YRE. (A) Sequence alignment of the regions within p27 involved in its binding to YRE in RCNMV and other dianthoviruses. Asterisks indicate the conserved amino acids selected for mutagenesis in RCNMV p27. The following abbreviations are used: SCNMV, Sweet clover necrotic mosaic virus; CRSV, Carnation ring spot virus. (B) In vitro pull-down assays of FLAG-tagged p27 and its alanine-scanning mutant derivatives by YRE. Other details are as described in the legend to Fig. 1.

K. Hyodo et al. / Virology 413 (2011) 300–309

303

its derivatives were incubated with RNA1-p88 in BYL or were coexpressed with RNA1-p88 from plasmids in BY-2 protoplasts. We chose this combination because only RNA1, from which p88 is translated, is an efficient template for replication in the presence of p27 (Okamoto et al., 2008). The total RNAs and proteins were extracted from BYL or BY-2 protoplasts after incubation for 4 h or 24 h, respectively. All the p27-FLAG proteins accumulated efficiently in both BYL and BY-2 protoplasts (Fig. 5). Northern blot analysis showed that the class I and class II mutations abolished or greatly reduced the levels of negative-strand RNA1 accumulated in both BYL (Fig. 5A, lanes 4 and 7–12) and BY-2 protoplasts (Fig. 5B, lanes 4 and 7–12). These results indicate that the amino acids mutated in the class I and II mutants are important for the functions of p27 in the synthesis of negative-strand RNA1, as well as in the synthesis of RNA2. It should be noted that the levels of RNA1 accumulated by the class I mutants correlated with their binding activities to YRE of RNA2 (Fig. 2B), even though RNA1 has no RNA element, like YRE, that interacts directly with replicase proteins supplied in trans (Iwakawa et al., 2011). Effects of the introduced p27 mutations on the protein–protein interactions between RCNMV replicase proteins

Fig. 3. Effects of the mutations introduced into p27 on the recruitment of viral genomic RNA2 to the membrane fraction. (A) Immunoblot analysis of the accumulation of p27FLAG and its derivatives in the pelleted fraction from BYL. (B) Northern blot analysis of the distribution of RNA2 in the total (T), (21,000g centrifuged) supernatant (S), and pelleted (P) fractions from BYL expressing RNA2 with p27–FLAG or its derivatives. The percentage of pellet-associated RNA2 (P/[S + P]) is graphed. The signal intensities were quantified with the Image Gauge program (Fuji Photo Film, Japan). The averages of three independent experiments are shown. Error bars indicate the standard deviations.

We refer hereafter to the p27-FLAG mutants that are compromised in the p27−YRE interaction (p27-FLAG/R164A, p27-FLAG/H179A, p27-FLAG/H180A, and p27-FLAG/HH179–180AA) as “class I mutants,” and the mutants that can interact with YRE but have little or no ability to support the negative-strand RNA synthesis of RNA2 (p27-FLAG/ R42A, p27-FLAG/K86A, and p27-FLAG/E178A) as “class II mutants.” The remaining p27-FLAG mutants, which are competent to support both the p27−YRE interaction and the negative-strand synthesis of RNA2 (p27-FLAG/K25A, p27-FLAG/K43A, and p27-FLAG/H53A), are referred to as “class III mutants.” The mutations present in these mutants will also be referred to as class I, class II, and class III mutations, respectively. To investigate whether the mutations described above also affect the replication of RNA1, we tested the p27-FLAG mutants for their ability to cause the accumulation of negative-strand RNA1 in BYL and to support the replication of RNA1 in BY-2 protoplasts. p27-FLAG and

The C-terminal half of p27, encompassing amino acid residues 124–236 (p27C), is responsible for p27–p27 and p27–p88 interactions, and these interactions are required for the assembly of the 480kDa replicase complex, which is thought to be a key player in the replication of RCNMV RNA (Mine et al., 2010a and b). The class II mutation E178A and all class I mutations occur in the C-terminal region of p27. Therefore, it is possible that these mutations affect the p27–p27 and/or p27–p88 interactions, thus compromising the assembly of the 480-kDa replicase complex. To test the effects of these mutations on the p27–p27 and p27–p88 interactions, we used a glutathione S-transferase (GST) pull-down assay. N-terminally histidine (His)- and C-terminally FLAG-tagged p27C mutants expressed in Escherichia coli were purified (Fig. 6A) and tested for their interactions with N-terminally His- and GST-fused p27C (His/GST-p27C) and His/ GST-p88Δp27 (Mine et al., 2010a). His/GST-p88Δp27 is a truncated form of p88 that lacks the region that overlaps p27 and is competent to interact with p27 and to support the negative-strand synthesis of RNA2 (Mine et al., 2010a). His/GST-p27C and His/GST-p88Δp27 captured on glutathione-bound beads were incubated with purified His-p27C-FLAG mutants. After extensive washing, the bound proteins were analyzed by immunoblotting with an anti-FLAG antibody. The results showed that the substitution of H179 with alanine inhibited the interaction of p27 with His/GST-p27C but not its interaction with His/GST-p88Δp27 (Fig. 6B and C, lane 10). The substitution of H180 or HH179–180 with alanine(s) inhibited the interactions of p27 with both His/GST-p27C and His/GST-p88Δp27 (Fig. 6B and C, lanes 11 and 12). These results suggest that H179 and H180 are important not only for the p27−YRE interaction but also for the p27–p27 and/or p27–p88 interactions. Interestingly, however, the class I mutant p27FLAG/R164A and the class II mutant p27-FLAG/E178A interacted with both p27 and p88Δ27 (Fig. 6B and C, lanes 8 and 9). The ability of p27FLAG/E178A to interact with p88Δ27 was much greater than the interaction of wild-type p27 (Fig. 6C, lane 9). Amino acids required for the formation of the 480-kDa replicase complex on RNA2 The successful interactions of the class I mutant p27-FLAG/R164A and the class II mutant p27-FLAG/E178A with both p27 and p88Δ27 prompted us to investigate whether these mutants are competent to form the 480-kDa replicase complex. To investigate the accumulation of the 480-kDa replicase complex, we incubated transcripts that expressed wild-type or mutant p27FLAG, together with RNA1-p88 and RNA2 in BYL. After incubation for

304

K. Hyodo et al. / Virology 413 (2011) 300–309

Fig. 4. Effects of the mutations introduced into p27 on the negative-strand synthesis and replication of RNA2. (A) Accumulation of negative-strand RNA2 in BYL incubated with RNA2 and RNA1-p88, together with p27-FLAG or its derivatives. The total RNAs and proteins were extracted after incubation for 4 h and used for northern and immunoblotting analyses, respectively. The details are as described in Materials and methods. The ribosomal RNA (rRNA) is shown below the northern blots as the loading control. (B) Full-length RNA2 was cotransfected with plasmid expressing p27-FLAG that carried a specific mutation and plasmid expressing p88 in BY2 protoplasts (5 × 105 cells per experiment). The total RNAs and proteins were extracted 16 h after infection and used for northern and immunoblotting analyses, respectively. The relative accumulation of negative- (A) and positive-strand (B) RNA2 with wild-type p27-FLAG and its derivatives is shown (wild-type p27-FLAG was set at 100%). The signal intensities were quantified with the Image Gauge program. The averages of three independent experiments are shown. Error bars indicate the standard deviations.

4 h, the protein samples were subjected to BN-PAGE and analyzed by immunoblotting with an anti-FLAG antibody. The accumulated levels of the 480-kDa replicase complex were below the level of detection in BYL expressing the class II mutants (Fig. 7, lanes 4, 7, and 9) or the class I mutant p27-FLAG/HH179–180AA (Fig. 7, lane 12). It should be noted that the class II mutations R42A and K86A are in the region that is not essential for the p27–p27 or p27–p88 interaction (Mine et al.,

2010a). The class I mutants with a single mutation accumulated reduced amounts of the 480-kDa replicase complex compared with that accumulated by wild-type p27 (Fig. 7, lanes 8, 10, and 11), although the effect of the R164A mutation was milder than those of the other single mutations. These results indicate that the class II mutations and the HH179–180AA mutation had very deleterious effects on the capacity of p27 to form the 480-kDa replicase complex,

Fig. 5. Effects of the mutations introduced into p27 on the negative-strand synthesis and replication of RNA1. (A) The accumulation of negative-strand RNA1-p88 in BYL incubated with RNA1-p88, together with p27-FLAG or its derivatives. (B) p27-FLAG and its derivatives were coexpressed with RNA1-p88 from plasmids in the protoplasts. The total RNAs and proteins were extracted 24 h after infection and used for northern and immunoblotting analyses, respectively. For other details, refer to the legend to Fig. 4.

K. Hyodo et al. / Virology 413 (2011) 300–309

305

Fig. 7. Effects of the mutations introduced into p27 on the formation of the 480-kDa RCNMV replicase complex. Accumulation of the 480-kDa complex in BYL incubated with transcripts that expressed the p27-FLAG mutants and p88 in the presence of RNA2. The total proteins were extracted 4 h after incubation and subjected to SDS–PAGE and BN-PAGE analyses, followed by immunoblotting with an anti-FLAG antibody.

its diverse functions that are required to play multiple roles during the early replication processes of RCNMV.

RNA-binding domains of p27

Fig. 6. Effects of the mutations introduced into p27 on the protein–protein interactions between RCNMV replicase proteins. (A) SDS–PAGE analysis of purified His–p27C–FLAG or its derivatives expressed in E. coli. The purified proteins (500 ng) were visualized with Coomassie Brilliant Blue (CBB) staining (left panel), and analyzed by immunoblotting with anti-FLAG antibody (right panel). (B and C) In vitro interactions between His–p27C–FLAG or its derivatives and His/GST–p27C or His/GST–p88Δp27. His–p27C– FLAG or its derivatives were incubated with glutathione-resin-bound His/GST–p27C (B) or His/GST–p88Δp27 (C). After they were washed, the pulled-down complexes were subjected to SDS–PAGE and blotted onto membrane. The separated proteins on the membrane were visualized with Ponceau S staining (upper panel), and analyzed by immunoblotting with anti-FLAG antibody (lower panel).

and that the other single class I mutations also affected the capacity of p27 to form the replicase complex. The class III mutants allowed the accumulation of the 480-kDa replicase complex to levels similar to those accumulated by wild-type p27-FLAG (Fig. 7, lanes 2, 3, 5 and 6).

Discussion The present study demonstrated that the auxiliary replicase protein p27 of RCNMV consists of several domains responsible for

The deleterious effects of deletions in both the N- and C-terminal regions of p27 on the p27–YRE interaction (Fig. 1B, lanes 5, 7, 13, and 14) suggest the involvement of multiple domains of p27 in its RNA-binding activity. However, alanine-scanning mutations introduced into the Nterminal region of p27-FLAG had no deleterious effects on the p27−YRE interaction (Fig. 2B, lanes 3–7) whereas those introduced into the Cterminal region, such as R164A, H179A, H180A, and HH179–180AA, abolished or greatly reduced the p27−YRE interaction. This mutagenesis analysis suggests that the C-terminal region, encompassing at least amino acids 157–196, is a major determinant of the RNA-binding property of p27. This idea is supported by an in silico analysis of the p27 protein with the program RNABindR (Terribilini et al., 2006 and 2007), which predicted that the C-terminal region of p27 is a potential RNAbinding site, but that the N-terminal region is not (data not shown). The N-terminal region of p27 might be important in supporting the conformation of p27 required for its interaction with YRE. In our previous study, we demonstrated that C-terminal amino acid residues 124–236 of p27 are essential for both the p27–p27 and the p27–p88 interactions through direct contact, and that the p27– p88 interaction occurs between the C-terminal half of p27 and the nonoverlapping unique region of p88 (Mine et al., 2010a). The deletion of C-terminal amino acids 197–236, which are essential for the p27–p27 and p27–p88 interactions (data not shown), had no deleterious effect on the RNA-binding activity of p27 (Fig. 1B, lane 15), indicating that different functional domains of p27 are required for its binding to RNA and protein. However, the class I mutations (R164A, H179A, H180A, and HH179–180AA) had deleterious effects on the RNA-binding activity of p27, and these mutations occur in the region required for protein binding. These results indicate that the main functional domains required for RNA and protein binding differ, but that these domains overlap in p27.

306

K. Hyodo et al. / Virology 413 (2011) 300–309

Roles of p27 in the replication of RNA2 The class I mutants with no or reduced activity to bind RNA were also compromised in their recruitment of RNA2 to the membrane fraction and in the negative-strand synthesis of RNA2 (Figs. 2B, 3, and 4). The robust correlation between these functions of p27 strongly suggests that the RNA-binding activity of p27 plays an essential role in the recruitment of RNA2 to the membranes, which are the sites of RCNMV RNA replication. The class I mutations also compromised the formation of the 480kDa replication complex, although the effect of the R164A mutation was very mild (Fig. 7, lanes 8 and 10–11). This mild effect might be partly explained by the fact that the R164A mutation has no effect on the interactions between the replicase protein components (Fig. 6B and C, lane 8). The class II mutants (R42A, K86A, and E178A) retained the ability to interact with both YRE and the replicase proteins (Figs. 2B and 6B and C), but lost the capacity to form the 480-kDa replicase complex (Fig. 7, lanes 4, 7, and 9). It is possible that the class II mutations affect the interactions between p27 and the host proteins, directly or indirectly, and the subsequent assembly of the 480-kDa replicase complex. Our previous study demonstrated that the RCNMV replicase complex contains many host proteins, including ubiquitin, heat shock protein 70, heat shock protein 90, and several ribosomal proteins (Mine et al., 2010b). It should be noted that the E178A mutation increased viral protein–protein interactions (Fig. 6B and C) with retaining the ability for specific binding to YRE (Fig. 2; data not shown). The undesirable interactions between viral replicase proteins by themselves might affect the interactions between the viral proteins and the host proteins and disturb the assembly of the 480-kDa replicase complex. The mutated amino acid residues might be involved in the posttranslational modification of p27. Ubiquitination is a common posttranslational modification in eukaryotic cells (Pickart and Eddins, 2004) and is known to play a role during the infection processes of several viruses. For example, the ubiquitination of nonstructural protein 3D RdRP is required for the effective replication of Coxsackievirus B3 (Si et al., 2008). The auxiliary replicase protein p33 of TBSV is ubiquitinated, and this ubiquitination is important for the replication of the TBSV replicon RNA (Barajas and Nagy, 2010; Li et al., 2008). The posttranslational modifications of the RCNMV replicase proteins, including the ubiquitination of lysine at position 86, are yet to be analyzed. In contrast, the class II mutations might affect other unknown functions of p27, including as an RNA chaperone. The roles of virus-encoded RNA chaperones in replication have been reported in many RNA viruses (Züñiga et al., 2009). It is noteworthy that the Tombusvirus auxiliary replicase protein p33 has RNA chaperone activity (Stork et al., 2011). Thus, p27 has distinct domains that interact with YRE, viral replicase proteins, and host proteins, and all these interactions are required for the replication of RNA2. Roles of p27 in the replication of RNA1 In our previous study, we demonstrated that RNA1 lacks a replicase recruiter, such as YRE of RNA2, and that the binding of the replicase proteins to RNA1 is coupled to the translation process (Iwakawa et al., 2011). Therefore, the initial template recognition mechanisms of the replicase proteins differ for RNA1 and RNA2. We proposed a model for the recruitment of RNA1 into the replication process by p27 and p88, wherein p27 binds directly or indirectly to RNA1 during its translation, and recruits RNA1 to the ER membrane (Iwakawa et al., 2011). p88, which is produced by a −1 frameshifting event, also binds to the 3′UTR of RNA1 in a translation-coupled manner (Iwakawa et al., 2011). Considering the correlation between the specific RNA-binding activity of p27 to YRE (Iwakawa et al., 2011; this study) and its ability to support the replication of RNA1 (Fig. 5), it is plausible that p27 binds directly to RNA1 by recognizing RNA elements that become available only during

the translation of RNA1 (Iwakawa et al., 2011). This direct interaction probably contributes not only to the recruitment of RNA1 to the ER membrane but also to the assembly of the 480-kDa replicase complex on RNA1, together with p88. Materials and methods Plasmid construction Plasmids with the prefixes “pUC” and “pRC” were used for in vitro transcription, and plasmids with the prefixes “pUB” and “pCold” or “pColdGST” were used for the protoplast experiments and the expression of recombinant proteins, respectively. pUCR1 and pRC2| G are full-length cDNA clones of RNA1 and RNA2, respectively, of the Australian RCNMV strain (Takeda et al., 2005; Xiong and Lommel, 1991). Previously described constructs that were used in this study include the following: pUCR1p88 (Takeda et al., 2005), pUCp27-FLAG (Mine et al., 2010a), pUCRLuc–FLAG (Iwakawa et al., 2011), pUCR2– 3′-84-S (Iwakawa et al., 2011), pUCR2–3′-84M-S (Iwakawa et al., 2011), pUBp27 (Takeda et al., 2005), pUBp88 (Takeda et al., 2005),

Table 1 List of primers and their sequences used for PCR to generate constructs. Primer name

Sequence

Δ1–20-F Δ1–20-R Δ21–40-F Δ21–40-R Δ41–60-F Δ41–60-R Δ61–80-F Δ61–80-R Δ81–100-F Δ81–100-R Δ101–113-F Δ101–113-R Δ114–136-F Δ114–136-R Δ137–156-F Δ137–156-R Δ157–176-F Δ157–176-R Δ177–196-F Δ177–196-R Δ197–236-F Δ197–236-R K25A-F K25A-R R42A-F R42A-R K43A-F K43A-R H53A-F H53A-R K86A-F K86A-R R164A-F R164A-R E178A-F E178A-R H179A-F H179A-R H180A-F H180A-R HH179–180AA-F HH179–180AA-R pUCSacI-F 3′ UTR-R 22R FLAG–KpnI-R M4 KpnI–p27C-F

TTCGTACCAGTCATGTTCAATCCAGGCAAAATCCTGTCTGCAAT GCCTGGATTGAACATGACTGGTACGAAAAGTAGAAATTTAAAAT GTGTGGGTGAGTAAATTTCGCAAGTGGTTCTTTGGTCTCAACTTT GAACCACTTGCGAAATTTACTCACCCACACCATTAATTTATCCA GACTGTTGGAATCGCATTCCACTCATGCCACATTACACGGAGCA GTGGCATGAGTGGAATGCGATTCCAACAGTCTATACCCAAGTTGC GCGGTGGATGCCTTCGAAACCCCAGAATCCAAATTAGAAGACTG GGATTCTGGGGTTTCGAAGGCATCCACCGCCCACATATGTGCAT GACGACTTCTGCAGCTTCGATGAAGAGGTGTACAAGAAGGATGA CACCTCTTCATCGAAGCTGCAGAAGTCGTCGACTACACGTTCCA TCAGTAAATGAATTCATGAAACTCCAAAGGAGCGCTGCCAGGAA CCTTTGGAGTTTCATGAATTCATTTACTGAGGTGTCCAGTTCCA GATGAGGAAGGCGTGATTAAGGCTGTAGAAACGAGGATCAGAAA TTCTACAGCCTTAATCACGCCTTCCTCATCCTTCTTGTACACCT ATGATGCAAGCGGCCAAGGTAGACGAAGCTGCAGTTAGAGCAAC AGCTTCGTCTACCTTGGCCGCTTGCATCATGCCTGGGCGCACAC GGAGATGACATGGGAAACGAACACCACACCAATGCATTGGTGTA GGTGTGGTGTTCGTTTCCCATGTCATCTCCAAAGATGGTATGGC GGTGAGTTCAAGATCCAGAGGTCTATCGACAGCGTCAAGCTCGC GTCGATAGACCTCTGGATCTTGAACTCACCACATATGTCACTGG GACACCAGACGATTACAAGGACGACGATGA CCTTGTAATCGTCTGGTGTCATGGCAAGGT GTAAATTCAATCCAGGCGCAATCCTGTCTGCAATCTGCAACTTG CAGATTGCAGACAGGATTGCGCCTGGATTGAATTTACTCACCCA ACTGTTGGAATCGCTTTGCCAAGTGGTTCTTTGGTCTCAACTTT AGACCAAAGAACCACTTGGCAAAGCGATTCCAACAGTCTATACC GTTGGAATCGCTTTCGCGCGTGGTTCTTTGGTCTCAACTTTGAT TTGAGACCAAAGAACCACGCGCGAAAGCGATTCCAACAGTCTAT GTCTCAACTTTGATGCAGCTATGTGGGCGGTGGATGCCTTCATT GCATCCACCGCCCACATAGCTGCATCAAAGTTGAGACCAAAGAA GCGAAACCCCAGAATCCGCATTAGAAGACTGTCTGGAACTGGAC TCCAGACAGTCTTCTAATGCGGATTCTGGGGTTTCGCTGCAGAA TAGACGAAGCTGCAGTTGCAGCAACTGCCAGTGACATATGTGGT ATGTCACTGGCAGTTGCTGCAACTGCAGCTTCGTCTACCTTTCC GTGAGTTCAAGATCAACGCACACCACACCAATGCATTGGTGTAT AATGCATTGGTGTGGTGTGCGTTGATCTTGAACTCACCACATAT AGTTCAAGATCAACGAAGCCCACACCAATGCATTGGTGTATGCC ACCAATGCATTGGTGTGGGCTTCGTTGATCTTGAACTCACCACA TCAAGATCAACGAACACGCCACCAATGCATTGGTGTATGCCGCA TACACCAATGCATTGGTGGCGTGTTCGTTGATCTTGAACTCACC TCAAGATCAACGAAGCCGCCACCAATGCATTGGTGTATGCCGCA ACCAATGCATTGGTGGCGGCTTCGTTGATCTTGAACTCACCACA AATTTCACACAGGAAACAGC GGGGTACCTAGCCGTTATAC AGCAGATGGAACGTGTAG CGGGGTACCCTACTTGTCATCGTCGTCC GTTTTCCCAGTCACGAC CGGGGTACCATGAAACTCCAAAGGAGCGCTGC

K. Hyodo et al. / Virology 413 (2011) 300–309

pUBR1–p88 (Okamoto et al., 2008), pCold–p27C-FLAG (Mine et al., 2010a), pColdGST–p27C (Mine et al., 2010a), and pColdGST–p88Δp27 (Mine et al., 2010a). All the constructs were verified by sequencing. The primers used in this study are listed in Table 1. pUCp27−FLAGΔ1–20; pUCp27−FLAGΔ21–40; pUCp27−FLAGΔ41–60; pUCp27−FLAGΔ61–80; pUCp27−FLAGΔ81–100; pUCp27−FLAGΔ101–113; pUCp27−FLAGΔ114–136; pUCp27−FLAGΔ137–156; pUCp27−FLAGΔ157–176; pUCp27−FLAGΔ177–196; pUCp27−FLAGΔ197–236:

307

RNA preparation pUCR2–3′-84-S and pUCR2–3′-84M-S were digested with XbaI; pRC2 or its derivatives were digested with XmaI; pUCR1p88, pUCp27FLAG, and their derivatives were digested with SmaI. The RNA transcripts were synthesized from these plasmids as described previously (Iwakawa et al., 2008). Preparation of BYL and BYLS20

DNA fragments were amplified by PCR from pUCp27-FLAG. The primer pairs used consisted of pUCSacI-F plus one each of the following: Δ1–20-R, Δ21–40-R, Δ41–60-R, Δ61–80-R, Δ81–100-R, Δ101–113-R, Δ114–136-R, Δ137–156-R, Δ157–176-R, Δ177–196-R, or Δ197–236-R. Another primer, 3′UTR-R, was used together with one each of the following: Δ1–20-F, Δ21–40-F, Δ41–60-F, Δ61–80-F, Δ81– 100-F, Δ101–113-F, Δ114–136-F, Δ137–156-F, Δ157–176-F, Δ177– 196-F, or Δ197–236-F. Each recombinant PCR fragment was amplified with the primer pair pUCSacI-F and 3′UTR-R, digested with SacI and MluI, and inserted into the corresponding region of pUCp27-FLAG. pUCp27−FLAG = K25A; pUCp27−FLAG = R42A; pUCp27−FLAG = K43A; pUCp27−FLAG = H53A; pUCp27−FLAG = K86A; pUCp27−FLAG = R164A; pUCp27−FLAG = E178A; pUCp27−FLAG = H179A; pUCp27−FLAG = H180A; pUCp27−FLAG = HH179–180AA:

DNA fragments were amplified by PCR from pUCp27-FLAG. The primer pairs used were pUCSacI-F plus one each of the following: K25A-R, R42A-R, K43A-R, H53A-R, K86A-R, R164A-R, E178A-R, H179A-R, H180A-R, or HH179–180AA-R. Another primer, 3′UTR-R, was used together with one each of the following: K25A-F, R42A-F, K43A-F, H53A-F, K86A-F, R164A-F, E178A-F, H179A-F, H180A-F, or HH179–180AA-F. Each recombinant PCR fragment was amplified with the primer pair pUCSacI-F and 3′UTR-R, digested with SacI and MluI, and inserted into the corresponding region of pUCp27-FLAG. pUBp27−FLAG; pUBp27−FLAG = R164A; pUBp27−FLAG = E178A; pUBp27−FLAG = H179A; pUBp27−FLAG = H180A; pUBp27−FLAG = HH179–180AA:

DNA fragments were amplified by PCR from each of the following: pUCp27-FLAG, pUCp27-FLAG/R164A, pUCp27-FLAG/E178A, pUCp27FLAG/H179A, pUCp27-FLAG/H180A, and pUCp27-FLAG/HH179– 180AA. The primer pairs used were 22R plus FLAG–KpnI-R. Each amplified PCR fragment was digested with EcoRI and KpnI, and inserted into the corresponding region of pUBp27. pUBp27−FLAG = K25A; pUBp27−FLAG = R42A; pUBp27−FLAG = H53A; pUBp27−FLAG = K86A:

pUBp27−FLAG = K43A;

DNA fragments were amplified by PCR from pUBp27-FLAG. The primer pairs used were M4 plus one each of the following: K25A-R, R42A-R, K43A-R, H53A-R, or K86A-R. Another primer, FLAG–KpnI-R, was used together with one each of the following: K25A-F, R42A-F, K43A-F, H53A-F, or K86A-F. Each recombinant PCR fragment was amplified with the primer pair M4 and FLAG–KpnI-R, digested with XbaI and KpnI, and inserted into the corresponding region of pUBp27-FLAG. pColdp27C−FLAG = R164A; pColdp27C−FLAG = E178A; pColdp27C−FLAG = H179A; pColdp27C−FLAG = H180A; pColdp27C−FLAG = HH179–180AA:

DNA fragments were amplified by PCR from each of the following: pUCp27-FLAG/R164A, pUCp27-FLAG/E178A, pUCp27-FLAG/H179A, pUCp27-FLAG/H180A, and pUCp27-FLAG/HH179–180AA. The primer pairs used were KpnI–p27C-F plus FLAG–KpnI-R. Each amplified PCR fragment was digested with KpnI, and inserted into the corresponding region of pColdp27C-FLAG.

The preparation of BYL and BYLS20 was as described previously (Komoda et al., 2004; Iwakawa et al., 2007 and 2011). STagT affinity purification STagT affinity purification was performed essentially as described previously (Iwakawa et al., 2011), with minor modifications. Briefly, capped p27-FLAG or its derivatives (2 μg) were added to 100 μL of BYLS20 mixture. After incubation at 17 °C for 120 min, 3.2 μg of probe RNA was added to the BYLS20 mixture, which was incubated on ice for 20 min, followed by incubation on ice for 40 min in the presence of 100 μg of heparin. The mixture was added to a 400 μL bed volume of streptomycin-coupled Sepharose beads that had been preequilibrated with column buffer (50 mM Tris–HCl [pH 7.5], 100 mM NaCl, 3 mM MgCl2). After incubation for 3 min, the beads were washed three times with 2 mL of column buffer. The bound RNA and proteins were eluted with 1.5 mL of column buffer containing 10 μM streptomycin, followed by acetone precipitation. All the purification steps were performed at 4 °C. These samples were subjected to 12.5% SDS–PAGE, followed by ethidium bromide staining, and immunoblotting with an anti-FLAG M2 monoclonal antibody. In vitro fractionation assay In the fractionation assays, capped p27-FLAG or one of its derivatives (1 μg) was added to 50 μL of BYL translation/replication mixture in the presence of RNA2 (500 ng). After incubation at 17 °C for 120 min, the samples were centrifuged (21,000g) at 4 °C for 10 min to separate the supernatant and pelleted fractions. To remove possible contaminating soluble proteins, the pellet was washed with TR buffer (30 mM HEPES–KOH [pH 7.4], 100 mM KOAc, 2 mM Mg (OAc)2, 2 mM DTT) and then centrifuged at 4 °C for 10 min, after which the pellet was lysed in solubilization buffer (50 mM Tris–HCl [pH 8.0], 150 mM NaCl, 10 mM MgCl2, 1 mM DTT, 0.5% Triton X-100). Aliquots of each fraction were subjected to northern and immunoblotting analyses, as described previously (Iwakawa et al., 2011). Replication assay The BYL translation/replication assay was performed as described previously (Iwakawa et al., 2007). Briefly, capped p27-FLAG or one of its derivatives (1 μg) was added to 30 μL of BYL translation/replication mixture in the presence of uncapped RNA2 (500 ng) and capped RNA1-p88 (300 ng). The BYL translation/replication mixture was incubated at 17 °C for 240 min. Aliquots of the reaction mixture were subjected to northern and immunoblotting analyses, as described previously (Iwakawa et al., 2007 and 2011). BN-PAGE analysis was performed as described previously (Mine et al., 2010a and b) with minor modifications. Briefly, the protein samples prepared from solubilized total BYL were subjected to BNPAGE, followed by immunoblotting using an anti-FLAG M2 monoclonal antibody. To assay viral replication in the protoplasts, approximately 5 × 105 tobacco BY2 protoplasts were resuspended in MMG buffer (0.4 M mannitol, 15 mM MgCl2, 5 mM MES [pH 5.7]) and inoculated with

308

K. Hyodo et al. / Virology 413 (2011) 300–309

RNA2 (1 μg) and the following amounts of plasmids: 10 μg of pUBp27FLAG or its derivatives and 5 μg of pUBp88. A twofold volume of polyethylene glycol (PEG) solution (40% PEG 4000 [Fluka], 0.4 M mannitol, 200 mM Ca(NO3)2) was added, and the mixture was diluted with 2 mL of dilution buffer (0.4 M mannitol, 125 mM CaCl2, 5 mM KCl, 5 mM glucose, 1.5 mM MES [pH 5.7]) and incubated on ice for 15 min. The transfected protoplasts were washed with 4 mL of dilution buffer. The protoplasts were incubated at 17 °C for 16 or 24 h in the dark. The total RNA and proteins were subjected to northern and immunoblotting analyses, respectively, as described previously (Iwakawa et al., 2011). GST pull-down assay The expression and purification of the recombinant proteins and the GST pull-down assay were performed as described previously (Mine et al., 2010a). Acknowledgments The authors thank S. A. Lommel for the original RNA1 and RNA2 cDNA clones of the Australian RCNMV strain. This work was supported in part by a Grant-in-Aid for Scientific Research (A) (18208004) and a Grant-in-Aid for Scientific Research (A) (22248002) from the Japan Society for the Promotion of Science. References Ahlquist, P., 2006. Parallels among positive-strand RNA viruses, reverse-transcribing viruses and double-stranded RNA viruses. Nat. Rev. Microbiol. 4, 371–382. Ahlquist, P., Noueiry, A.O., Lee, W.M., Kushner, D.B., Dye, B.T., 2003. Host factors in positive-strand RNA virus genome replication. J. Virol. 77, 8181–8186. An, M., Iwakawa, H.O., Mine, A., Kaido, M., Mise, K., Okuno, T., 2010. A Y-shaped RNA structure in the 3′ untranslated region together with the trans-activator and core promoter of Red clover necrotic mosaic virus RNA2 is required for its negativestrand RNA synthesis. Virology 405, 100–109. Auweter, S.D., Oberstrass, F.C., Allain, F.H., 2006. Sequence-specific binding of single-stranded RNA: is there a code for recognition? Nucleic Acids Res. 34, 4943–4959. Barajas, D., Nagy, P.D., 2010. Ubiquitination of tombusvirus p33 replication protein plays a role in virus replication and binding to the host Vps23p ESCRT protein. Virology 397, 358–368. Chen, J., Noueiry, A., Ahlquist, P., 2001. Brome mosaic virus Protein 1a recruits viral RNA2 to RNA replication through a 5′ proximal RNA2 signal. J. Virol. 75, 3207–3219. Dangerfield, J.A., Windbichler, N., Salmons, B., Günzburg, W.H., Schröder, R., 2006. Enhancement of the StreptoTag method for isolation of endogenously expressed proteins with complex RNA binding targets. Electrophoresis 27, 1874–1877. Draper, D.E., 1999. Themes in RNA-protein recognition. J. Mol. Biol. 293, 255–270. Iwakawa, H.O., Kaido, M., Mise, K., Okuno, T., 2007. cis-Acting core RNA elements required for negative-strand RNA synthesis and cap-independent translation are separated in the 3′-untranslated region of Red clover necrotic mosaic virus RNA1. Virology 369, 168–181. Iwakawa, H.O., Mine, A., Hyodo, K., Kaido, M., Mise, K., Okuno, T., 2011. Template recognition mechanisms by replicase proteins differ between bipartite positivestrand genomic RNAs of a plant virus. J. Virol. 85, 497–509. Iwakawa, H.O., Mizumoto, H., Nagano, H., Imoto, Y., Takigawa, K., Sarawaneeyaruk, S., Kaido, M., Mise, K., Okuno, T., 2008. A viral noncoding RNA generated by ciselement-mediated protection against 5′–3′ RNA decay represses both capindependent and cap-dependent translation. J. Virol. 82, 10162–10174. Kaido, M., Tsuno, Y., Mise, K., Okuno, T., 2009. Endoplasmic reticulum targeting of the Red clover necrotic mosaic virus movement protein is associated with the replication of viral RNA1 but not that of RNA2. Virology 395, 232–242. Kim, K.H., Lommel, S.A., 1994. Identification and analysis of the site of − 1 ribosomal frameshifting in red clover necrotic mosaic virus. Virology 200, 574–582. Kim, K.H., Lommel, S.A., 1998. Sequence element required for efficient − 1 ribosomal frameshifting in red clover necrotic mosaic dianthovirus. Virology 250, 50–59. Komoda, K., Naito, S., Ishikawa, M., 2004. Replication of plant RNA virus genomes in a cell-free extract of evacuolated plant protoplasts. Proc. Natl Acad. Sci. USA 101, 1863–1867. Li, Z., Barajas, D., Panavas, T., Herbst, D.A., Nagy, P.D., 2008. Cdc34p ubiquitinconjugating enzyme is a component of the tombusvirus replicase complex and ubiquitinates p33 replication protein. J. Virol. 82, 6911–6926. Liu, L., Westler, W.M., den Boon, J.A., Wang, X., Diaz, A., Steinberg, H.A., Ahlquist, P., 2009. An amphipathic alpha-helix controls multiple roles of brome mosaic virus protein 1a in RNA replication complex assembly and function. PLoS Pathog. 5, e1000351.

Lommel, S.A., Weston-Fina, M., Xiong, Z., Lomonossoff, G.P., 1988. The nucleotide sequence and gene organization of red clover necrotic mosaic virus RNA-2. Nucleic Acids Res. 16, 8587–8602. Mine, A., Hyodo, K., Takeda, A., Kaido, M., Mise, K., Okuno, T., 2010a. Interactions between p27 and p88 replicase proteins of Red clover necrotic mosaic virus play an essential role in viral RNA replication and suppression of RNA silencing via the 480kDa viral replicase complex assembly. Virology 407, 213–224. Mine, A., Takeda, A., Taniguchi, T., Taniguchi, H., Kaido, M., Mise, K., Okuno, T., 2010b. Identification and characterization of the 480-kilodalton template-specific RNAdependent RNA polymerase complex of red clover necrotic mosaic virus. J. Virol. 84, 6070–6081. Mizumoto, H., Iwakawa, H.O., Kaido, M., Mise, K., Okuno, T., 2006. Cap-independent translation mechanism of red clover necrotic mosaic virus RNA2 differs from that of RNA1 and is linked to RNA replication. J. Virol. 80, 3781–3791. Mizumoto, H., Tatsuta, M., Kaido, M., Mise, K., Okuno, T., 2003. Cap-independent translational enhancement by the 3′ untranslated region of red clover necrotic mosaic virus RNA1. J. Virol. 77, 12113–12121. Nagy, P.D., Pogany, J., 2008. Multiple roles of viral replication proteins in plant RNA virus replication. Methods Mol. Biol. 451, 55–68. Okamoto, K., Nagano, H., Iwakawa, H.O., Mizumoto, H., Takeda, A., Kaido, M., Mise, K., Okuno, T., 2008. cis-Preferential requirement of a − 1 frameshift product p88 for the replication of Red clover necrotic mosaic virus RNA1. Virology 375, 205–212. Panavas, T., Hawkins, C.M., Panaviene, Z., Nagy, P.D., 2005. The role of the p33:p33/p92 interaction domain in RNA replication and intracellular localization of p33 and p92 proteins of Cucumber necrosis tombusvirus. Virology 338, 81–95. Panaviene, Z., Baker, J.M., Nagy, P.D., 2003. The overlapping RNA-binding domains of p33 and p92 replicase proteins are essential for tombusvirus replication. Virology 308, 191–205. Panaviene, Z., Panavas, T., Nagy, P.D., 2005. Role of an internal and two 3′-terminal RNA elements in assembly of tombusvirus replicase. J. Virol. 79, 10608–10618. Panaviene, Z., Panavas, T., Serva, S., Nagy, P.D., 2004. Purification of the cucumber necrosis virus replicase from yeast cells: role of coexpressed viral RNA in stimulation of replicase activity. J. Virol. 78, 8254–8263. Pickart, C.M., Eddins, M.J., 2004. Ubiquitin: structures, functions, mechanisms. Biochim. Biophys. Acta 1695, 55–72. Pogany, J., White, K.A., Nagy, P.D., 2005. Specific binding of tombusvirus replication protein p33 to an internal replication element in the viral RNA is essential for replication. J. Virol. 79, 4859–4869. Quadt, R., Ishikawa, M., Janda, M., Ahlquist, P., 1995. Formation of brome mosaic virus RNA-dependent RNA polymerase in yeast requires coexpression of viral proteins and viral RNA. Proc. Natl Acad. Sci. USA 92, 4892–4896. Rajendran, K.S., Nagy, P.D., 2003. Characterization of the RNA-binding domains in the replicase proteins of tomato bushy stunt virus. J. Virol. 77, 9244–9258. Rajendran, K.S., Nagy, P.D., 2004. Interaction between the replicase proteins of Tomato bushy stunt virus in vitro and in vivo. Virology 326, 250–261. Rajendran, K.S., Nagy, P.D., 2006. Kinetics and functional studies on interaction between the replicase proteins of Tomato Bushy Stunt Virus: requirement of p33:p92 interaction for replicase assembly. Virology 345, 270–279. Sarawaneeyaruk, S., Iwakawa, H.O., Mizumoto, H., Murakami, H., Kaido, M., Mise, K., Okuno, T., 2009. Host-dependent roles of the viral 5′ untranslated region (UTR) in RNA stabilization and cap-independent translational enhancement mediated by the 3′ UTR of Red clover necrotic mosaic virus RNA1. Virology 391, 107–118. Schwartz, M., Chen, J., Janda, M., Sullivan, M., den Boon, J., Ahlquist, P., 2002. A positivestrand RNA virus replication complex parallels form and function of retrovirus capsids. Mol. Cell 9, 505–514. Schwartz, M., Chen, J., Lee, W.M., Janda, M., Ahlquist, P., 2004. Alternate, virus-induced membrane rearrangements support positive-strand RNA virus genome replication. Proc. Natl Acad. Sci. USA 101, 11263–11268. Si, X., Gao, G., Wong, J., Wang, Y., Zhang, J., Luo, H., 2008. Ubiquitination is required for effective replication of coxsackievirus B3. PLoS ONE 3, e2585. Sit, T.L., Vaewhongs, A.A., Lommel, S.A., 1998. RNA-mediated trans-activation of transcription from a viral RNA. Science 281, 829–832. Stork, J., Kovalev, J.N., Sasvari, Z., Nagy, P.D., 2011. RNA chaperone activity of the tombusviral p33 replication protein facilitates initiation of RNA synthesis by the viral RdRp in vitro. Virology 409, 338–347. Sullivan, M.L., Ahlquist, P., 1999. A brome mosaic virus intergenic RNA3 replication signal functions with viral replication protein 1a to dramatically stabilize RNA in vivo. J. Virol. 73, 2622–2632. Takeda, A., Tsukuda, M., Mizumoto, H., Okamoto, K., Kaido, M., Mise, K., Okuno, T., 2005. A plant RNA virus suppresses RNA silencing through viral RNA replication. EMBO J. 24, 3147–3157. Tatsuta, M., Mizumoto, H., Kaido, M., Mise, K., Okuno, T., 2005. The red clover necrotic mosaic virus RNA2 trans-activator is also a cis-acting RNA2 replication element. J. Virol. 79, 978–986. Terribilini, M., Lee, J.H., Yan, C., Jernigan, R.L., Honavar, V., Dobbs, D., 2006. Prediction of RNA binding sites in proteins from amino acid sequence. RNA 12, 1450–1462. Terribilini, M., Sander, J.D., Lee, J.H., Zaback, P., Jernigan, R.L., Honavar, V., Dobbs, D., 2007. RNABindR: a server for analyzing and predicting RNA-binding sites in proteins. Nucleic Acids Res. 35, 578–584. Turner, K.A., Sit, T.L., Callaway, A.S., Allen, N.S., Lommel, S.A., 2004. Red clover necrotic mosaic virus replication proteins accumulate at the endoplasmic reticulum. Virology 320, 276–290. Wang, X., Lee, W.M., Watanabe, T., Schwartz, M., Janda, M., Ahlquist, P., 2005. Brome mosaic virus 1a nucleoside triphosphatase/helicase domain plays crucial roles in recruiting RNA replication templates. J. Virol. 79, 13747–13758.

K. Hyodo et al. / Virology 413 (2011) 300–309 Xiong, Z., Kim, K.H., Giesman-Cookmyer, D., Lommel, S.A., 1993a. The roles of the Red clover necrotic mosaic virus capsid and cell-to-cell movement proteins in systemic infection. Virology 192, 27–32. Xiong, Z., Kim, K.H., Kendall, T.L., Lommel, S.A., 1993b. Synthesis of the putative red clover necrotic mosaic virus RNA polymerase by ribosomal frameshifting in vitro. Virology 193, 213–221.

309

Xiong, Z., Lommel, S.A., 1989. The complete nucleotide sequence and genome organization of red clover necrotic mosaic virus RNA-1. Virology 171, 543–554. Xiong, Z.G., Lommel, S.A., 1991. Red clover necrotic mosaic virus infectious transcripts synthesized in vitro. Virology 182, 388–392. Züñiga, S., Sola, I., Cruz, J.L.G., Enjuanes, L., 2009. Role of RNA chaperones in virus replication. Virus Res. 139, 253–266.