The Red clover necrotic mosaic virus origin of assembly is delimited to the RNA-2 trans-activator

Virology 384 (2009) 169–178

Contents lists available at ScienceDirect

Virology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / y v i r o

The Red clover necrotic mosaic virus origin of assembly is delimited to the RNA-2 trans-activator Veronica R. Basnayake 1, Tim L. Sit, Steven A. Lommel ⁎ Plant Virology Group, Campus Box 7342, Department of Plant Pathology, North Carolina State University, Raleigh, NC 27695-7342, USA

a r t i c l e

i n f o

Article history: Received 10 September 2008 Returned to author for revision 1 October 2008 Accepted 5 November 2008 Available online 4 December 2008 Keywords: Red clover necrotic mosaic virus Virion assembly Origin of assembly trans-activator Dianthovirus Tombusviridae

a b s t r a c t The bipartite RNA genome of Red clover necrotic mosaic virus (RCNMV) is encapsidated into icosahedral virions that exist as two populations: i) virions that co-package both genomic RNAs and ii) virions packaging multiple copies of RNA-2. To elucidate the packaging mechanism, we sought to identify the RCNMV origin of assembly sequence (OAS). RCNMV RNA-1 cannot package in the absence of RNA-2 suggesting that it does not contain an independent packaging signal. A 209 nt RNA-2 element expressed from the Tomato bushy stunt virus CP subgenomic promoter is co-assembled with genomic RNA-1 into virions. Deletion mutagenesis delimited the previously characterized 34 nt trans-activator (TA) as the minimal RCNMV OAS. From this study we hypothesize that RNA-1 must be base-paired with RNA-2 at the TA to initiate co-packaging. The addition of viral assembly illustrates the critical importance of the multifunctional TA element as a key regulatory switch in the RCNMV life cycle. © 2008 Elsevier Inc. All rights reserved.

Introduction Virion assembly of RNA viruses is determined by a specific sequence (s) and/or structural element(s) known as the origin of assembly sequence (OAS) that binds cognate viral capsid protein (CP) and orients the CP into an initiation complex. This RNA structure/CP specificity discriminates against packaging of heterologous viral or cellular RNAs. The OAS for several plant viruses have been identified with the most extensively characterized being that of the rod-shaped, monopartite Tobacco mosaic virus (TMV; Turner and Butler, 1986; Turner et al., 1988; Zimmern, 1983). The TMV OAS is a 51 nt bulged stem loop with a G residue at every third nucleotide in the terminal loop. Each CP subunit binds to three nucleotides and to the G residues of the loop preferentially to initiate assembly (Turner et al., 1988). Less is known regarding icosahedral plant RNA virus assembly and their packaging signals although progress is being made (Rao, 2006). Turnip crinkle virus (TCV) in the Carmovirus genus, family Tombusviridae, is the only small icosahedral monopartite plant RNA virus for which the OAS is reasonably well characterized. TCV produces a 33 nm virion (Hogle et al., 1986) encapsidating a 4.0 kb monopartite genome. A 28 nt bulged hairpin loop was identified as the essential packaging element (Qu and Morris, 1997). In contrast, multipartite viruses employ diverse mechanisms for packaging of their genomic RNAs. Brome mosaic virus (BMV), an icosahedral RNA plant virus with a multipartite genome produces ⁎ Corresponding author. Fax: +1 919 515 7169. E-mail address: [email protected] (S.A. Lommel). 1 Present address: Fraunhofer Center for Molecular Biotechnology, 9 Innovation Way, Suite 200, Newark, DE 19711, USA. 0042-6822/$ – see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2008.11.005

three distinct types of virions encapsidating different combinations of the three genomic and single subgenomic RNA (sgRNA). BMV packages RNAs 1 and 2 into separate virions and co-packages RNA3 and its sgRNA (RNA4) into a single virion (Choi et al., 2002; Choi and Rao, 2003; Damayanti et al., 2003; Loesch-Fries and Hall, 1980). The copackaging of RNAs 3 and 4 is achieved by the presence of the conserved 3′ tRNA-like structure (TLS) element on each RNA combined with a discrete, RNA-3 specific upstream element to form the complete packaging signal (Choi and Rao, 2003; Damayanti et al., 2003). However, the packaging of RNAs 1 and 2 does not require the presence of the 3′ TLS element (Annamalai and Rao, 2007). Red clover necrotic mosaic virus (RCNMV) is an icosahedral virus in the genus Dianthovirus, family Tombusviridae. Dianthoviruses are taxonomically distinct from other genera in the family (such as the aforementioned Carmovirus genus) due to the bipartite nature of their single-stranded, positive-sense RNA genome. RCNMV produces 37 nm isometric virions composed of 180 copies of the 37 kDa CP subunit arranged in a T = 3 icosahedron (Sherman et al., 2006). The two genomic RNAs, RNA-1 and RNA-2 (3.9 kb and 1.45 kb, respectively; Fig. 1A) are essentially non-homologous. RNA-1 codes for three proteins: i) the 88 kDa RNA dependent RNA polymerase (p88), ii) the 27 kDa protein (p27) with unspecified, but probable replicase function and iii) the 37 kDa CP (Kim and Lommel, 1994; Xiong et al., 1993b; Xiong and Lommel, 1989). The CP open reading frame (ORF) is 3′ proximal and is translated from a sgRNA (Osman and Buck, 1990; Zavriev et al., 1996). RNA-1 can replicate independently but cannot move from cell-to-cell in the absence of RNA-2 (Osman and Buck, 1987; Paje-Manalo and Lommel, 1989; Xiong et al., 1993a) which codes for the 35 kDa

170

V.R. Basnayake et al. / Virology 384 (2009) 169–178

Fig. 1. Schematic representation of viral genomes used in assembly studies. The open reading frames (ORFs) are depicted as boxes and the encoded products are indicated within the boxes. The subgenomic RNA transcription start sites are indicated by bent arrows. (A) Red clover necrotic mosaic virus genomic RNAs. RNA-1 and RNA-2 are the genomic RNAs. R1sGFP is a reporter construct of RNA-1 that expresses the green fluorescent protein (sGFP) in place of the capsid protein (CP). The products p27 and p88 are replicase proteins while MP is the movement protein. The −1 frameshift signal (−1 FS) responsible for the translation of p88 is indicated. The positions and sequences of the TABS (on RNA-1 and R1sGFP) and TA (RNA-2) elements are indicated with complementary regions shaded. (B) Tomato bushy stunt virus constructs. Products p33 and p92 are the replicase proteins, CP the capsid protein, p22 the movement protein and p19 is the RNA silencing suppressor protein. The amber termination readthrough codon (UAG) for the expression of p92 is indicated. The pHST2 vector has part of the CP coding region removed and the p19 ORF is not expressed. pHST2-RCP expresses the RCNMV CP.

movement protein (MP; Lommel et al., 1988). Although CP is not required for cell-to-cell movement, it is essential for systemic transport through the vasculature, likely as virions (Vaewhongs and Lommel, 1995; Xiong et al., 1993a). RCNMV virions form a single band in equilibrium density centrifugation indicating that the entire virion population is of equal or near equal density (Gould et al., 1981; Hollings and Stone, 1977) suggesting that the two genomic RNAs are co-encapsidated. However, RNA liberated from purified virions exhibits an RNA-1 to RNA-2 ratio of approximately 1:3 (S.A. Lommel, unpublished data). Heat treatment and UV cross-linking of RCNMV virions suggest that RCNMV is composed of two virion populations: i) one in which RNA-1 and RNA-2 are co-encapsidated and ii) a population encapsidating multiple copies (likely 4) of RNA-2 (Basnayake et al., 2006). These observations on the RCNMV genome packaging scheme suggest the presence of a complex, non-uniform and possibly novel packaging strategy for RCNMV. For comparison purposes, Flock house virus (FHV), an icosahedral insect virus in the Nodavirus genus, most closely resembles RCNMV in terms of genome organization and packaging scheme. FHV RNAs 1 and 2 heterodimerize upon virion heating to 65 °C which illustrates the copackaging of both RNAs (Krishna and Schneemann, 1999). Packaging of a defective interfering RNA derived from FHV RNA-2 is controlled by a 32 nt stem loop OAS (Zhong et al., 1992). However, it has not been determined if this OAS is sufficient for genomic RNA-2 packaging or how both RNAs become co-packaged into a single virion (Venter and Schneemann, 2008). In the case of RCNMV, RNA-2 replication and accumulation is required to initiate CP sgRNA synthesis from RNA-1 (Sit et al., 1998). The trans-activator (TA) element, a 34 nt stem loop structure within the RNA-2 MP ORF, trans-activates CP sgRNA transcription from RNA-1 by base pairing with the TA binding site (TABS) found within the RNA1 CP subgenomic promoter. NMR structural probing of the TA–TABS

interaction demonstrated the formation of a stacked helical structure (Guenther et al., 2004). This RNA:RNA interaction was the basis for our initial investigations into the packaging mechanism(s) of RCNMV and our search for the OAS. Without an efficient in vitro assembly system for RCNMV, the OAS was identified and delimited in this study utilizing a combination of two in vivo packaging assays. The first assay is based on a heterologous Tomato bushy stunt virus (TBSV) vector (Scholthof et al., 1996) used to express RNA-2 fragments and the second was based on direct deletion mutagenesis of RCNMV RNA-2. Here we demonstrate that a 209 nt sequence within the MP ORF of RNA-2 was able to direct co-packaging of the heterologous TBSV sgRNA with RCNMV RNA-1. Secondary structure analysis of this 209 nt sequence revealed a highly base-paired structure of five stem loops, one being the previously characterized TA element (Guenther et al., 2004; Sit et al., 1998). Further dissection of the 209 nt element based on its predicted secondary structure model revealed that the 34 nt TA element was the essential minimal element for virion assembly. As definitive evidence that the RNA-2 TA element is the RCNMV OAS, virions consisting of RNA-1 co-encapsidated with the TBSV sgRNA containing the TA element were generated. The TA element was previously shown to be a critical factor in the trans-activation of transcription (Sit et al., 1998) and to be an essential cis-acting replication element for RNA-2 amplification (Tatsuta et al., 2005). This is a new function for the TA as the OAS reaffirms the TA's role as a critical multifunctional element in the RCNMV life cycle. Results RNA-1 is not encapsidated without RNA-2 To uncouple the requirement of RNA-2 for CP expression, the TBSV based vector pHST2 (Scholthof et al., 1996) was engineered to express and accumulate the RCNMV CP (construct pHST2-RCP; Figs. 1B and 2A). The TBSV MP (p22) expressed from pHST2-RCP complements the movement of RCNMV RNA-1 in the absence of RNA-2. To test the assembly capabilities of the heterologously expressed RCNMV CP, construct R1sGFP [RCNMV RNA-1 engineered to express sGFP in place of the CP (Sit et al., 1998)] was co-inoculated with wt RCNMV RNA-2

Fig. 2. RCNMV RNA-1 is not packaged in the absence of RNA-2. (A) Western blot of RCNMV CP expressed from pHST2-RCP vector alone (lane 1) or RNA-1 co-inoculated with pHST2-RCP (lane 2). (B) Electron micrographs of trans-encapsidated virions. Virions were purified from leaves inoculated with the following: pHST2-RCP (panel 1), RNA-1 + pHST2-RCP (panel 2), R1sGFP + pHST2-RCP (panel 3) and R1sGFP with RNA-2 + pHST2-RCP (panel 4). Scale bar equals 50 nm.

V.R. Basnayake et al. / Virology 384 (2009) 169–178

171

Fig. 3. RCNMV virion assembly directed by TBSV subgenomic RNA (sgRNA) containing the RCNMV RNA-2 origin of assembly region (OAR). (A) CP expression induced by RNA-2 OAR. A western blot of RCNMV CP expression induced by co-inoculation of RCNMV RNA-1 with pHST2 (lane 1), pHST2-ΔBP (containing the RNA-2 OAR; lane 2) and wt RNA-2 (lane 3), respectively. (B) Electron micrographs of purified virions from co-inoculations. RCNMV RNA-1 with pHST2 (panel 1), pHST2-ΔBP (panel 2) and wt RNA-2 (panel 3) respectively. Scale bar equals 50 nm. (C) Characterization of RNA from chimeric virions. Virion RNA was extracted and probed by northern blotting. Blots were hybridized with probes specific for RNA-1, RNA-2 and pHST2. Samples are: mock (lane 1), RNA-1 + pHST2 (lane 2), RNA-1 + pHST2-ΔBP (lane 3) and wt RCNMV (lane 4). Lane 5 for all blots contained T7 RNA transcripts specific for the probe used. Note that the packaged TBSV sgRNA contains the RNA-2 OAR element and is smaller than native RNA-2. Encapsidated RNA species are denoted with asterisks (⁎—RNA-1; ⁎⁎—RNA-2; ⁎⁎⁎—TBSV sgRNA).

and pHST2-RCP onto Nicotiana benthamiana plants. This triple inoculation accumulated RCNMV virions (Fig. 2B) suggesting that the CP from pHST2-RCP was fully functional for assembly. Furthermore, the assembly of R1sGFP reveals that the CP ORF (missing in R1sGFP) does not contain sequences critical for assembly. When either RCNMV RNA-1 or R1sGFP was co-inoculated with pHST2-RCP in the absence of RNA-2, no virions were detected (Fig. 2B) despite the presence of all the necessary components for RNA-1 only virions. This suggests that RCNMV RNA-1 is unable to produce virions in the absence of RNA-2. From this experiment we conclude that RCNMV RNA-1 is not encapsidated by itself and likely does not contain a discrete, independent OAS.

of wt RCNMV levels (based on UV spectroscopy of purified virions; data not shown) in correlation with the reduced CP expression levels. RNA extracted from these chimeric virions was subjected to northern analysis with RCNMV and TBSV specific probes. The RCNMV RNA-1 specific probe detected the presence of RNA-1 in the chimeric as well as wt virions (Fig. 3C). An RNA species was detected in chimeric virions which hybridized to the RCNMV RNA-2 MP ORF probe as well as a TBSV 3′ 738 nt probe (Fig. 3C). This RNA species is slightly smaller than RCNMV RNA-2 and appears to be the TBSV sgRNA expressing the 209 nt sequence from RCNMV RNA-2. Furthermore, the TBSV probe did not detect the encapsidation of the 4.7 kb TBSV genomic RNA despite the presence of the RCNMV RNA-2 209 nt element.

An RCNMV RNA-2 209 nt element directs encapsidation of the TBSV sgRNA into RCNMV virions

Refining the minimal OAS on RCNMV RNA-2 by deletion mutagenesis

Sit et al. (1998) reported that expression of a 209 nt region from RCNMV RNA-2 (containing the TA element) by pHST2 (construct pHST2-ΔBX), initiated CP synthesis from RCNMV RNA-1. A new construct containing the same 209 nt region was engineered to ensure that the expressed sgRNA would be similar in size to wild-type (wt) RCNMV RNA-2. This construct, pHST2-ΔBP, was tested for its ability to trans-activate either sGFP expression from R1sGFP or CP expression with virion formation when co-inoculated with RCNMV RNA-1. sGFP expression induced by pHST2-ΔBP was near the level induced by wt RNA-2 when co-inoculated with R1sGFP (data not shown). However, western analysis revealed that pHST2-ΔBP induces CP expression at reduced levels in comparison to wt RNA-2 when co-inoculated with RCNMV RNA-1 (Fig. 3A). Virions produced by co-inoculation of RCNMV RNA-1 and pHST2-ΔBP were indistinguishable from wt virions (Fig. 3B). Chimeric virions accumulated to approximately 60%

To refine the RCNMV packaging signal we produced a series of deletion mutants within this 209 sequence (nt 708–917; termed the Origin of Assembly Region or OAR) directly on RNA-2. Computer analysis utilizing mfold (Fig. 4; Zuker, 2003) predicted the presence of five stable stem loop structures within the OAR. The first structure is the previously reported TA element (Sit et al., 1998) followed by a GNRA tetraloop with three discrete stem loops (SL1–SL3) further downstream. There are also intervening sequences between these primary structures (g1–g3) which may or may not have functional implications in assembly. The mutations were designed to delete the primary structures and the intervening sequences. Since the OAR is located within the MP ORF, any deletion mutations may affect MP function. To overcome this potential limitation, transgenic N. benthamiana plants that express wt RCNMV MP (MP + plants) to complement any potential movement defects (Vaewhongs and Lommel, 1995) were used in addition to wt N. benthamiana plants.

172

V.R. Basnayake et al. / Virology 384 (2009) 169–178

Fig. 4. RNA-2 mutations within the origin of assembly region (OAR). Mfold secondary structure prediction for the RNA-2 OAR (nts 708–917). The putative five stem loop structures (TA, GNRA, SL1, SL2 and SL3) and the intervening sequences (g1, g2 and g3) are indicated. The TA and GNRA loops are shaded. The deleted region of each RNA-2 mutant is indicated below with the resultant final construct length indicated in parentheses. The asterisk indicates the position of the mutation on R2TAMUT.

Deletion mutants (still containing the TA element) were initially screened for replication and MP function by co-inoculation with R1sGFP and assaying for sGFP expression and movement on wt N. benthamiana plants. Mutants were subsequently co-infected with wt RCNMV RNA-1 and assayed for replication (via northern blotting) and assembly (by EM of purified virions) on MP + plants (findings summarized in Table 1). Deletions of the GNRA tetraloop (R2ΔGNRA) or any of the three downstream stem loops (R2ΔSL1, R2ΔSL2, R2ΔSL3, R2ΔSL1–3) as well as the intervening sequences (R2Δg1 and R2Δg2), were replication competent as assayed by northern analysis (Fig. 5). However, co-inoculation with R1sGFP demonstrated that replication of R2Δg3, R2Δg2–g3 and R2ΔG-g3 occurred at very low levels while mutants R2ΔTA and R2Δg1–g3 (which both lack the TA element) did not produce sGFP as expected. Assays for virion production determined that all RNA-2 deletion mutants, again with the exception of R2ΔTA and R2Δg1–g3, assembled into virions with varying degrees of efficiency (Fig. 6). In this study, deletion mutants of structural elements within the OAR were engineered to refine the minimal packaging element.

Despite deletion of all other structural elements within the OAR, save for the TA element, mutant R2ΔG-g3 was still able to direct virion assembly, although at highly reduced levels. This result indicates that the TA element is the minimal essential structure on RNA-2 that is necessary and sufficient for RCNMV assembly. TA loop mutation does not disrupt OAS function The terminal loop of the RNA-2 TA element base pairs with the RNA-1 TABS for trans-activation of CP sgRNA synthesis (Fig. 1A; Sit et al., 1998). Since the 8 nt terminal loop of the TA element was implicated in trans-activation, we wanted to ascertain if it played an additional role in assembly. To do this, the TA–TABS interaction was disrupted by incorporating two point mutations into the loop (Fig. 7A). This mutant (R2TAMUT) was able to replicate when co-inoculated with either R1sGFP or RNA-1 but did not induce detectable sGFP production from R1sGFP (Table 1). The assembly capabilities of R2TAMUT were assayed by co-inoculation with RCNMV RNA-1 and pHST2-RCP as a supplementary source of exogenous CP. This

V.R. Basnayake et al. / Virology 384 (2009) 169–178 Table 1 RNA-2 Deletion mutant phenotypes RNA-2 construct

Co-inoculated with R1sGFP onto N. benthamianaa

Co-inoculated with RNA-1 onto MP + N. benthamiana

173

shows that the co-packaged sgRNA has retained the TA element. These findings demonstrate conclusively that the TA element functions as the RCNMV OAS. Discussion

sGFP expression Cell-to-cell movement Replicationb Packagingc Wt RNA-2 R2Δg1 R2ΔTA R2ΔGNRA R2Δg2 R2ΔSL1 R2ΔSL2 R2ΔSL3 R2Δg3 R2ΔSL1–3 R2Δg2–g3 R2ΔG–g3 R2Δg1–g3 R2TAMUT

+ + − + + + + + + + + + − −

+ + − + − + + + + + + − − +

+ + − + + + + + +⁎ + +⁎ +⁎ − +

+ + − + + + + + + + + + − +

a sGFP expression and cell-to-cell movement visualized via fluorescence microscopy with FITC filter set. Non-fluorescing necrotic foci indicative of movement were visible in R2TAMUT co-inoculations with R1sGFP. b Replication assayed by northern analysis of total RNAs from inoculated leaves (see Fig. 5). An asterisk (⁎) indicates that replication was negative via northern analysis but positive for sGFP expression which is indicative of RNA-2 replication when the TA is present. c Packaging assayed by TEM (see Fig. 6).

combination results in the production of virions containing both RNA1 and R2TAMUT (Fig. 7B). This suggests that these point mutations in the TA loop have no detrimental effect on assembly. The RCNMV TA element functions as an OAS in a heterologous context The TA element was cloned into the heterologous pHST2 vector and was expected to express the TA element within a sgRNA of approximately 1134 nt in length. This construct, pHST2-SLΔNA, was co-inoculated with RCNMV RNA-1 and assayed for packaging. The presence of the TA element in pHST2-SLΔNA results in CP expression from RNA-1 but at a reduced level in comparison to RCNMV RNA-2 (Fig. 8A). More importantly, virions were observed confirming that the TA element was sufficient for directing virion formation (Fig. 8B). Virion accumulation was less than that produced with RCNMV RNA-2 as expected, based on the western analysis. RNA extracted from the chimeric virions was analyzed by gel electrophoresis and RT-PCR. As seen in Fig. 8C, chimeric virions contain RNA-1 together with a smaller RNA species corresponding in size to the sgRNA expressed from pHST2-SLΔNA. Viral RNA was further subjected to RT-PCR analysis with TA and pHST2 specific primers to verify the chimeric nature of the packaged RNAs. Fig. 8D

Based on our earlier findings that RCNMV virions were composed of 2 populations, we had proposed that RNA-2 was the most likely location for the RCNMV OAS (Basnayake et al., 2006). We were able to demonstrate the absence of a discrete, independent OAS on RCNMV RNA-1 when heterologously expressed RCNMV CP, that was assembly competent, was unable to form virions when only RNA-1 was present. This does not, however, preclude the possibility of a discrete OAS/CP binding site on RNA-1 that requires the close presence of the OAS from RNA-2. The replicating pHST2 vector was chosen to exogenously express the RCNMV CP since this most closely resembles the wt replication process. Furthermore, the ability of pHST2 constructs expressing the TA element to induce sGFP expression from co-inoculated R1sGFP (Sit et al., 1998) suggests that the RNAs are in close spatial as well as temporal proximity within the infected cell. The RCNMV genomic RNAs are truly co-dependent upon each other since RNA-1 cannot package and move without the aid of RNA-2 while RNA-2 cannot replicate without the aid of RNA-1. This parallels the situation for another bipartite RNA virus, FHV, where both genomic RNAs are co-packaged into a single virion (Krishna and Schneemann, 1999) but the CP ORF is located on RNA-2 which also contains the proposed OAS (Zhong et al.,1992). However, any potential RNA–RNA interaction in FHV assembly is complicated by the finding that RNA-1 and RNA-2 packaging is independent of each other (Venter and Schneemann, 2008). Having ruled out the presence of a discrete OAS on RNA-1, our attention was focused on RNA-2 where a 209 nt sequence was sufficient to trans-activate CP synthesis from RNA-1 (Sit et al., 1998). This region (which we now term the OAR) is highly conserved phylogenetically among the three sequenced Dianthovirus species, possibly reflecting a conserved function. The formation of psuedorecombinant virions between the genomic RNAs of the various Dianthovirus species lends further support to this possibility (Okuno et al., 1983; Sit and Lommel, unpublished data). pHST2 constructs containing the OAR co-package RCNMV RNA-1 (Figs. 3B and C), demonstrating the presence of the RCNMV OAS within this region. Given the possibility that any one of the five predicted stem loop structures within the OAR was the putative OAS, what properties do other characterized OASs of spherical RNA viruses have in common? The OAS for the monopartite TCV was delimited to a 28 nt bulged hairpin loop (Qu and Morris, 1997) whereas a 32 nt stem loop on RNA2 was proposed for the bipartite FHV (Zhong et al., 1992). Therefore, the OAS for RCNMV would most likely be a highly conserved stem loop structure.

Fig. 5. Replication of the RNA-2 OAR mutants. Northern analysis was performed on total RNA isolated from leaves inoculated with RCNMV RNA-1 and various RNA-2 mutants. The blots were hybridized to 32P labeled RCNMV RNA-2 specific probes. Ethidium bromide stained rRNA controls from each total RNA extraction are shown below the blots.

174

V.R. Basnayake et al. / Virology 384 (2009) 169–178

Fig. 6. Virions produced by RNA-2 mutants. Representative electron micrographs of virions produced by co-inoculation of RCNMV RNA-1 with RNA-2 mutants. RCNMV RNA-1 coinoculated with: A) wt RNA-2; B) R2Δg1; C) R2ΔTA; D) R2ΔGNRA; E) R2Δg2; F) R2ΔSL1; G) R2ΔSL2; H) R2ΔSL3; I) R2Δg3; J) R2ΔSL1-3; K) R2Δg2-g3; L) R2ΔG-g3; M) R2Δg1-g3; N) R2TAMUT. In the case of mutant R2TAMUT (panel N), pHST2-RCP was also co-inoculated to provide CP in trans. Scale bar equals 50 nm.

A series of deletion mutants within the OAR were produced directly on RNA-2 (Fig. 4) and co-inoculated with wt RCNMV RNA-1 to ensure that the assembly assay most closely mimicked a wt RCNMV infection. This was especially critical in light of the findings for BMV and FHV where heterologously expressed CP from non-replicating sources resulted in decreased packaging specificity for viral RNAs (Annamalai and Rao, 2006; Venter et al., 2005). The findings of Tatsuta et al. (2005) demonstrating the cis-acting replication function of the TA element was reaffirmed by mutants R2ΔTA and R2Δg1–g3 (both missing the TA element) which did not replicate to detectable levels in the presence of RCNMV RNA-1 (Fig. 5 and unpublished data). All deletion mutants (with the exception of R2ΔTA and R2Δg1–g3) were encapsidated into virions when co-inoculated with RCNMV RNA-1. Surprisingly, construct R2ΔG-g3, lacking the entire OAR with the exception of the TA element, was packaged into virions. This reductionist approach has revealed that the TA element is the functional entity within the OAR responsible for RCNMV assembly. The highly conserved TA element fits the premise that the RCNMV OAS would be a highly conserved stem loop structure. The obvious test for the TA element being the OAS would be to delete only the TA element from RCNMV RNA-2 to abolish virion formation. However, it is not possible to uncouple the OAS function of the TA element from its cisacting role in the replication of RCNMV RNA-2. To bypass this obstacle, the TA element was expressed from the heterologous pHST2 vector (construct pHST2-SLΔNA) and co-inoculated with RCNMV RNA-1. The pHST2-SLΔNA sgRNA (containing the TA element) was co-packaged with RCNMV RNA-1 into virions (Fig. 8) proving conclusively that the TA element serves as the RCNMV OAS. The TA/TABS interaction was initially identified via its role in activating CP sgRNA synthesis from RNA-1 (Sit et al., 1998). Structural studies showed that the TA/TABS interaction forms a stacked helical structure reminiscent of the dimerization signal of Human immunodeficiency virus I (HIV-1; Guenther et al., 2004; Mujeeb et al., 1998). Thus, the TA/TABS interaction may also be responsible for the initiation of heterodimer complex formation between RNA-1 and

RNA-2 (Basnayake et al., 2006) by forming a bipartite OAS that is favored over the TA alone for CP binding. This mechanism would ensure the co-packaging of both genomic RCNMV RNAs (Basnayake et al., 2006) much like the dimerization signal of HIV-1 ensures packaging of two copies of the HIV-1 genomic RNA (Fu et al., 1994; Sakuragi et al., 2003). To evaluate the necessity of this interaction for RCNMV virion assembly, the TA loop was mutated on RCNMV RNA-2 (mutant R2TAMUT). This RNA-2 mutant formed virions when coinoculated with RCNMV RNA-1 and pHST2-RCP as the heterologous source for RCNMV CP. This suggests that there may be other RNA–RNA contacts besides the TA/TABS interaction involved in the co-packaging of the genomic RCNMV RNAs. Alternatively, the TA loop mutation may have been sufficient enough to disrupt trans-activation but not copackaging as only 2 loop nucleotides were changed. This may also indicate that CP recognition and assembly initiation occurs at a different region of the TA element such as the helical regions. It was an interesting observation that the previously characterized TA element also acts as the OAS given the genetic compactness of RNA viral genomes. There are several examples of multifunctional RNA elements within both plant and animal RNA viral genomes. The Turnip yellow mosaic virus (TYMV) 5′ leader region contains a hairpin secondary structure identified as a regulator of both translation and encapsidation (Bink et al., 2002, 2003; Hellendoorn et al., 1996). This TYMV regulator is involved in translation during the early stages of the viral life cycle. During latter stages of infection, the internal cytosines within the hairpin get protonated leading to an altered conformation which switches its function from translation regulator to packaging signal for TYMV encapsidation. The BMV 3′ TLS is a multifunctional element that directs minus-strand synthesis (Chapman and Kao, 1999; Dreher, 1999) while also serving as half of the packaging element on RNA3 (Choi et al., 2002; Choi and Rao, 2003; Damayanti et al., 2003). Genomic functions of HIV-1 such as assembly, dimerization, primer binding, primer initiation and Gag start codon, overlap each other within the 5′ non-coding region known as the Ψ element (Abbink et al., 2005; Berkhout et al., 2002; Clever et al., 2002; Paillart et al.,

V.R. Basnayake et al. / Virology 384 (2009) 169–178

175

Fig. 7. The importance of the TA terminal loop in assembly. (A) The TA–TABS interaction between RNA-1 and RNA-2. The wild-type interaction is depicted on the left while the two nucleotide mutation (unfilled residues) of construct R2TAMUT is depicted on the right. (B) Northern hybridization analysis of virion RNAs with RNA-1 and RNA-2 specific probes. RCNMV RNA-1 co-inoculated with R2TAMUT (lane 1) or R2TAMUT with pHST2-RCP (lane 2). Since R2TAMUT does not induce CP expression from RNA-1, pHST2-RCP was coinoculated to provide CP in trans. Lane 3 represents a T7 RNA transcript corresponding to the probe used.

2004). This Ψ element acts as a riboswitch that upon dimerization of the genomic RNA, changes its conformation to present the essential encapsidation signal to allow the binding of Gag polyprotein (nucleocapsid precursor; Ooms et al., 2004). The dimerization and encapsidation switch mechanism of the Ψ element for Moloney murine leukemia virus is better characterized (D'Souza and Summers, 2004). Dimerization of the genomic RNA exposes the conserved UCUG sequence to the Gag polyprotein ensuring that only the genomic dimer is packaged while discriminating against spliced RNAs which do not dimerize. Another interesting observation was the total lack of TBSV genomic RNA encapsidation by RCNMV CP despite the presence of the RCNMV OAS on the genomic pHST2 constructs (Fig. 8C). This is probably due to the stoichiometry of the packaged RNAs where chimeric pHST2 constructs alone (∼4000 + nt) would be insufficient while being too large to co-package with RCNMV RNA-1 (∼7900 nt). This reinforces our finding that virions containing RNA-1 only are not likely to be found even if an OAS is present as the RNA content would be suboptimal. Based on the cumulative data discussed above, we propose the following model for RCNMV assembly. The RNA-2 TA element binds to the RNA-1 TABS and initiates CP sgRNA and subsequently, CP synthesis late in the viral infection process. The TA/TABS interaction results in a reorganization of the TA element leading to exposure of its stem (and/ or an RNA-1:RNA-2 OAS complex) followed by CP recognition and binding. The TA/TABS interaction leads to an intimate association between RNA-1 and RNA-2 facilitating encapsidation of both RNAs into a single virion (Basnayake et al., 2006). Assuming that a finite amount of RNA is required for stable virion formation, a second type of virion might package 4 copies of RNA-2 due to the coalescence of initiation complexes in a less favorable conformation. Thus, the RNA-2 location of the OAS leads to the presence of two RCNMV virion populations: i) one type co-packaging RNA-1 and RNA-2 (5.3 kb total) and ii) a second type with four copies of RNA-2 (5.8 kb total). This

difference in total RNA content per virion may be resolved by the recently described RNA-1 degradation product of approximately 0.4 kb in length that is present in virion RNA preparations (Iwakawa et al., 2008). How or why this additional RNA is packaged into virions is unknown at this time. Additional support for the two population model comes from dilution infectivity data for dianthoviruses which suggested two virion types (Hamilton and Tremaine, 1996). The multifunctional nature of the TA element was reaffirmed by our findings that it functions as the OAS for RCNMV. Much like the retroviruses mentioned previously, the TA/TABS interaction may cause a reorganization of the TA element to expose critical residues required for CP binding to the OAS as well as ensuring the co-packaging of both genomic RNAs into a single virion. One could envision the evolving role of the TA element during the viral life cycle to be a consequence of: i) the RNA-2 concentration, ii) the presence of both cis- and transinteractions and iii) the presence of viral proteins. The dynamic TA element would first serve as a cis-acting replication element (Tatsuta et al., 2005) at low concentrations of RNA-2 where trans-interactions are not favored. Later in the infection process, when sufficient time has elapsed to allow amplification of both genomic RNAs, a transinteraction (TA/TABS) would be the most likely outcome leading to sgRNA synthesis. Finally, this TA/TABS structure may be altered by the process of interaction to reveal the final function of the TA element, that of the OAS. Thus, the TA functions as a key regulatory element within the RCNMV life cycle. Materials and methods Plasmid constructs Full-length RCNMV RNA-1 (RC169) and RNA-2 (pRC2) cDNA clones as well as the sGFP expressing RNA-1 clone (R1sGFP) were described previously (Sit et al., 1998; Xiong and Lommel, 1991).

176

V.R. Basnayake et al. / Virology 384 (2009) 169–178

Fig. 8. The 34 nt RCNMV RNA-2 TA element is sufficient for heterologous co-encapsidation with RCNMV RNA-1. (A) Western blot of CP expression induced from RNA-1. CP was detected from total leaf proteins of MP + plants inoculated with the following: lane 1, mock inoculation, lane 2, RNA-1 alone, co-inoculation of RNA-1 with pHST2 (lane 3), pHST2SLΔNA (lane 4) and wt RNA-2 (lane 5), respectively. (B) Electron micrographs of virions from co-inoculation of RNA-1 with pHST2-SLΔNA (left panel) or wt RNA-2 (right panel). (C) Encapsidated viral RNAs. Purified virion RNA was analyzed by agarose gel electrophoresis. Asterisks denote the position of co-packaged TBSV sgRNAs (in lanes 4 and 5) while the arrow denotes the position of wt RNA-2 in lane 6. Lane 1, mock inoculation, lane 2, RNA-1 alone, lane 3, RNA-1 with pHST2, lane 4, RNA-1 with pHST2-SLΔNA (sgRNA size of 1134 nt), lane 5, RNA-1 with pHST2-ΔBP (sgRNA size of 1430 nt) and lane 6, wt RCNMV. Due to differences in packaging efficiency, the volume of wt RCNMV RNA loaded onto the gel was 1/20th of the other virion RNAs. (D) Confirming the chimeric nature of co-packaged RNAs. RT-PCR amplification of virion RNAs was conducted with a primer specific to the RCNMV TA element and one for the pHST2 vector (lanes 2–6). Only chimeric RNAs should generate an amplification product. Lane 1, molecular weight marker, lane 2, mock inoculation, lane 3, RNA-1 with pHST2, lane 4, RNA-1 with pHST2-SLΔNA, lane 5, RNA-1 with pHST2-ΔBP, lane 6, wt RCNMV and lane 7, RNA-2 positive control amplified with a pair of RNA-2 specific primers. Note that the amplified products from pHST2-SLΔNA and pHST2-ΔBP are different in size reflecting the different sized sgRNAs produced by each construct.

pHST2-based constructs The TBSV based construct pHST2 (kindly provided by H.B. Scholthof, Texas A & M University) served as the heterologous expression vector for RCNMV RNA-2 sequence fragments. Constructs pHST2-ΔBX and pHST2-SL2 (containing a 209 and core 34 nt TA, respectively, from RCNMV RNA-2) were described previously (Sit et al., 1998). pHST2-ΔBP was derived from construct pHST2-ΔBX by the deletion of 260 nt from the pHST2 vector as follows. A PCR fragment was first amplified with PfuTurbo® DNA polymerase (Stratagene, La Jolla, CA) from pHST2 utilizing primers pHST2 2941 X/B and pHST2 −3475 (see Table 2) followed by cleavage with XhoI/NcoI. Subsequently, pHST2-ΔBX was digested with XhoI/NcoI followed by ligation of the pHST2 PCR fragment to generate pHST2-ΔBP. pHST2-SLΔNA was derived from pHST2-SL2 by cleavage with NotI/ AgeI followed by blunting with Klenow fragment and re-ligation to yield a construct with a 390 nt deletion of the pHST2 vector sequence. pHST2-RCP is a construct that expresses wt RCNMV CP. The RCNMV CP ORF was amplified by PCR with Taq DNA polymerase (New England Biolabs, Ipswich, MA) using oligos 5′ RCP and 3′ RCP. The PCR fragment was subcloned into the pGEM-T vector (Promega, Madison, WI) and subsequently isolated after cleavage with XhoI/StuI. The pHST2 vector was cleaved with XhoI/SnaBI and dephosphorylated with shrimp alkaline phosphatase (USB, Cleveland, OH) prior to ligation of the CP insert. RNA-2 mutants Site-directed mutants of RCNMV RNA-2 were synthesized utilizing the QuikChange® Site-Directed Mutagenesis kit (Stratagene). The oligonucleotides used in the construction of the mutants were synthesized by MWG Biotech (High Point, NC) and listed in Table 2. R2Δg1–g3 contains a deletion of all structural elements characterized within the 209 nt region of RCNMV RNA-2. An EcoRI site was introduced into pRC2 at nt 730 by site-directed mutagenesis with the

oligonucleotide MP214 ECO STOP to generate MP214S1. This construct was cleaved with EcoRI/BglII followed by blunting with Klenow fragment and re-ligation to yield a construct with a 186 nt deletion. Plant inoculations T7 RNA transcripts of RCNMV RNA-1 and RNA-2 as well as pHST2 constructs were produced from SmaI linearized templates as previously described (Sit et al., 1998). Uncapped transcripts (5 μl of Table 2 Sequences of oligonucleotides Oligonucleotidesa

Sequencesb

pHST2 2941X/B pHST2 −3475 5′ RCP 3′ RCP ΔGNRA (HindIII)⁎ ΔSL1 (HindIII)⁎ ΔSL2 (HindIII)⁎ ΔSL3 (HindIII)⁎ ΔSL1–3 (HindIII)⁎ ΔTA (HindIII)⁎ ΔTAMUT (AflIII)⁎ Δg1 (HindIII)⁎ Δg2 (HindIII)⁎ Δg3 (HindIII)⁎ Δg2–g3 (EcoRI)⁎ ΔG–g3 (EcoRI)⁎ MP 214 ECO STOP⁎ RC2 TA CLA 5′ (+)

ATTCTCGAGATCTCGGCAACAACGTTAGGCTTG CGAATCTCCCGTCCAAGATC GCAGGCCTACGTAAAATGTCTTCAAAAGCTCCC ATGAGCTCGAGTCTAGATTAACCAAGTATGAAAGTG GCCTCTCAGTGTTGTACCAA_aagcttGTTGAAACAGAAAGGAGG CAGAAAGGAGGAACTG_aagcttCTTCGTTGGAACCTTCTTCC CCACGAAGCTGCCTTCGT_aagcttGTTCCGGCTTGAGTATG CCTTCTTCCGGTTCCAGTTC_aagcttAAGATCTCACAGAAATGTTC CAGAAAGGAGGAACTG_aagcttGAAGATCTCACAGAAATGTTCTG CCCTCCCAAAGCAGAGACA_aagcttAAACCAAGGACGAGAGTCCAAGG GACAGGTTCAATCAGAGGTATaGCgCCGCCcttaagTGTTGTACCAAACC GGAGAAGAATCCTCAACTG_aagcttGGTTCAATCAGAGGTATCGC GGACGAGAGTCCAAGG_aagcttGGCAGCAAAACCACGAAGC CGTTTAATCGGAATAGATGAGT_aagcttCGGCTCATACTCAAGCC GGACGAGAGTCCAAGGTGTT_gaattcAAGATCTCACAGAAATG CCTCTCAGTGTTGTACCAA_gaattcTCACAGAAATGTTCTG TCAACTGTGCACCAAATCCAATTgaattcATCATCCCTCCCAAAGC GTATCGATCAATCAGAGGTATC

a Oligonucleotides used with the QuikChange® Site-Directed Mutagenesis kit are denoted with an asterisk. The complimentary oligonucleotide is not shown. Engineered restriction sites are shown in parentheses. b Underscore denotes deleted region. Mutated or inserted nucleotides are indicated in lowercase text.

V.R. Basnayake et al. / Virology 384 (2009) 169–178

each genomic RNA) in a total volume of 110 μl 10 mM sodium phosphate buffer, pH 7.0, were used to inoculate four carborundumdusted leaves of N. benthamiana or MP + N. benthamiana plants at the 6–8 leaf stage. Inoculated plants were maintained at 18–20 °C under standard glasshouse conditions. Virus and RNA purification Leaf tissue, exhibiting symptoms, was harvested 4 days post inoculation (dpi). Virions were purified from 0.5 g of infected leaf tissue by homogenization in 1 ml of 0.2 M sodium acetate, pH 5.2, 0.1% β-mercaptoethanol. The homogenate was incubated on ice for 10 min prior to centrifugation at 16,250 g for 10 min. The supernatant was filtered through Miracloth and virions were precipitated by the addition of 1/4 volume of 40% PEG 8000, 1 M NaCl followed by incubation on ice for 30 min. Virions were pelleted by centrifugation at 16,250 g for 10 min and resuspended in 50 μl 10 mM Tris–HCl, pH 6.5. Viral RNA was extracted from virus preparations with phenol– chloroform after addition of SDS to 2% final concentration as described previously (Lommel et al., 1988). The final ethanol precipitated RNA pellet was resuspended in 10 μl of nuclease-free water.

177

blots were exposed on Phosphorimager® screens and visualized with the Storm™ Gel and Blot Imaging System (GE Healthcare). Western blotting Total leaf protein was extracted from 0.5 g of infected N. benthamiana leaf tissue according to the protocol described by Petty et al. (1989). Samples were electrophoresed by SDS-PAGE through 12% Ready Gels® (Bio-Rad Laboratories, Hercules, CA) at 200 V for 50 min in 1× Laemmli running buffer (Laemmli, 1970). Proteins were transferred to nitrocellulose membranes (GE Osmonics) in 25 mM Tris, 40 mM glycine using a Bio-Rad Trans-Blot® SD transfer cell. After transfer, the membrane was blocked in 50 mM Tris pH 7.4, 0.15 M NaCl, 0.05% Tween-20, 3% low fat dry milk. RCNMV CP was detected with rabbit polyclonal antisera raised against RCNMV virions, followed by incubation with goat anti-rabbit horseradish peroxidase conjugated antisera (Sigma-Aldrich, St. Louis, MO). The protein bands were visualized by the ECL™ Western Blotting Detection System (GE Healthcare) as directed by the manufacturer and exposed to Kodak BioMax Light Chemiluminescence film (Eastman Kodak, Rochester, NY). Electron microscopy

RT-PCR RCNMV virions were assayed for the encapsidation of TBSV sgRNA by RT-PCR. First strand synthesis was initiated with SuperScript™ II reverse transcriptase (Invitrogen, Carlsbad, CA) and pHST2 −3475 primer according to the manufacturer's instructions. The cDNA was amplified with GoTaq DNA polymerase (Promega) utilizing primers RC2 TA CLA 5′ (+) and pHST2 −3475. Total leaf RNA extraction Total RNA was purified from 100 mg of infected N. benthamiana leaves 4 dpi with the RNeasy® Plant Mini Kit (Qiagen, Valencia, CA) according to the manufacturer's protocol. RNA was resuspended in 50 μl of nuclease-free water. Gel electrophoresis For non-denaturing electrophoresis, a 1 μl aliquot of purified viral RNA or total RNA was electrophoresed through a 1% agarose gel in Tris-acetate EDTA buffer at 90 V for 1 h. For semi-denaturing electrophoresis, a 1 μl aliquot of purified viral RNA or total RNA was electrophoresed through a 1% agarose gel in Tris-borate EDTA buffer at 90 V for 1 h. For denaturing electrophoresis, 1 μl of viral RNA or total RNA was heated at 65 °C for 3 min prior to electrophoresis through a 1% agarose gel containing 1.8% formaldehyde in 1× MOPS (morpholinopropane sulfonic acid, pH 7.0) buffer. For all electrophoresis methods, RNA was visualized by staining with ethidium bromide. Northern blot hybridization Electrophoresed viral RNA was blotted onto Magnaprobe™ membranes (GE Osmonics, Minnetonka, MN) by capillary transfer in 5× SSC (0.75 M NaCl, 75 mM Sodium citrate, pH 7.0) buffer. The membrane was then subjected to optimal UV cross-linking with the Stratalinker® (Stratagene). DNA probes corresponding to the RNA-1 CP ORF, the RNA-2 MP ORF and a pHST2 EcoRI/SmaI 3′ 738 nt fragment were 32P-dCTP labeled with the Rediprime™ II DNA Labeling System (GE Healthcare, Piscataway, NJ). The blots were hybridized to the probes overnight at 62 °C in 250 mM sodium phosphate, pH 7.0, 7% SDS and 1 mM EDTA. The blots were washed at 60 °C with 5% SDS in 40 mM sodium phosphate, pH 7.0 and 1 mM EDTA followed by a wash with 1% SDS in 40 mM sodium phosphate, pH 7.0 and 1 mM EDTA. The

Purified virions were applied to Formvar-coated copper grids, negatively stained with 2% uranyl acetate and blotted dry. Virus preparations were visualized under a JEM-100S transmission electron microscope (JEOL, Tokyo, Japan) at 50,000× magnification. Acknowledgments Special thanks to Valerie Knowlton (NCSU EM Center) for the TEM work. We thank C.L. Hemenway and I.T.D. Petty (NCSU) for useful discussion and guidance. This work was supported by NSF competitive grants MCB-0077964 and MCB-0651263 to S.A.L. and T.L.S. References Abbink, T.E., Ooms, M., Haasnoot, P.C., Berkhout, B., 2005. The HIV-1 leader RNA conformational switch regulates RNA dimerization but does not regulate mRNA translation. Biochemistry 44, 9058–9066. Annamalai, P., Rao, A.L., 2006. Packaging of brome mosaic virus subgenomic RNA is functionally coupled to replication-dependent transcription and translation of coat protein. J. Virol. 80, 10096–10108. Annamalai, P., Rao, A.L., 2007. In vivo packaging of brome mosaic virus RNA3, but not RNAs 1 and 2, is dependent on a cis-acting 3′ tRNA-like structure. J. Virol. 81, 173–181. Basnayake, V.R., Sit, T.L., Lommel, S.A., 2006. The genomic RNA packaging scheme of Red clover necrotic mosaic virus. Virology 345, 532–539. Berkhout, B., Ooms, M., Beerens, N., Huthoff, H., Southern, E., Verhoef, K., 2002. In vitro evidence that the untranslated leader of the HIV-1 genome is an RNA checkpoint that regulates multiple functions through conformational changes. J. Biol. Chem. 277, 19967–19975. Bink, H.H., Hellendoorn, K., van der Meulen, J., Pleij, C.W., 2002. Protonation of nonWatson–Crick base pairs and encapsidation of turnip yellow mosaic virus RNA. Proc. Natl. Acad. Sci. U. S. A. 99, 13465–13470. Bink, H.H., Schirawski, J., Haenni, A.L., Pleij, C.W., 2003. The 5′-proximal hairpin of turnip yellow mosaic virus RNA: its role in translation and encapsidation. J. Virol. 77, 7452–7458. Chapman, M.R., Kao, C.C., 1999. A minimal RNA promoter for minus-strand RNA synthesis by the brome mosaic virus polymerase complex. J. Mol. Biol. 286, 709–720. Choi, Y.G., Rao, A.L., 2003. Packaging of brome mosaic virus RNA3 is mediated through a bipartite signal. J. Virol. 77, 9750–9757. Choi, Y.G., Dreher, T.W., Rao, A.L., 2002. tRNA elements mediate the assembly of an icosahedral RNA virus. Proc. Natl. Acad. Sci. U. S. A. 99, 655–660. Clever, J.L., Miranda Jr., D., Parslow, T.G., 2002. RNA structure and packaging signals in the 5′ leader region of the human immunodeficiency virus type 1 genome. J. Virol. 76, 12381–12387. D'Souza, V., Summers, M.F., 2004. Structural basis for packaging the dimeric genome of Moloney murine leukaemia virus. Nature 431, 586–590. Damayanti, T.A., Tsukaguchi, S., Mise, K., Okuno, T., 2003. cis-acting elements required for efficient packaging of brome mosaic virus RNA3 in barley protoplasts. J. Virol. 77, 9979–9986.

178

V.R. Basnayake et al. / Virology 384 (2009) 169–178

Dreher, T.W., 1999. Functions of the 3′-untranslated regions of positive strand RNA viral genomes. Annu. Rev. Phytopathol. 37, 151–174. Fu, W., Gorelick, R.J., Rein, A., 1994. Characterization of human immunodeficiency virus type 1 dimeric RNA from wild-type and protease-defective virions. J. Virol. 68, 5013–5018. Gould, A.R., Francki, R.I.B., Hatta, T., Hollings, M., 1981. The bipartite genome of red clover necrotic mosaic virus. Virology 108, 499–506. Guenther, R.H., Sit, T.L., Gracz, H.S., Dolan, M.A., Townsend, H.L., Liu, G., Newman, W.H., Agris, P.F., Lommel, S.A., 2004. Structural characterization of an intermolecular RNA–RNA interaction involved in the transcription regulation element of a bipartite plant virus. Nucleic Acids Res. 32, 2819–2828. Hamilton, R.I., Tremaine, J.H., 1996. Dianthoviruses: properties, molecular biology, ecology, and control. In: Harrison, B.D., Murant, A.F. (Eds.), The Plant Viruses, Volume 5: Polyhedral Virions and Bipartite RNA Genomes. Plenum Press, New York. Hellendoorn, K., Michiels, P.J., Buitenhuis, R., Pleij, C.W., 1996. Protonatable hairpins are conserved in the 5′-untranslated region of tymovirus RNAs. Nucleic Acids Res. 24, 4910–4917. Hogle, J.M., Maeda, A., Harrison, S.C., 1986. Structure and assembly of turnip crinkle virus. I. X-ray crystallographic structure analysis at 3.2 A resolution. J. Mol. Biol. 191, 625–638. Hollings, M., Stone, O.M., 1977. Red clover necrotic mosaic virus. CMI/AAB Descr. Plant Viruses 181. Iwakawa, H.O., Mizumoto, H., Nagano, H., Imoto, Y., Takigawa, K., Sarawaneeyaruk, S., Kaido, M., Mise, K., Okuno, T., 2008. A viral noncoding RNA generated by ciselement-mediated protection against 5′—N3′ RNA decay represses both capindependent and cap-dependent translation. J. Virol. 82, 10162–10174. Kim, K.H., Lommel, S.A., 1994. Identification and analysis of the site of −1 ribosomal frameshifting in red clover necrotic mosaic virus. Virology 200, 574–582. Krishna, N.K., Schneemann, A., 1999. Formation of an RNA heterodimer upon heating of nodavirus particles. J. Virol. 73, 1699–1703. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Loesch-Fries, L.S., Hall, T.C., 1980. Synthesis, accumulation and encapsidation of individual brome mosaic virus RNA components in barley protoplasts. J. Gen. Virol. 47, 323–332. Lommel, S.A., Weston-Fina, M., Xiong, Z., Lomonossoff, G.P., 1988. The nucleotide sequence and gene organization of red clover necrotic mosaic virus RNA-2. Nucleic Acids Res. 16, 8587–8602. Mujeeb, A., Clever, J.L., Billeci, T.M., James, T.L., Parslow, T.G., 1998. Structure of the dimer initiation complex of HIV-1 genomic RNA. Nat. Struct. Biol. 5, 432–436. Okuno, T., Hiruki, C., Rao, D.V., Figueiredo, G.C., 1983. Genetic determinants distributed in two genomic RNAs of sweet clover necrotic mosaic, red clover necrotic mosaic and clover primary leaf necrosis viruses. J. Gen. Virol. 64, 1907–1914. Ooms, M., Huthoff, H., Russell, R., Liang, C., Berkhout, B., 2004. A riboswitch regulates RNA dimerization and packaging in human immunodeficiency virus type 1 virions. J. Virol. 78, 10814–10819. Osman, T.A.M., Buck, K.W., 1987. Replication of red clover necrotic mosaic virus RNA in cowpea protoplasts: RNA 1 replicates independently of RNA 2. J. Gen. Virol. 68, 289–296. Osman, T.A.M., Buck, K.W., 1990. Double-stranded RNAs isolated from plant tissue infected with red clover necrotic mosaic virus correspond to genomic and subgenomic single-stranded RNAs. J. Gen. Virol. 71, 945–948. Paillart, J.C., Shehu-Xhilaga, M., Marquet, R., Mak, J., 2004. Dimerization of retroviral RNA genomes: an inseparable pair. Nat. Rev. Microbiol. 2, 461–472.

Paje-Manalo, L.L., Lommel, S.A., 1989. Independent replication of red clover necrotic mosaic virus RNA-1 in electroporated host and nonhost Nicotiana species protoplasts. Phytopathology 79, 457–461. Petty, I.T., Hunter, B.G., Wei, N., Jackson, A.O., 1989. Infectious barley stripe mosaic virus RNA transcribed in vitro from full-length genomic cDNA clones. Virology 171, 342–349. Qu, F., Morris, T.J., 1997. Encapsidation of turnip crinkle virus is defined by a specific packaging signal and RNA size. J. Virol. 71, 1428–1435. Rao, A.L.N., 2006. Genome packaging by spherical plant RNA viruses. Annu. Rev. Phytopathol. 44, 61–87. Sakuragi, J., Ueda, S., Iwamoto, A., Shioda, T., 2003. Possible role of dimerization in human immunodeficiency virus type 1 genome RNA packaging. J. Virol. 77, 4060–4069. Scholthof, H.B., Scholthof, K.B., Jackson, A.O., 1996. Plant virus gene vectors for transient expression of foreign proteins in plants. Annu. Rev. Phytopathol. 34, 299–323. Sherman, M.B., Guenther, R.H., Tama, F., Sit, T.L., Brooks, C.L., Mikhailov, A.M., Orlova, E.V., Baker, T.S., Lommel, S.A., 2006. Removal of divalent cations induces structural transitions in red clover necrotic mosaic virus, revealing a potential mechanism for RNA release. J. Virol. 80, 10395–10406. Sit, T.L., Vaewhongs, A.A., Lommel, S.A., 1998. RNA-mediated trans-activation of transcription from a viral RNA. Science 281, 829–832. Tatsuta, M., Mizumoto, H., Kaido, M., Mise, K., Okuno, T., 2005. The red clover necrotic mosaic virus RNA2 trans-activator is also a cis-acting RNA2 replication element. J. Virol. 79, 978–986. Turner, D.R., Butler, P.J., 1986. Essential features of the assembly origin of tobacco mosaic virus RNA as studied by directed mutagenesis. Nucleic Acids Res. 14, 9229–9242. Turner, D.R., Joyce, L.E., Butler, P.J., 1988. The tobacco mosaic virus assembly origin RNA. Functional characteristics defined by directed mutagenesis. J. Mol. Biol. 203, 531–547. Vaewhongs, A.A., Lommel, S.A., 1995. Virion formation is required for the long-distance movement of red clover necrotic mosaic virus in movement protein transgenic plants. Virology 212, 607–613. Venter, P.A., Krishna, N.K., Schneemann, A., 2005. Capsid protein synthesis from replicating RNA directs specific packaging of the genome of a multipartite, positivestrand RNA virus. J. Virol. 79, 6239–6248. Venter, P.A., and Schneemann, A., 2008. Recent insights into the biology and biomedical applications of Flock House virus. Cell Mol Life Sci. 65, 2675–2687. Xiong, Z., Lommel, S.A., 1989. The complete nucleotide sequence and genome organization of red clover necrotic mosaic virus RNA-1. Virology 171, 543–554. Xiong, Z.G., Lommel, S.A., 1991. Red clover necrotic mosaic virus infectious transcripts synthesized in vitro. Virology 182, 388–392. Xiong, Z., Kim, K.H., Giesman-Cookmeyer, D., Lommel, S.A., 1993a. The roles of the red clover necrotic mosaic virus capsid and cell-to-cell movement proteins in systemic infection. Virology 192, 27–32. Xiong, Z., Kim, K.H., Kendall, T.L., Lommel, S.A., 1993b. Synthesis of the putative red clover necrotic mosaic virus RNA polymerase by ribosomal frameshifting in vitro. Virology 193, 213–221. Zavriev, S.K., Hickey, C.M., Lommel, S.A., 1996. Mapping of the red clover necrotic mosaic virus subgenomic RNA. Virology 216, 407–410. Zhong, W., Dasgupta, R., Rueckert, R., 1992. Evidence that the packaging signal for nodaviral RNA2 is a bulged stem–loop. Proc. Natl. Acad. Sci. U. S. A. 89, 11146–11150. Zimmern, D., 1983. An extended secondary structure model for the TMV assembly origin, and its correlation with protection studies and an assembly defective mutant. EMBO J. 2, 1901–1907. Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406–3415.