Identification of Cis and Trans-elements involved in the timed control of a Caulobacter flagellar gene

J. Mol. Biol. (1991) 217, 247-257

Identification of Cis and Tracts-elements Involved in the Timed Control of a Caulobacter Flagellar Gene James W. Gober, Hong Xuf, Andrew K. Dingwall and Lucille Shapiro Department of Developmental Biology Stanford University School of Medicine Stanford, CA 94305-5427, U.S.A. (Received

27 July 1990; accepted 20 September

1990)

The genes encoding the structural components of the Caulobacter crescentus flagellum are temporally controlled and their order of expression reflects the sequence of assembly. Transcription of the operon containing the structural gene for the flagellar hook protein occurs at a defined time in the cell cycle, and information necessary for transcription is contained within a region between - 81 and - 120 base-pairs from the transcription start site. To identify the sequence elements that contribute to the temporal control of hook operon transcription, we constructed deletions and base changes in the 5’ region and fused the mutagenized regulatory region to transcription reporter genes. We demonstrate that sequences 3’ to the transcription start site do not contribute to temporal control. We confirm that upstream sequences between - 81 and - 120 base-pairs are necessary for temporal activation, and that transcription also requires sequences at -26 to -46 basepairs. A specific binding activity for the region between -81 and - 122 base-pairs was shown to be temporally controlled, appearing prior to the activation of hook operon transcription. This binding activity was missing from strains containing mutations in $a0 and $a W, two genes near the top of the flagellar hierarchy known to be required for hook operon transcription. Thus, the hook operon upstream region contains a sequence element that responds to a temporally controlled trans-acting factor(s), and in concert with a second sequence element causes the timed activation of transcription.

Ely, 1989). The order of Aagellar assembly appears to follow the temporal order of expression of the flagellar structural genes (Hahnenberger & Shapiro, 1987). The cell orchestrates the assembly of a large number of flagellar proteins through a hierarchy of trans-acting positive and negative controls that function to order jZa gene expression within a defined period in the cell cycle (Bryan et al., 1984, 1990; Ohta et al., 1985; Champer et al., 1985, 1987; Xu et al., 1989; Newton et al., 1989). Sequences within the 5’ regulatory region contribute to the regulation of the time of@ gene transcription (Ohta et al., 1985; Champer et al., 1985, 1987; Chen et al., 1986; Loewy et al., 1987; Minnich & Newton, 1987; Kaplan et al., 1989). To define the &-acting regulatory elements and the trans-acting factors that control this temporal activation, we analyzed the promoter region of the hook operon. The hook operon is composed of four genes, JlbG, $aJ, flbH and $aK (Ohta et al., 1985; Fig. l(a)). The nucleotide sequence of the hook operon 5’ region (Mullin et al., 1987) and conserved sequence motifs are shown in Figure l(b). The promoter for this operon was identified by Mullin et al. (1987) and

1. Introduction A critical problem in developmental biology is to understand the mechanisms that control the timing of gene expression within the context of a developmental program. It is becoming evident in many organisms, including bacteria (Komeda, 1982, 1986; Kroos & Kaiser, 1987; Losick et al., 1989; Bryan et al., 1990), yeast (Herskowitz, 1989) and multicellular organisms (Blau, 1988; Ingham, 1988; Baker, 1989; Villeneuve & Meyer, 1990), that groups of genes under temporal control are part of complex trans-acting regulatory hierarchies. The relationship between trans-acting control mechanisms and the temporal signals that activate gene expression is being actively studied. In this paper we investigate the &-acting elements and trans-acting signals involved in the timed expression of one of the components of the bacterial flagellum. The Caulobacter crescentus flagellum requires at least 48 genes for its biogenesis and function (Ely & 7 Present address: Center for Blood Research, 800 Huntington Avenue, Boston, MA 02132, U.S.A. 247 0022-2836/91/020247-l

1 $03.00/O

0

1991 Academic

Press Limited

J. W. Gober et al.

248 (01

-77 CG~GATTTTTCTTCGTA~A -37

-49

CAAGtCATTAAAGTCAlTGATAACAG~GGT~AGGTCG+GTTTTCCGAG 13 mer -I2 -24 &X~CGACCGTTT&TGAGGGAGGCb~ Dd,?.

.I

ic) Sgnthmtlc

ollgonucleotlda

-120 I

-81

AGCTCCGGC AAAAAGCGtCttl\CCG&GA-TCTT TCGAGGCCGTlTTTCGCGGCGTGGGCCACGCTAAAAAGAA I \

Figure 1. (a) Physical and genetic map of the hook operon (Ohta et al., 1985; Chen et al., 1986) carrying a reporter gene fusion. The gene designations for G, J, H and K are jlbG, jZaJ, jlbH and jlaK, respectively (Ohta et al., 1985). The site of insertion of the Tn5 :: neo reporter transposon in the structural gene for the hook protein, jZaK, is indicated by a filled triangle. A partial restriction map of the insertion and surrounding sequences is shown below the genetic map. The insertion flu-806 in mutant strain AE8006 contains a promoterless neo gene (hatched box) driven by the hook operon promoter, and a complete tet gene (open box). The BgZII to Hind111 restriction fragment in plasmid pHX3 is shown below the restriction map, and in more detail at the top of Fig. 2. The BgZII site is - 1300 bp from the + 1 start site and the Sac1 site is + 120 bp from t,he + 1 site. The restriction enzymes indicated are B, BarnHI; Bg, BgZII; P, P&I; R, EcoRI; S, SucI; X, XhoI; H, HindIII. (b) Nucleotide sequence of the 5’ regulatory region of the hook operon (Mullin et al., 1987). The +l indicates the transcription initiation site and numbers correspond to the positions in the upstream region. The 654 promoter sequence is underlined by a broken line at -12 and -24 (Mullin & Newton, 1989). A previously identified 13-mer consensus element and a NtrC-like element is indicated. A conserved region, ftr element (Mullin et al., 1987; Mullin & Newton, 1989), is shown in the open box and inverted repeat sequences are indicated by arrows. (c)The sequence of the doublestranded oligonucleotide used in gel mobility shift assays.

shown to conform to a - 12, - 24 nucleotide sequence motif that is used for the a54 promoters of other bacteria (for a review, see Kustu et al., 1989). In vitro mutagenesis was used to demonstrate that

this promoter sequence is required for the transcription of the hook operon (Mullin & Newton, 1989) and it was reported that this promoter is recognized in vitro by the Escherichia coli a54 subunit (Ninfa et al., 1989). Mullin & Newton (1989) also mutagenized an upstream consensus sequence,ftr (Fig. l(b)), that is found approximately 100 bpt upstream from the hook operon and several other flagellar genes, and showed that this element is required for transcription of the operon. An A+ T-rich region between the j’tr and the promoter contains a binding site for integration host factor (IHF). Mutations that abolish IHF binding prevent transcription of the hook operon in vivo (Gober & Shapiro, 1990), indicating that IHF is important in transcriptional activation. A conserved element, a l&mer, overlaps the IHF binding region and is also found in the 5’ region of several other flagellar genes (Kaplan et al., 1989). Some of these genes do not have an IHF consensus sequence, nor do they require IHF for activity. We demonstrate here that both the ftr element and sequences within a region at approximately -26 to -46 bp are necessary for temporal activation. Specific binding activity was detected for the region containing the ftr element and Southwestern assays of cell extracts showed that two proteins, 95,000 and 55,000 M,, bound to this region. This binding activity was cell-cycle-controlled and appeared prior to the time of activation of the hook operon promoter. The binding activity to the ftr region was absent in cell extracts ofJla0 and jla W mutants and the hook operon is not transcribed in these mutant strains (Xu et al., 1989; Newton et aZ., 1989). Thus jla0 and jlaW are candidate genes for the binding activity.

2. Materials and Methods (a) Materials

Calf intestine alkaline phosphatase was obtained from Boehringer-Mannheim. DNA polymerase I, phage T4 and restriction DNA ligate enzymes were from Boehringer-Mannheim, International Biotechnologies, or New England Biolabs. [y-32P]ATP (>3000 Ci/mmol) and [“Slmethionine (1150 mCi/mmol) were purchased from Amersham. Staphylococcus A cells were obtained from Bethesda Research Laboratory. The Muta-gene Ml3 in vitro mutagenesis kit was purchased from BioRad. Operon were synthesized Oligonucleotides by Technologies. (b) BacteriaZ

strains

and growth conditions

Wild-type C. crescentus CB15N was grown at 30°C in minimal M2 or rich PYE media (Contreras et aZ., 1978). Synchronized populations of C. crescentw CBl5N were obtained by centrifugation in a Ludox gradient as described by Evinger & Agabian (1977) and modified by Mansour et al. (1980). Swarmer cells (>95% pure) were t Abbreviations used: bp, base-pair(s); IHF, integration host factor; kb, IO3 bases or base-pairs; NPT II, neomycin phosphotransferase II.

Temporal Control of Caulobacter

Flagellar Genes

249

Table 1 List of plasmids Plasmids 1.3 kb PstI-XhoI fragment of the hook operon in pUC19 160 bp NarI-DdeI fragment of the hook operon promoter region in pUC19 120 bp SacI-DdeI fragment of the hook operon promoter region in pKIC7 6.6 kb BgZII to Hind111 fragment in pKH600 1.3 kb P&I to XhoI fragment in pRK290-20R 04 kb SaeI-X&I fragment from pHXU1 in pKIC7 0.8 kb Sac-XhoI fragment from pHXU1 (with 2 bases changed) in front of neo in pRK290-20R Deleted pHX6M at 5’ end from Sac1 to BgZII pHX6M containing an internal deletion of 19 bp pHX6M containing an internal deletion of 8 bp pHX6M containing 8 bp changes

pHX1.3 pHX160 pHX120-K pHX3 pHX120 pJG62 pHX6M pHXA70 pHXAl9 pHXA8 pHXr8

washed,

diluted

into

proceed synchronously

fresh medium, and allowed through the cell cycle at 30°C.

(c) Plasmid

to

constructions

Plasmids used in this study are listed in Table 1 and schematically shown in Fig. 2. Chimeric plasmids contain a portion of hook operon fused to a promoterless neo gene. pHX3 was cloned from C. crescentus strain AE8006 that harbors a Tn5-VB32 (Bellofatto et al., 1984) insertion in the JlaK gene. A BgZII fragment containing the entire hook operon and adjacent chromosomal sequences fused to the neo transcription reporter gene, was obtained from AE8006 DNA and ligated into pBR322 at the BamHI site. An 8 kb Hind111 fragment (one of the Hind111 sites was in the neo gene of the Tn5-VB32 insertion, and the other in the vector) was then inserted into pKH600, a derivative of pRK291 (Ditta et al., 1980), which contained a 1.8 kb BgZI fragment from pBR322 inserted into the BamHI site (Hahnenberger, 1987). pHX120 was obtained by subcloning a 1.3 kb PstI-XhoI fragment from the hook operon (Fig. 2) into pUCl9 (pHX1.3). Then a Sac1 (at - 120) to DdeI (at - 8) piece from the promoter region was isolated and cloned into plasmid pKIC7 containing a promoterless neo gene from Tn5 with multiple cloning sites (M. R. K. Alley, unpublished results). This vector was constructed by ligating a 1.2 kb BamHI-Sal1 fragment, which contained the neo gene from Tn5 without its promoter, into pIcl9H (Marsh et al., 1984). The cloned fragment was then ligated into pRK290 so that it could replicate in C. crescentws. In vitro mutagenesis was carried out on the 1.3 kb PstI-XhoI fragment that had been cloned into M13mp19. Site-directed mutagenesis was carried out on this phage DNA using the Muta-gene kit. After mutations were introduced, the appropriate sites were cut by restriction enzymes to release fragments containing the promoter region, aa shown in Fig. 2. These fragments were ligated into pKIC7 in front of the lzeo gene and then moved into pRK290 for mobilization into C. crescentus CB15N. The wild-type transcriptional fusion, p,JG62, was constructed the same way as the mutants. pHXA19 and pHXA8 carried the internal deletions shown in Fig. 2 and pHXr8 had the indicated base-pair changes. To obtain pHXGM, a 70 bp fragment from the Sac1 to BgZII site (generated by mutagenesis; shown in Fig. 2) ww inserted into pHXA70. (d) Transcription II)

assay by neo reporter

gene fusions

The synthesis of neomycin phosphotransferase II (NPT was measured by immunoprecipitation of cell extracts

from cultures pulse-labeled with [35S]methionine. To examine the synthesis of NPT II in synchronized cultures, portions of cells were taken at various stages of the cell cycle and pulse-labeled with [35S]methionine for 10 min. Cells were then lysed, preadsorbed with Staphylococcus A cells, and proteins immunoprecipitated with antisera against NPT TI, as described by Gomes & Shapiro (1984). The same number of counts were used for each experiment. Proteins were separated by electrophoresis through 10% (w/v) polyacrylamide/SDS gels. The gels were fixed in 5% (v/v) methanol and 7oj, (v/v) acetic acid, enhanced, and subjected to autoradiography.

(e) Gel mobility

sh,ift

assays

C. crescentus cell extracts were prepared from cells grown to mid-log phase, harvested by centrifugation and washed with a buffer containing 20 mM-Tris. HCl (pH 7.5), @l mM-EDTA, 100 mM-KCl. The washed cells were resuspended in the same buffer and disrupted by sonication on ice with six 15 s pulses. The lysed cells were centrifuged at 4°C and the supernatant from the crude extract was assayed for binding activity. Standard binding reactions were performed according to the procedure described by Irwin & Ptashne (1978). Single-stranded synthetic oligonucleotides were annealed to their complementary strands and end-labeled with [Y-~‘P]ATP. The labeled probes were incubated with crude extracts at 25°C for 20 min in binding buffer A (20 mM-Tris.HCl (pH &O), @l mM-EDTA, @l mMdithiothreitol, 100 mM-KCl, 5% (v/v) glycerol). Bovine serum albumin, to a final concentration of 100 pg/ml, 1 pg of poly(dIdC), and @5 pg of pUCl9 were added to each of the reactions. In the competition experiments, unlabeled oligonucleotides or plasmid DNA was incubated with the labeled probes. The reaction mixtures were applied to 5 y. polyacrylamide gels with a loading buffer (50% glycerol, 10 mM-Tris, pH 7.5) and tracking dye. The electrophoresis was carried out at 4°C for 3 h at 300 V in TBE buffer (Maniatis et al., 1982). The gel was then fixed in 10% acetic acid and 10% methanol, dried and subjected to autoradiography.

(f) Southwestern

blot assay

Specific DNA binding activities in crude Caulobacter protein extracts were detected by the method described by Miskimins et aZ. (1985) as modified by D. Shore (unpublished results). Crude protein extracts from

J. W. Gober et al.

250

Synthesis of NPT-II

Temporal expression

pHX3

pHXi20

+ AGGTTTAGGTCGT

-49

-37

pJG62

+

+

pHXA70

+

LOW

pHXAl9Ahfff +c

-46

Low

n.t.

Low

n.t.

Low

-

-26

pHXAe

pHXra

Figure 2. Schematic of deletions and base changes in the region 5’ to the hook operon u54 promoter and their effect on hook operon-neo fusion expression and temporal control. Mutagenesis was performed following the method described by Kunkel et aE. (1987) using phage Ml3 containing the P&I-XhoI fragment from the hook upstream region. Diagrams of 8 transcription fusions of the hook operon and hook operon deletions to a promoterless neo gene are shown. The numbers in the Figure indicate the positions of nucleotides relative to the + 1 transcriptional start site. The 5’ regulatory region up to - 120 (Sac1 site) is drawn in detail. Two filled ovals represent the promoter at - 12 and - 24 (Mullin & Newton, 1989). A previously identified 13 bp consensus sequence (“13-me?), shown as an open box lies between -37 to -49. The 13-mer sequence is shown in the pHX120 insert. Sequences between - 100 and - 117 contain the conserved pr region (Mullin & Newton, 1989), and a sequence just adjacent to the& (-99 to -90) contains an inverted repeat with some homology to an NtrC site. In pHX120 only the sequences from - 120 to - 8 are fused to neo. The pHX6M insert contains GG + TC base changes in the l&mer consensus sequence. pHXA70, pHXA19 and pHXA8 contain the indicated deletions. pHXr8 contains base changes in the l&mer while retaining the same number of nucleotides in the 5’ region as the wild-type gene. Bases in the 13-mer that have been mutagenized are typed as bold letters with dots above them. Restriction sites created by mutagenesis are underlined. All constructions were confirmed by DNA sequence analysis. Constructions were tested for promoter activity and temporal expression during the wild-type cell cycle by assaying NPT II synthesis, as described in Materials and Methods. The results are summarized. + , Normal; Low, detectable but low level of expression; -, loss of temporal expression; n.t., not tested. A is SacI, and all other restriction enzymes are as indicated.

Caulobmter (5 fig to 50 pg) were mixed with sample buffer (Miskimins et al., 1985) and electrophoresed using standard polyacrylamide/SDS electrophoresis. Electrophoretically separated proteins were transferred to nitrocellulose in 25 mM-Tris, 199 mv-glycine at 4°C. Proteins on filters were then denatured by incubation in buffer (40 ml) containing 50 mM-Tris (pH 8-O), 2 mM-EDTA 7 ni-guanidine . HCl, 50 mM-dithiothreitol, and 625c/o non-fat dried milk at room temperature for 1 h. Filters were washed once and then incubated in

100 m&l-NaCl, 100 ml of 50 mm-Tris . HCI (pH 80) 2 mar-dithiothreitol, 2 mM-EDTA, 61 y. (v/v) Nonidet P-40 and 925% non-fat dried milk overnight at 4°C. Filters were then incubated for 1 h at room temperature oligonucleotide double-stranded labeled with in TNE (10 mM-Tris . HCl (pH 80) (10’ cts/min) I mm-EDTA, 56 mm-NaCl) and 5 pg sheared calf thymus DNA/ml. Following incubation, filters were washed 3 times with TNE for 10 min, dried and exposed to X-ray film.

251

Temporal Control of Caulobacter Flagellar Genes 3. Results (a) Analysis of deletions and site-specijc mutations in the region 5’ to the hook operon promoter The non-motile mutant strain AE8006 was generated by transposon mutagenesis with Tn5-VB32 (Champer et al., 1985, 1987), carrying a transcription neo reporter gene (Bellofatto et al., 1984). Mapping and DNA sequencing analysis (data not shown) revealed that the neo reporter gene had inserted in the hook protein structural gene, jlaK (Fig. l(a)). A sequence containing the first three genes of the hook operon and the truncated $aK gene linked to a promoter-less neo gene was cloned in plasmid pHX3 (Xu et al., 1989; Fig. 2). This reporter gene was differentially transcribed during the cell cycle either as a chromosomal insertion (Champer et al., 1987) or as an insert carried either by pHX3 or by the shorter 5’ insert in pJG62 (see Figs 2 and 3). Plasmids bearing this reporter gene were used to generate a series of deletions and base changes (Fig. 2) to define the elements that contribute to the temporal control of hook operon expression. In vitro mutagenesis was carried out as described in Materials and Methods and all mutagenized sequences were verified by DNA sequence analysis. To confirm that only sequence elements 5’ to the transcription initiation site regulate the timing of transcription, a subclone was constructed that retained the promoter and the upstream region but lacked the natural transcription start site and mRNA sequences of the operon. The resulting plasmid, pHX120, contains a Sac1 (at -120) to DdeI (at -8) fragment fused to a promoterless neo gene (Fig. 2). The time of reporter gene expression was assayed in a synchronized culture of wild-type cells carrying pHX120 by immunoprecipitation with anti-NPT II (neomycin phosphotransferase II) antibody. Figure 3(a) shows that the reporter gene was expressed and that transcription occurred at the same time in the cell cycle as that seen with the control plasmids pHX3 and pJG62 (Fig. 3(b)). The synthesis of the 25,OOOM, NPT II in pHXl20, pHX3 and pJG62 increased at 965 division units. This result demonstrates that the regulatory information required for timing is retained in the 120 bp 5’ to the start of transcription, and that information 3’ to the natural transcription start site does not contribute to the temporal expression of the operon. Cis-acting sites within the 120 bp 5’ to the transcription

start

site were examined

for their

possible

roles in temporal control. Two nucleotides in the 13-mer region, GG at - 47, were changed to TC to generate plasmid pHX6M (Fig. 2). The time of transcription initiation of pHX6M was the same as that observed for pHX3, pJG62 and pHX120 (Fig. 3), indicating that these two nucleotides are not necessary for hook operon expression or for the timing of transcription initiation. The mutation in pHX6M generated a new BglII restriction site that allowed the construction of the deletion in pHXA70 (Fig. 2). The insert in pHXA70 lacks upstream

(b) I

2

3

4

5

6

pHX3

pHXI20

pJG62

pHX6M

pHXA70

pHXr8

Figure 3. Expression of plasmid-borne hook operon-nw transcription fusions in synchronized cultures of wild-type C. crescentus.The synthesis of the product of the neo gene, NPT II, is a direct reflection of the transcription of the chimeric mRNA initiating at the + 1 of the hook operon because the fusions have translation stop codons between the hook operon and region 5’ to the MO ATG. (a) Synthesis of NPT II by wild-type and mutagenized hook operon 5’ regions. Seven fusion plasmids, shown diagrammatically in Fig. 2, were introduced into a CB15N wild-type strain and NPT II synthesis was assayed by immunoprecipitation of [“Slmethioninelabeled extracts with anti-NPT II antibody, as described in Materials and Methods. The immunoprecipitated NPT II is resolved as a single 25,060 &f, band in the autoradiogram. (b) The temporal expression of the hook operon-neo fusions was assayed by immunoprecipitation of the reporter gene product NPT II in extracts of synchronized cultures of C. crescentus CBl5N containing pHX3, pHX120, pHXA70 and pHXr8. Portions of cells were pulse-labeled at 0,45, 90, 120, 150 and 180 min (lanes 1 to 6), corresponding to 0, 625, 05, 065, 06 and 1.0 division unit, respectively. Each of the cell cycles shown is the result of data obtained from a single culture of synohronized cells. Samples from each experiment were run on a single gel. Lanes 1 to 6 indicate specific stages of the cell cycle, as diagrammed below the autoradiograms. Division units are fractions of the cell division cycle with 1 unit equivalent to the generation time of 180 min. The cell cycle stages were monitored using light microscopy and by immunoprecipitating flagellins with anti-flagellin antibody as an internal control.

J. W. Gober et al.

252

0

I

2

3

4

5

6

7

6

9

10

1234567

-c

c-

F-F

(a)

(b)

Figure 4. DNA-protein complex formation between oligonucleotide I and C. crescentus protein from cell extracts. (a) Specific binding activity was detected in C. crescentus crude extracts prepared and assayed as described in Materials and Methods. The 32P-labeled probe (oligonucleotide I) was incubated in buffer A without protein, lane 0, or with 5 pg of mixtures were C. crescentus protein. In each lane 1 pg of poly(dIdC) was added as carrier DNA. The protein-DNA separated by electrophoresis as described in Materials and Methods. The band with the slowest migration rate is indicated as the DNA-protein complex (C). The free probe is indicated (F). Increasing amounts of non-specific DNA, pUC19, 1 pg (lane l), 2 pg (lane 2), 3 pg (lane 3) and 5 pg (lane 4) was added to the reaction mixtures. The retarded complexes were competed with unlabeled oligonucleotide I in lo-fold (lane 5) 20-fold (lane 6) and S&fold (lane 7) excess of the labeled probe. Plasmid pHXl60 DNA was used 118a competitor in lanes 8 through 10. pHX160, a derivative plasmid of pUC19, contains an insert of nucleotides - 160 to -8 from the hook operon promoter region. One, 2 and 3 pg of this plasmid were added to the reaction mixture in lanes 8, 9 and 10, respectively. (b) Binding activity as a function of the cell cycle. Extracts were prepared from synchronized cells at the stages of the cell cycle shown below the autoradiogram. Lane 1 contains probe without cell extract. The cell cycle stages correspond to 0, 025, 95, 668, O-8 and 1.0 division unit (lanes 2 to 7), respectively. In this experiment the cultures were grown in rich medium with a cell cycle of 120 min. The cell cycle was monitored by light microscopy. In each reaction, 2 pg of crude extract was used and the binding reaction is the same as described for (a).

sequences, but leaves the a54 promoter and upstream nucleotides up to -46 bp intact. The neo reporter gene in pHXA70 had a very low level of expression that was not activated at any time in the cell cycle (Fig. 3). These results confirm those of Mullin & Newton (1989), who demonstrated that upstream sequences are required for transcription of the hook operon. To explore further the role of the -46 to -26 bp region in temporal control of transcription three additional mutations were made. Two internal deletions of either 19 bp (-26 to -46) or 8 bp ( -37 to -46) were generated, pHXAl9 and pHXA8,

respectively (Fig. 2). Expression of the neo reporter gene in each of these plasmids was dramatically reduced (Fig. 3(a)). The region upstream from these deletions was unchanged, but the spacing was altered, perhaps accounting for the loss of activity. To generate a mutation in this region, while preserving the normal length of the promoter region and normal spacing between it and the other conserved elements, we changed five base-pairs (pHXr8). Expression of the neo reporter gene in pHXr8 was very low (Fig. 3(a)) and was not temporally activated as a function of the cell cycle (Fig. 3(b)). These results suggest that at least two

Temporal

Control

of

Caulobacter Flagellar

&-acting sites, at approximately - 100 and at -46 to -37 bp are required for temporal activation of transcription. These experiments do not rule out the possibility that sequences between - 37 and -26 are also required for activation. (b) Protein -81

binding to a sequence element between and -122 in the hook operon upstream region is temporally controlled

Plasmid pHXA70 contains a hook operon promoter with a deleted upstream region (Fig. 3). The loss of temporal activation in this deletion suggests that a trans-acting protein might interact with sequence elements in the deleted region. an oligonucleotide containing the Accordingly, sequences between -81 and -122 (Fig. I(c)) that has both an ftr element and two inverted repeats (Fig. l(b)) was used in gel mobility shift assays (Fig. 4). A specific DNA-protein complex (C) was detected (Fig. 4(a)). Unlabeled oligonucleotide 1 duplex competed effectively when present in tenfold excess of labeled probe (Fig. 5(a), lanes 5 to 7). The complex was also competed by the natural DNA fragment present in plasmid pHXl60 (Fig. 4(a), lanes 8 to 10). This plasmid contains an insert of nucleotides -8 to - 160 from the transcription initiation site. The same amount of pUCI9 vector DNA did not compete for the formation of the DNA-protein complex (lanes 1 to 4). To test if this specific binding activity was temporally controlled, gel mobility shift assays were performed using extracts prepared from synchronized cultures at different developmental stages, corresponding to 0, @25, @5,0.7,0.8 and 1.0 division unit (Fig. 4(b)). Specific binding activity was first detected in extracts of cells at 05 division unit, just prior to the initiation of transcription of the hook operon seen in Figure 3(b). Densitometer analysis revealed that the maximal activity occurs at @8 cell division unit and was five times greater than the activity measured in swarmer cells. To define more precisely the sequences bound by the trans-acting factor(s), competition binding experiments were performed using double-stranded oligonucleotides that were smaller than the labeled oligonucleotide I probe (Fig. 5). Oligonucleotide II cont’ains nucleotides - 103 to - 122 from the transcription start site and oligonucleotide III contains nucleotides from -90 to - 104. Oligonucleotide II competed effectively with the complexes formed with labeled oligonucleotide I. At the same DNA concentration, oligonucleotide III did not compete with labeled oligonucleotide I. These results indicate that sequences within the - 103 to - 122 bp region, which contains the conserved ftr sequence, are important for the binding of trans-acting factor(s). To identify the protein(s) that bound to oligonucleotide I, Southwestern analysis was performed as described in Materials and Methods. Proteins from crude cell extracts were separated by SDS/polyacrylamide gel electrophoresis, and transferred to nitrocellulose. The filter was probed with

I

253

Genes

-120 1 AGCTCCGGCAAAAAGCGCC&cGlGiiGmTTTcTT TCGAGGCCGTTTTTCGCGGCGTGGGCCACGCTAAAaAGAA

-120

II III

-81

-103

wq

-‘@y m(

1234567

Figure 5. Competition analysis of DNA-protein complex formation between oligonucleotide I and C. crescentus cell extracts. Specific binding activity was detected in C. crescentus crude extracts prepared and assayed as described in Materials and Methods. The labeled probe was oligonucleotide I. The competitor oligonucleotides are shown below and labeled as II and III. Oligonucleotide II represents sequences - 103 to - 122 bp from the transcription start of the hook operon promoter and encompasses most of the previously defined ftr element. Oligonucleotide III represents positions -90 to - 104 bp and contains an inverted repeat similar to an E. coli NtrC binding site. The bands with the slowest migration rate are indicated as DNA-protein complexes (C). The 2 complexes present in Fig. 4 are more clearly resolved in this experiment. The free probe is indicated (F). The 32P-labeled probe (oligonucleotide I) was incubated in buffer A without (lane 1) or with (lanes 2 to 7) competitor oligonucleotide and 5 pg of C. crescentus crude cell extract. Lanes 2, 3 and 4 contain oligonucleotide II as competitor at 10, 20 and 30 pg, respectively. Lanes 5, 6 and 7 contain oligonucleotide III as competitor at 10, 20 and 30 pg, respectively.

254

J. W. Gober et al. Oligom

Oligo I

-eCProtrinl+

-+CProtrinl--+

116 -

t

95 kd

c-

55kd

64

56

-

Figure 6. Detection of proteins in complex with oligonucleotide I by Southwestern analysis. Extracts of C. crescentus CB15N and “P-labeled oligonucleotide I or oligonucleotide III were prepared as described in the legend to Fig. 4. Proteins in cell extracts (5 to 50 pg) were separated by SDS/(lO%) polyacrylamide gel electrophoresis and then transferred to a nitrooellulose filter. Labeled probe was incubated with the filter and binding activity was detected as described in Materials and Methods. Autoradiography detected 2 proteins, 95,000 and 55,000 M,, in complex with labeled oligonucleotide I. kd = lo3 iw,.

32P-labeled

oligonucleotide

from

region

I (Fig. 6).

Two binding proteins were detected; a stronger activity at 95,000 M, and a weaker one at approximately 55,006 M,. To control for non-specific binding, Southwestern analysis was also performed using an oligonucleotide (III) that failed to compete with oligonucleotide I in the binding assay shown in Figure 5. Binding proteins were not detected when labeled oligonucleotide III ( - 90 to - 104) was used as a probe (Fig. 6). When labeled oligonucleotide II, which competed with oligonucleotide I in gel mobility shift assays (Fig. 5), was tested in Southwestern assays, weak binding activity of only the 95,066 M, protein was detected (data not shown). It may be that the transacting

factors

recognize

the sequence

but bind

less

well to this smaller oligonucleotide. The fact that relatively high concentrations of oligonucleotide II DNA are required to compete with binding activity to oligonucleotide I, supports this possibility. (c) Binding

activity

in jlagellar

genes (Fig. 7). Extracts of the jla0 mutant strain possessed no binding activity. At low protein concentrations, jla W extracts also had no binding activity. Although a complex was formed at the highest protein concentration tested (3 pg), it exhibited a different mobility than that observed with extracts of wild-type cells. It appears, therefore, that flu0 and JEaW either encode or are necessary for the expression of the binding activity present in wildtype cells. Extracts prepared from two mutants, jlb0 and jlbD, possess wild-type binding activities demonstrating that loss of binding activity is not a general characteristic of mutations in all genes known to be required for hook operon transcription.

mutant strains

Several genes near the top of the flagellar regulatory hierarchy are known to be required for hook operon transcription (Xu et al., 1989; Newton et al., 1989). These genes are likely candidates for direct regulators of the hook operon. We therefore performed gel mobility shift assays using labeled oligonucleotide I with extracts prepared from strains carrying mutations in $aS, $bO, jla0, $a W or $bD

4. Discussion The genes encoding the structural proteins of the flagellum are temporally controlled. The correct order of jla gene transcription may be essential for the assembly process. As is true for flagellar biogenesis in E. coli (Komeda, 1982, 1986), the C. crescentusja genes exist in a regulatory hierarchy (Xu et al., 1989; Newton et al., 1989; Bryan et al., 1996). Once the temporal signal to begin the flagellar regulatory cascade is given, the ordered transcription of $a genes is set in motion. The expression

of these

genes

appears

to

be tightly

coupled to other cell cycle events. Mutations in genes near the top of this hierarchy, including JlaS, $bO,$bD,$aW andjla0, have a complex phenotype.

255

Temporal Control of Caulobacter Flagellar Genes Strain:

CB15N

Genotype:

Wild-type

SC1131

SC297

SC1032

f/b0

fldv

flbD

F-

Figure 7. Analysis of protein-DNA complexes formed between labeled oligonucleotide I and protein extracts prepared from C. crescentus Aagellar mutant strains. Extracts, probe preparation, and gel shift assays were performed as described in the legend to Fig. 4 and in Materials and Methods. One, 2 and 3 pg of protein extract of wild-type CBlBN, pa&’ (SC508), $bO (SC1131), jIa0 (SC290), JlaW (SC297) or JEbD (SC1032) cells were tested for binding activity. The specific DNA protein complexes are designated (C). Free probe is indicated (F). Non-specific complexes are present, and migrate between the specific complexes (C) and the free probe (F).

These mutants are unable to form a flagellum and they fail to divide normally. In addition, it is known that disruption of DNA replication (Osley & 1977; Sheffery & Newton, 1981) or Newton, membrane synthesis (Conteras et al., 1980; Shapiro et al., 1982) disrupts flagellar biogenesis. These observations argue that the temporal control of flagellar biogenesis is closely related to other cell cycle events. How then is the ordered expression of these genes accomplished? What is the signal that initiates the cascade of the j&z gene expression1 The position of the jlu genes in the regulatory hierarchy reflects the order of their transcription. Genetic analyses have shown that the expression of the hook operon is under the positive control of jlaS, $uO, @D, $a W andJEb0 (Champer et al., 1985, 1987; Ohta et al., 1985; Xu et al., 1989; Newton et al., 1989); these are the same set of genes that also have a cell division phenotype. Mutations in any of these genes results in a low level of hook operon transcription. In this paper we have identified both &-acting elements and tram-acting proteins that participate in the temporal activation of the hook operon in an effort to initiate a biochemical defini-

tion of the trans-acting effects that were previously defined genetically. Examination of the DNA sequence of the hook operon upstream region reveals at least four highly conserved elements. These include the a54 promoter sequence (Mullin & Newton, 1989), a 13-mer consensus sequence that is found in front of several C. crescentus jla genes, (Kaplan et al., 1989) and in some flagellar genes overlaps an IHF binding site (Gober & Shapiro, 1990). There is also a region between -81 and - 120 that contains two conserved elements: an ftr element (Mullin & Newton, 1989) and an adjacent inverted repeat sequence that is similar to an E. coli NtrC binding site (Reitzer t Magasanik, 1986). We have shown here that mutations in two of the regulatory genes, $a0 and jaw, lack a temporally controlled binding activity for the upstream ftr region of the hook operon. Mullin & Newton (1989) have demonstrated that the as4 promoter and sequences within the ftr consensus element are essential for hook operon transcription. We show here that sequences within the region designated as the 13-mer element (Kaplan et al., 1989) are also essential for expression

256

J. W. Gober et al

of this operon. Base substitutions in the region - 46 to -26 bp (which retains the correct spacing of elements in the 5’ region) and a deletion of this region resulted in loss of transcription of the hook operon. We conclude, however, that the entire conserved 13-mer element is not important for transcriptional activation, since a mutation that disrupts the 13-mer consensus (pHX6M) is still under normal temporal control. We have shown that the E. coli IHF binds to a region of high A+T DNA that overlaps the 13-mer region in the hook operon (Gober & Shapiro, 1990). Mutations within the 13-mer region that had an effect on transcription also prevent efficient binding by IHF. It is probable that IHF contributes to the temporal control of transcription, since the protein itself is under cell cycle control (J. W. Gober, unpublished results). An oligonucleotide corresponding to the sequences between - 81 and - 122 (oligonucleotide I) specifically bound two proteins in crude cell extracts, a 95,000 M, protein and a protein of (I) approximately 55,000 M,. The oligonucleotide used to detect the two binding proteins has both a conserved ftr element and adjacent inverted repeats (Fig. 1). The proteins apparently recognize the ftr element since oligonucleotide II (- 103 to - 122) was able to compete with oligonucleotide I, whereas oligonucleotide III (-90 to - 104) did not. Binding activity to labeled oligonucleotide II in a Southwestern assay was weak and only the 95,000 M, protein was detected. It is likely that the context of the binding site influences the affinity of binding. Because the 55,000 M, protein bound weakly to the large oligonucleotide I in the Southwestern assay, we cannot unequivocally state that it does not interact with the smaller oligonucleotide II. The 95,000 M, binding protein has recently been purified to homogeneity and the pure protein binds to theftr region (J. W. Gober, unpublished results). Mutants in jla0 and flaw do not assemble a flagellum and the $a0 and $a W genes are required for the transcriptional activation of several flagellar structural genes including the hook operon (Newton et al., 1989; Xu et al., 1989). It is possible that the j&z0 and flaw gene products are responsible for the temporally regulated binding activity since the transcription of these genes occurs at about the same time in the cell cycle as the hook operon binding activity (Ramakrishnan & Newton, 1989; J. W. Gober & L. Shapiro, unpublished results). The apparent cell cycle control of the binding activity for the ftr region could result from two mechanisms. It could be that the transcription of the gene(s) encoding this binding activity is itself temporally controlled as would be the case for $a0 and jlaW, or that the binding protein(s) are modified in a temporal fashion, allowing binding only at specific times in the cell cycle. In the latter case, genes at a higher level of the hierarchy might control the transition of an inactive to an active form of a DNA binding protein. This is true for the

regulation by the NtrB,C proteins (Ninfa et al., 1987; Keener & Kustu, 1988), as well as other twocomponent regulatory systems that respond to environmental signals by transient phosphorylation (Weiss & Magasanik, 1988; Kustu et al., 1989; Stock et al., 1989; Albright et al., 1989). The $bD gene, which lies downstream from $a0 in an operon and is known to be required for the positive control of hook operon expression, shows homology to pro teins in the response regulator class of twocomponent regulatory systems (Ramakrishnan & Newton, 1990). Surprisingly, extracts prepared from cells with a Tn5 insertion in jlbD possess wild-type binding activity to the ftr region of the hook operon promoter (Fig. 7). It is possible that FlbD binding activity cannot be detected under our assay conditions. It is also conceivable that FlbD does not bind DNA but acts in concert with DNA binding proteins in order to accomplish transcriptional activation. The combinatorial use of transcription factors may be an important mechanism in Caulobacter to regulate the expression of various $a genes that share subsets of homologous regulatory sequences, yet are transcribed in a temporal sequence. This investigation was supported by U.S. Public Health Service grant GM32566 from the National Institutes of Health. J.W.G. is a fellow of the Helen Hay Whitney Foundation. A.D. received predoctoral support from Public Health Service Training grant GM0749107.

References Albright, L. M., Huala, E. & Ausubel, F. M. (1989). Annu. Rev. Genet. 23, 311-336. Baker, B. S. (1989). Nature (London), 340, 521-524. Bellofatto, V., Shapiro, L. $ Hodgson, D. (1984). Proc. Nat. Acd Sci., U.S.A. 81, 1035-1039. Blau, H. M. (1988). Cell, 53, 673-674. Bryan, R., Purucker, M., Gomes, S. L., Alexander, W. & Shapiro, L. (1984). Proc. Nat. Acad. Sci., U.S.A. 81,

1341-1345. Bryan, R., Glaser, D. & Shapiro, L. (1990). In Genetic Regulatory Hierarchies in Development (Scandalios, J. G. & Wright, T. R. F., eds), pp 1-31, Academic Press, San Diego. Champer, R., Bryan, R., Gomes, S. L., Purucker, M. & Shapiro, L. (1985). Cold Spring Harbor Symp. Quant. Biol. JO, 831840. Champer, R., Dingwall, A. & Shapiro, L. (1987). J. Mol. Biol. 194, 71-80. Chen, L. S., Mullin, D. & Newton, A. (1986). Proc. Nat. Acad. Sci., U.S.A. 83, 2860-2864. Contreras, I., Shapiro, L. & Henry, S. (1978). J. Bucteriol. 135, 1130-1136. Contreras, I., Bender, R., Weissborn, A., Amemiya, K., Mansour, J., Henry, S. t Shapiro, L. (1980). J. Mol. Biol. 138, 401-409. Ditta, G., Stanfield, S., Corbin, D. & Helinski, D. R. (1980). Proc. Nat. Acad. Sci., U.S.A. 77, 7347-7351. Ely, B. t Ely, T. W. (1989). Genetics, 123, 649-654. Evinger, M. & Agabian, N. (1977). J. Bacterial. 132, 294-301. Gober, J. W. t Shapiro, L. (1990). Genes Develop. 4, 1494-1504. Gomes, S. L. & Shapiro, L. (1984). J. MOE. Biol. 178, 551-568.

Temporal

Control of Caulobacter

Hahnenberger, K. M. (1987). Ph.D. dissertation, Albert Einstein College of Medicine. Hahnenberger, K. M. & Shapiro, L. (1987). J. Mol. Biol. 194, 91-103. Herskowitz, I. (1989). Nature (London), 342, 749-757. Ingham, P. W. (1988). Nature (London), 335, 25-34. Irwin, N. & Ptashne, M. (1987). Proc. Nat. Acud. Sci., U.S.A. 84, 8315-8319. Kaplan, J. B., Dingwall, A., Bryan, R., Champer, R. t Shapiro, L. (1989). J. Mo2. Biol. 205, 71-83. Keener, J. & Kustu, S. (1988). Proc. Nat. Acad. Sci., U.S.A. 85, 4976-4980. Komeda, Y. (1982). J. Bacterial. 150, 16-26. Komeda, Y. (1986). J. BacterioZ. 168, 1315-1318. Kroos, L. & Kaiser, D. (1987). Genes Develop. 1, 840-854. Kunkel, T. A. & Roberts, J. D. (1987). Methods Enzymol. 154, 367-382. Kustu, S., Santero, E., Keener, J., Popham, D. & Weiss, D. (1989). Microbial. Rev. 53, 367-376. Loewy, Z. G., Bryan, R. A., Reuter, S. H. & Shapiro, L. (1987). Genes Develop. 1, 626-635. Losick, R., Kroos, L., Errington, J. & Youngman, P. (1989). In Genetics of Bacterial Diversity (Hopwood, D. A. & Chater, K. F., eds), pp. 221-240, Harcourt Brace Jovanovich, London. Maniatis, T., Fritsch, E. F. t Sambrook, J. (1982). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Mansour, H., Henry, S. & Shapiro, L. (1980). J. Bacterial. 141, 262-269. Marsh, J. L., Erfle, M. & Wykes, E. J. (1984). Gene, 32, 481-485. Minnich, S. A. t Newton, A. (1987). Proc. Nat. Acad. Sci., U.S.A. 84, 1142-1146. Miskimins, W. K., Roberts, M. P., McClelland, A. &

Edited

Flagellar

Genes

Ruddle, F. H. (1985). Proc. Nat. Acad. Sci., U.S.A. 82, 6741-6744. Mullin, D. A. & Newton, A. (1989). J. Bacterial. 171, 3218-3227. Mullin, D. A., Minnich, S., Chen, L.-S. & Newton, A. (1987). J. Mol. BioZ. 195, 939-943. Newton, A., Ohta, N., Ramakrishnan, G., Mullin, D. & Raymond, G. (1989). Proc. Nat. Acad. Sci., U.S.A. 86, 6651-6655. Ninfa, A. J., Reitzer, L. J. & Magasanik, B. (1987). Cell, 50, 1039-1046. Ninfa, A. J., Mullin, D. A., Ramakrishnan, G. & Newton, A. (1989). J. Bacterial. 171, 383-391. Ohta. N., Chen, L. S., Swanson, E. & Newton, A. (1985). J. Mol. BioZ. 186, 107-115. Osley, M. A. & Newton, A. (1977). Proc. Na,t. Acad. Sci., U.S.A. 74, 124-128. Ramakrishnan, G. & Newton, A. (1989). Annual Meeting American Society Microbiology, H147, p. 194, Amer. Sot. Microbial. Washington, DC. Ramakrishnan, G. t Newton, A. (1990). Proc. Nat. Acad. Sci., U.S.A. 87, 2369-2373. Reitzer, L. J. & Magasanik, B. (1986). Cell, 45, 785792. Shapiro, L., Mansour, J., Shaw, P. & Henry, S. (1982). J. MoZ. BioZ. 159, 303-322. Sheffery, M. & Newton, A. (1981). CeZZ,24, 49-57. Stock, J. B., Ninfa, A. J. & Stock, A. M. (1989). Bacterial. Rev. 53, 450-490. Villeneuve, A. & Meyer, B. (1990). In Genetic Regulatory Hierarchies in Development (Scandalios, J. G. & Wright, T. R. F., eds), pp. 117-188, Academic Press, San Diego. Weiss, V. & Magasanik, B. (1988). Proc. Nat. Acad. Sci., U.S.A. 85, 8919-8923. Xu, H., Dingwall, A. & Shapiro, L. (1989). Proc. Nat. Acad. Sci., U.S.A. 86, 6656-6660.

by N.-H.

Chua