- Email: [email protected]
Identification of key amino acid differences between Cyrtorhinus lividipennis and Nilaparvata lugens nAChR α8 subunits contributing to neonicotinoid sensitivity
Neuroscience Letters 589 (2015) 163–168
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Research article
Identification of key amino acid differences between Cyrtorhinus lividipennis and Nilaparvata lugens nAChR ␣8 subunits contributing to neonicotinoid sensitivity Beina Guo a,1 , Yixi Zhang a,1 , Xiangkun Meng a , Haibo Bao a,b , Jichao Fang b , Zewen Liu a,∗ a Key Laboratory of Integrated Management of Crop Diseases and Pests (Ministry of Education), College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China b Institute of Plant Protection, Jiansu Academy of Agricultural Sciences, Nanjing 210014, China
h i g h l i g h t s • • • • •
Neonicotinoids showed high toxicity to Cyrtorhinus lividipennis. A novel nAChR subunit Cl␣8 was cloned from Cyrtorhinus lividipennis. Key amino acid differences were found between Cl␣8 and Nilaparvata lugens ␣8. One different residue contributed to neonicotinoid sensitivity directly. One residue influenced sensitivity by enhancing direct effect of the other.
a r t i c l e
i n f o
Article history: Received 29 August 2014 Received in revised form 10 December 2014 Accepted 16 January 2015 Available online 20 January 2015 Keywords: Cyrtorhinus lividipennis Neonicotinoid selectivity Nicotinic acetylcholine receptor ␣8 subunit
a b s t r a c t High sensitivity to neonicotinoid insecticides have been reported in the miridbug Cyrtorhinus lividipennis, an important predatory enemy of rice planthoppers, such as Nilaparvata lugens (brown planthopper). In the present study, the sensitivity of neonicotinoid insecticides between C. lividipennis and N. lugens were detected and compared. The results showed that neonicotinoid insecticides were much more toxic to the miridbug than to the brown planthopper. A nicotinic acetylcholine receptor subunit was cloned from the miridbug and denoted as ␣8 subunit (Cl␣8) according to sequence similarities and important functional motifs. Key amino acid differences were found in specific loops from ␣8 subunits between C. lividipennis (Cl␣8) and N. lugens (Nl␣8). In order to understand the roles of key amino acid differences in insecticide sensitivities, the different amino acid residues in specific loops of Nl␣8 were introduced into the corresponding sites in Cl␣8 to construct several subunit mutants. Cl␣8 or subunit mutants were coexpressed with rat 2 to obtain the functional receptors in Xenopus oocytes. The single mutation N191F in loop B reduced imidacloprid sensitivity, with EC50 value in Cl␣8N191F /2 of 15.21 M and 5.74 M in Cl␣8/2. Interestingly, although the single mutation E240T in loop C did not cause the significant change in imidacloprid sensitivity, it could enhance the effects of N191F and cause more decrease in imidacloprid sensitivity. The results indicated that E240T might contribute to neonicotinoid sensitivity in an indirect way. © 2015 Elsevier Ireland Ltd. All rights reserved.
1. Introduction With the development of agriculture science and technology, a variety of pest control methods are available, such as chemi-
∗ Corresponding author at: Tongwei Road 6, Nanjing 210095, PR China. Tel.: +86 25 84399051; fax: +86 25 84399051. E-mail address: [email protected] (Z. Liu). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.neulet.2015.01.046 0304-3940/© 2015 Elsevier Ireland Ltd. All rights reserved.
cal control, biological control, physical control and remote sensing [1]. Chemical and biological controls have been studied by many researchers, especially for two species predator–prey system or three-specie food chain system [2–4]. Chemical insecticides are considered useful because they can quickly wipe out a significant portion of pest population. However, the overuse of chemical insecticides causes many ecological and environmental problems and becomes a big health hazard to human being and natural enemies. Thus, in many cases, the biological and chemical control methods should be considered together for a better balance [5,6].
164
B. Guo et al. / Neuroscience Letters 589 (2015) 163–168
In previous researches, the brown planthopper outbreaks appeared to be prevented by predation of Cyrtorhinus lividipennis (Reuter) (Hemiptera: Miridae) [7,8], Microvelia douglasi atrolineata Bergroth (Hemiptera: Veliidae) [9] and spiders [10,11] in tropical rice without insecticides. Among several predators reported on rice hoppers, the green miridbug, C. lividipennis, is widely distributed in rice fields and plays important roles in biological controls against rice planthoppers. As the dominant predator in the irrigated rice, C. lividipennis mainly preyed on both eggs and young nymphs of rice planthoppers [11]. A predator nymph consumed an average of 7.5 eggs or 1.4 hoppers per day for a period of 14 days. Adults consumed about 10.2 eggs or 4.7 nymphs or 2.4 adults per day for a period of 10 days [12]. However, the irrational use of insecticides has led to the strong lethality to C. lividipennis. High sensitivity to neonicotinoid insecticides have been reported previously in C. lividipennis, in a laboratory study, and under field conditions [13,14]. Previous studies found that neonicotinoid insecticides like imidacloprid (selectivity ratio = 0.05) and clothianidin (selectivity ratio = 0.02) have no selectivity between C. lividipennis and Nilaparvata lugens, and C. lividipennis was more sensitive to these insecticides [15]. In addition, the sublethal dose of the neonicotinoid insecticides significantly impacted the egg hatchability, predacious number and fecundity of C. lividipennis [14,16]. Nicotinic acetylcholine receptors (nAChRs), the targets of neonicotinoid insecticides [17,18], are receptors of acetylcholine, the neurotransmitter of synaptic transmission in the nervous systems of insects [19]. The binding site for neurotransmitter or other agonist ligand exists on the interface of the N-terminal domains of two adjacent subunits [18,20]. Amino acid mutations located in 6 loops (loop A–C from ␣ subunit and loop D–F from  subunit) which constitute the binding pocket have been reported to associate with resistance to neonicotinoids in various insect species [21,22]. For example, mutations in these loops of insect ␣ subunits and  subunits were reported to be involved in neonicotinoid resistance insecticides in Myzus persicae, Aphis gossypii, N. lugens and Drosophila melanogaster [23–28]. Thus, researches on these domains of nAChR subunits are significantly important for the insecticide sensitivity and target resistance in insects. High sensitivity to neonicotinoid insecticides of C. lividipennis was well-documented, but there is little information and knowledge about the possible molecular mechanism. In this study, the toxicity of neonicotinoid insecticides to C. lividipennis and N. lugens was compared. The trials to understand the different toxicity between two insect species were performed through the comparison of insecticide sensitivities on nAChRs from two species.
2. Materials and methods
2.2. Chemicals Acetylcholine, Imidacloprid and Clothianidin were purchased from Sigma–Aldrich (St. Louis, MO, USA) 2.3. Contact acute toxicity (LC50 ) and selectivity assessment The contact acute toxicity was tested according to the method described by Preetha et al. [15]. Glass scintillation vials (15 ml) were coated with 0.5 ml of tested insecticide and rolled until no drops were seen on the glass wall to insure the uniformity of insecticide membrane. The vials were air dried for 1 h to allow all the acetone to evaporate before introducing the tested insects. A pre-experiment was performed to estimate the range of insecticide concentrations. Then five proper concentrations were selected with 10–90% mortalities. Acetone alone was used as the control. Approximately 30 tritonymphs of uniform size insects (miridbug/BPH) were introduced into the treated vials and the mouth was covered with double gauze. After 3 h exposure, the tested nymphs were transferred into a plastic cup containing fresh rice plants pre-oviposited by BPH for miridbugs and rice plants only for BPH. The mortalities were recorded in 48 h after treatments and the mortality in each treatment was corrected by Abbott formula. The data obtained was analyzed using software Polo. Selectivity ratio was calculated as described previously [13] using the following formula: Selectivityratio = LC50 ofbeneficialspecies/LC50 ofpestspecies The insecticide is selective when the value is >1 and nonselective when the value is ≤1. 2.4. Molecular cloning of Cl˛8 Total RNA was isolated from approximately 10 C. lividipennis using TRIzol® reagent (Invitrogen, Life Technologies, Carlsbad, CA, USA). Specific primers (5 GSP: GTAATTGGACAGCAGATCGTCGTACAGCC; 3 GSP: GGAGTCTGGGT ACGTCAATGATGGG) were designed according to the unigene (CL1597.Contig1) from a transcriptome to obtain the full length by RACE technique using GeneRacerTM (Invitrogen). The amplified product was separated by the agarose gel electrophoresis and purified using Wizard PCR Preps DNA Purification System (Promega, Madison, WI, USA). Purified DNA was ligated into the pGEM-T Easy vector (Promega) and several independent sub-clones were sequenced from both directions. Sequence homology was determined using the NCBI BLAST online services at http://www.ncbi.nlm.nih.gov/BLAST. Protein alignments were performed using the ClustalW program (http://www.ebi.ac.uk/services/).
2.1. Insects
2.5. Expression and electrophysiological recording in Xenopus oocyte
The field populations of the brown planthopper (BPH) and the green miridbug were collected from the same rice field in Nanning (Guangxi) in July 2013. The susceptible strain of BPH was original collected from Taizhou (Zhejiang) in August 2003 and reared in the laboratory without the contact of any insecticides. The susceptible strain of the green miridbug was originally collected from Taizhou (Zhejiang) in July 2007 and reared in the laboratory without the contact of any insecticides. Uniform sized BPH were selected and reared on rice plants kept in the illumination incubator. Rice plants pre-oviposited by BPH were used to rear miridbugs. Adult green miridbug were inoculated to these plants and confined for 2–3 days for the oviposition to obtain nymphs with specific ages. All plants and insects were maintained at 26 ± 1 ◦ C, 75 ± 5% RH in the illumination incubator.
The N. lugens Nl␣8 (FJ481979) and Rattus norvegicus subunit rat 2 (L31622) were subcloned into the expression vector pGH19 as described previously [29,30]. Cl␣8 was subcloned into vector pGH19 at EcoRI and XbaI sites. Cl␣8 mutants (Cl␣8N191F , Cl␣8E240T and Cl␣ N191F/E240T ) were constructed by the overlap extension PCR using QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA). Subunit cRNAs were generated using the mMESSAGE mMACHINE T7 transcription kit (ABI-Ambion, Foster, CA, USA). Xenopus oocyte preparation and cRNA injection were performed as described previously [29]. Electrophysiological recordings were made using a two-electrode voltage clamp (Multiclamp 700B Amplifier; Axon Instruments, Foster, CA, USA) as previously described [29].
B. Guo et al. / Neuroscience Letters 589 (2015) 163–168
165
Table 1 Comparison of insecticide toxicities against field populations and susceptible strains of Cyrtorhinus lividipennis and Nilaparvata lugens. Insecticides
Insects
LC50 (95% CL) mg/l
Slope
Selectivity ratio
Imidacloprid
C. lividipennis N. lugens C. lividipennis* N. lugens*
0.9624 (0.7240–1.2794) 16.5040 (12.6132–21.5949) 0.1038 (0.0922–0.1194) 1.2766 (1.1015–1.5821)
1.1319 1.1503 2.5349 2.0731
0.0583
C. lividipennis N. lugens C. lividipennis* N. lugens*
0.4736 (0.3625–0.6187) 3.6081 (2.8203–4.6158) 0.0624 (0.0571–0.0693) 0.4449 (0.4116–0.4812)
1.2354 1.3508 2.3950 2.2727
0.1313
Thiacloprid
C. lividipennis N. lugens
0.2038 (0.1823–0.2355) 5.9225 (4.6702–7.7310)
1.5223 1.2704
0.0344
Dinotefuran
C. lividipennis N. lugens
0.3639 (0.3250–0.4118) 0.7142 (0.5716–0.8824)
1.7924 1.4336
0.5095
Clothianidin
0.0813
0.1403
The field populations of Cyrtorhinus lividipennis and Nilaparvata lugens were collected from the same rice field in Nanning (Guangxi) in July 2013. The asterisk (*) showed the data for the susceptible strains of two insects.
2.6. Statistical analysis Differences in responses (currents), Imax and EC50 values were analyzed by one-way ANOVA with at least three repeats (different batches of oocytes from different frogs). Multiple comparisons between the groups were performed using S–N–K method. The level of significance for results was set at p < 0.05. 3. Result 3.1. Contact toxicity and selectivity The toxicities of 4 neonicotinoid insecticides against C. lividipennis and N. lugens populations (tritonymphs) from the same field were tested (Table 1). The results showed that the acute contact toxicities of neonicotinoid insecticides to C. lividipennis were significantly higher than that to N. lugens. The selectivity ratios for thiacloprid, imidacloprid and clothianidin were much less than 1 (0.034, 0.058 and 0.131), which indicated that these three insecticides had no selectivities between BPH and the nature enemy, green miridbug. By contrast, dinotefuran had the selectivity ratio of 0.510 and showed the comparable toxic to C. lividipennis and N. lugens. The much lower toxicity of neonicotinoid insecticides against N. lugens than C. lividipennis might be because of high imidacloprid resistance in N. lugens field population and cross-resistances to thiacloprid and clothianidin. In order to evaluate this possibility, the toxicity comparison was also performed in the susceptible strains of N. lugens and C. lividipennis. The results showed the selectivity ratios for imidacloprid and clothianidin were 0.081 and 0.140 (Table 1), which were close to the values tested in the field populations. 3.2. Cloning of C. lividipennis nAChR ˛8 subunit (Cl˛8) The full sequence of ␣8 subunit (Cl␣8, KJ747359) was isolated from C. lividipennis with specific primers PCR and RACE technique. The nucleotide sequence revealed an open reading frame (ORF) of 546 amino acids with features typical of a nAChR ␣ subunit (Fig. S1), such as conserved residues within loops A, B and C involved in ligand binding, four conserved transmembrane regions (TM1–TM4) and a variable intracellular region between TM3 and TM4. The subunit demonstrates high similarities with other insect nAChR subunits and most closely resembles ␣8 subunit (Fig. S2). Although high similarity (75.9%) was found between Cl␣8 and Nl␣8 from N. lugens, two amino acid differences were found within loop B and loop C between Cl␣8 and Nl␣8, which were N191F and E240T (Fig. 1).
Supplementry material related to this article found, in the online version, at http://dx.doi.org/10.1016/j.neulet.2015.01.046. 3.3. Influence of key amino acid differences on imidacloprid sensitivity Functional nAChRs were detected when Cl␣8 was co-expressed with the rat 2 subunit, which was consistent with Nl␣8, nAChR ␣8 subunit of N. lugens [31]. Maximal agonist-induced responses in oocytes expressing Cl␣8/2 nAChRs were obviously bigger than that of Nl␣8/2 (Fig. 2a). All responses elicited by either acetylcholine or imidacloprid were dose-dependent (Fig. 2b and c). The maximal agonist response (Imax ) detected with imidacloprid in oocytes expressing Nl8/2 nAChRs was 11.56 ± 2.27 nA, with 19.44 ± 3.15 for Cl␣8/2 (Fig. 3). The receptors Cl␣8/2 (EC50 = 5.74 ± 0.92 M) were more sensitive to imidacloprid than Nl␣8/2 (66.59 ± 8.33 M). In order to evaluate the effects of key amino acid differences on agonist potencies, mutations N191F and E240T were introduced into Cl␣8 singly or together to construct mutants Cl␣8N191F , Cl␣8E240T and Cl␣8N191F/E240T . Comparisons of Cl␣8N191F /2 and Cl␣8/2 nAChRs expressed in oocytes revealed that the Cl␣8N191F mutation caused a significant rightward shift in the agonist doseresponse curve for imidacloprid (2.65-fold; Fig. 2d). In contrast, E240T did not cause the significant influence on EC50 values of ACh and imidacloprid (Fig. 3). However, E240T caused a further rightward shift in the agonist dose-response curve for imidacloprid on Cl␣8N191F/E240T /2, compared to Cl␣8N191F /2. 4. Discussion Neonicotinoids were found with high contact toxicities to the predator, C. lividipennis and have no obvious selectivities between pests and the predator [14,15,32]. The present study showed that imidacloprid, clothianidin and thiacloprid were non-selective and high toxic to C. lividipennis than to N. lugens collected from the same rice fields in Nanning (Guangxi, China). Such toxicity difference might be from the high imidacloprid resistance and cross-resistance to clothianidin and thiacloprid in N. lugens field populations, because high imidacloprid resistances were often reported recently in China [33]. However, the toxicities of imidacloprid and clothianidin against the susceptible strains for both C. lividipennis than N. lugens clearly showed that the sensitivity difference was because of different insect species, but not mainly from insecticide resistance in N. lugens. The high toxicity of neonicotinoids against C. lividipennis made us to find more safe ways to apply neonicotinoids and protect this nature enemy. Some
166
B. Guo et al. / Neuroscience Letters 589 (2015) 163–168
Fig. 1. Sequences alignment of Cyrtorhinus Lividipennis Cl␣8 and Nilaparvata lugens Nl␣8. Loops A–C, important to agonist binding site in nAChR ␣ subunit, are underlined. In loop B and C, the amino acid residues different between Cl␣8 and Nl␣8 subunits are marked by asterisks. The identical amino acid residues are showed by dots in Cl␣8 sequence.
studies showed that C. lividipennis adult and nymph were sensitive to thiamethoxam and imidacloprid, while the egg was less sensitive [14]. Besides that, low doses of imidacloprid can reduce the predation rate of adults of C. lividipennis, inducing the resurgence of N. lugens [34]. Given all of these results, using neonicotinoids during the egg stage of C. lividipennis in rice fields if possibly may protect it and increase the selectivity of insecticides. The sensitivity mechanisms of neonicotinoids against C. lividipennis than N. lugens might include metabolic factors and target differences. The preliminary bioassay led us to suspect target sensitivity of C. lividipennis was related to its high sensitivity to imidacloprid. In order to evaluate whether the neonicotinoid
sensitivity difference may also from target differences between C. lividipennis than N. lugens, sequence differences in a key subunit (␣8) of nAChRs were compared and identified. The subunit Cl␣8 was considered to play an important role in imidacloprid binding in C. lividipennis, an insect belongs to Hemiptera as well as N. lugens. Studies have demonstrated that Nl␣8 was involved in the receptor for the higher affinity binding site of imidacloprid in N. lugens [31]. The presence of very high-affinity imidacloprid binding sites in hemipteran insects were believed to be the cause why imidacloprid is particularly useful in controlling insect pests from the insect order Hemiptera [35,36]. Despite the high similarity between Cl␣8 and Nl␣8, two amino acid differences were found
Fig. 2. Representative whole-cell responses and agonist dose–response curves from hybrid nAChRs expressed in Xenopus oocytes. (a) Representative responses elicited by acetylcholine and imidacloprid. (b) Dose–response curves for acetylcholine on Nl␣8/r2 and Cl␣8/r2. (c) Dose–response curves for imidacloprid on Nl␣8/r2 and Cl␣8/r2. (d) Dose–response curves for imidacloprid on receptors with Cl␣8 or Cl␣8 mutant plus r2. Data are means of at least five independent experiments.
B. Guo et al. / Neuroscience Letters 589 (2015) 163–168
167
Fig. 3. Imax and EC50 values of acetylcholine and imidacloprid on hybrid nAChRs containing 2 plus insect ␣8 subunit in Xenopus oocytes. (A) Multiple comparisons of EC50 values for each drug among different receptors. (B) Multiple comparisons of Imax values for each drug among different receptors. The asterisk (*) and double asterisk (**) above each line indicated the significant difference between two receptors connected by the line at 0.05 and 0.01 levels. Data are means of at least three independent experiments ± SEM.
within loops B (N191F) and C (E240T). Because of the importance of amino acid residues with loops on neonicotinoid sensitivities [26–28,37], N191F and E240T might also be important in neonicotinoid sensitivities between C. lividipennis than N. lugens. Functional nAChRs were detected when Cl␣8 was co-expressed with the rat 2 subunit. The mutations N191F and E240T were introduced into Cl␣8 singly or together to construct mutants Cl␣8N191F , Cl␣8E240T and Cl␣8N191F/E240T , which then was coexpressed with r2. As the previous report on Y151S mutation in N. lugens ␣ subunits [26,29], all mutations had little effects on agonist potencies of acetylcholine. In contrast, the single mutation N191F in loop B and the double mutation N191F/E240T caused the significant decrease in imidacloprid potencies, reflecting in the increase of EC50 values. It was worth noting that the mutation E240T had little effect on agonist potency of imidacloprid, but it could enhance the effects of N191F and cause more decrease in imidacloprid sensitivity on receptor Cl␣8N191F/E240T /2 than Cl␣8N191F /2. These results implied that the N191F mutation played key roles in imidacloprid sensitivity on nAChRs in a direct way and E240T mutation contributed to imidacloprid sensitivity in an indirect style. Because of the lack of direct influences on insecticide sensitivities, the influence of mutations like E240T may be ignored when they were studied separately. There might be even more amino acid differences in insect nAChRs or other targets associated with insecticide
sensitivities (resistances) in the way like E240T and the possible indirect effects should be considered. In conclusion, the present results may contribute to our understanding of the molecular mechanism underlying the high neonicotinoid sensitivity on C. lividipennis and suggest the possible target regions for the design of new selective insecticides. Residue changes in loops B and C of Hemipteran insect ␣8 subunits may also lead to a neonicotinoid resistant phenotype because the effects of such changes on ACh potencies are minimal. Acknowledgements This work was supported by National High Technology Research and Development Program of China (863 Program, 2011AA10A207 and 2012AA101502), National Natural Science Foundation of China (31322045, 31130045and 31171869), Jiangsu Science for Distinguished Young Scholars (BK20130028), National Key Technology Research and Development Program(2012BAD19B01). References [1] K.S. Jatav, J. Dhar, Hybrid approach for pest control with impulsive releasing of natural enemies and chemical pesticides: a plant-pest-natural enemy model, Nonlinear Anal. Hybrid Syst. 12 (2014) 79–92.
168
B. Guo et al. / Neuroscience Letters 589 (2015) 163–168
[2] X. Song, Z. Xiang, The prey-dependent consumption two-prey one-predator models with stage structure for the predator and impulsive effects, J. Theor. Biol. 242 (2006) 683–698. [3] Z. Ma, J. Yang, G. Jiang, Impulsive control in a stage structure population model with birth pulses, Appl. Math. Comput. 217 (2010) 3453–3460. [4] W. Wang, L. Chen, A predator-prey system with stage-structure for predator, Comput. Math. Appl. 33 (1997) 83–91. [5] J.R. Beddington, C.A. Free, J.H. Lawton, Characteristics of successful natural enemies in models of biological control of insect pests, Nature 273 (1978) 513–519. [6] P. DeBach, D. Rosen, Biological Control by Natural Enemies, Cambridge University Press, 1991. [7] P.E. Kenmore, Ecology and Outbreaks of a Tropical Insect Pest of the Green Revolution, the Rice Brown Planthopper, Nilaparvata lugens (Stål), University of California, Berkeley, 1980. [8] P.E. Kenmore, F. Carino, C. Perez, V.A. Dyck, A. Gutierrez, Population regulation of the rice brown planthopper (Nilaparvata lugens Stål) within rice fields in the Philippines, J. Plant Protect. Trop. 1 (1984) 19–37. [9] F. Nakasuji, V. Dyck, Evaluation of the role of Microvelia douglasi atrolineata (Bergroth)(Heteroptera: Veliidae) as predator of the brown planthopper Nilaparvata lugens (Stål)(Homoptera: Delphacidae), Res. Popul. Ecol. 26 (1984) 134–149. [10] S. Sahu, R. Singh, P. Kumar, Host preference and feeding potential of spiders predaceous on insect pests of rice, J. Entomol. Res. (New Delhi) 20 (1996) 145–150. [11] L. Sigsgaard, Early season natural control of the brown planthopper, Nilaparvata lugens: the contribution and interaction of two spider species and a predatory bug, Bull. Entomol. Res. 97 (2007) 533–544. [12] T. Reyes, B. Gabriel, The life history and consumption habits of Cyrtorhinus lividipennis Reuter (Hemiptera: Miridae), Philip. Entomol. 3 (1975) 79–88. [13] K. Tanaka, S. Endo, H. Kazano, Toxicity of insecticides to predators of rice planthoppers: spiders, the mirid bug and the dryinid wasp, Appl. Entomol. Zool. 35 (2000) 177–187. [14] V. Jhansi Lakshmi, N.V. Krishnaiah, I.C. Pasalu, T. Lingaiah, K. Krishnaiah, Safety of thiamethoxam to Cyrtorhinus lividipennis Reuter (Hemiptera: Miridae), a predator of brown planthopper, Nilaparvata lugens (Stål) in rice, J. Biol. Control 15 (2001) 53–58. [15] G. Preetha, J. Stanley, S. Suresh, R. Samiyappan, Risk assessment of insecticides used in rice on miridbug Cyrtorhinus lividipennis Reuter, the important predator of brown planthopper, Nilaparvata lugens (Stål.), Chemosphere 80 (2010) 498–503. [16] R. Suvaparp, Effects of Sublethal Doses of Insecticides on the Mirid Predator, Cyrtorhinus lividipennis (Reuter)(Heteroptera:Miridae), Kasetsart University, 1993. [17] R. Nauen, I. Denholm, Resistance of insect pests to neonicotinoid insecticides: current status and future prospects, Arch. Insect Biochem. Physiol. 58 (2005) 200–215. [18] N. Millar, I. Denholm, Nicotinic acetylcholine receptors: targets for commercially important insecticides, Invertebrate Neurosci. 7 (2007) 53–66. [19] H. Breer, D.B. Sattelle, Molecular properties and functions of insect acetylcholine receptors, J. Insect Physiol. 33 (1987) 771–790. [20] N. Unwin, Refined structure of the nicotinic acetylcholine receptor at 4 angstrom resolution, J. Mol. Biol. 346 (2005) 967–989. [21] C. Gotti, F. Clementi, Neuronal nicotinic receptors: from structure to pathology, Prog. Neurobiol. 74 (2004) 363–396. [22] M. Shimomura, M. Yokota, K. Matsuda, D.B. Sattelle, K. Komai, Roles of loop C and the loop B–C interval of the nicotinic receptor at subunit in its selective interactions with imidacloprid in insects, Neurosci. Lett. 363 (2004) 195–198.
[23] X. Yao, F. Song, F. Chen, Y. Zhang, J. Gu, S. Liu, Z. Liu, Amino acids within loops D, E and F of insect nicotinic acetylcholine receptor  subunits influence neonicotinoid selectivity, Insect Biochem. Mol. Biol. 38 (2008) 834–840. [24] C. Bass, A.M. Puinean, M. Andrews, P. Cutler, M. Daniels, J. Elias, V.L. Paul, A.J. Crossthwaite, I. Denholm, L.M. Field, S.P. Foster, R. Lind, M.S. Williamson, R. Slater, Mutation of a nicotinic acetylcholine receptor beta subunit is associated with resistance to neonicotinoid insecticides in the aphid Myzus persicae, BMC Neurosci. 12 (2011) 51. [25] H.N. Koo, J.J. An, S.E. Park, J.I. Kim, G.H. Kim, Regional susceptibilities to 12 insecticides of melon and cotton aphid, Aphis gossypii (Hemiptera: Aphididae) and a point mutation associated with imidacloprid resistance, Crop Protect. 55 (2014) 91–97. [26] Z. Liu, M.S. Williamson, S.J. Lansdell, I. Denholm, Z. Han, N.S. Millar, A nicotinic acetylcholine receptor mutation conferring target-site resistance to imidacloprid in Nilaparvata lugens (brown planthopper), Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 6. [27] T. Perry, D.G. Heckel, J.A. McKenzie, P. Batterham, Mutations in D alpha 1 or D beta 2 nicotinic acetylcholine receptor subunits can confer resistance to neonicotinoids in Drosophila melanogaster, Insect Biochem. Mol. Biol. 38 (2008) 520–528. [28] T. Perry, J.Q. Chan, P. Batterham, G.B. Watson, C.X. Geng, T.C. Sparks, Effects of mutations in Drosophila nicotinic acetylcholine receptor subunits on sensitivity to insecticides targeting nicotinic acetylcholine receptors, Pest. Biochem. Physiol. 102 (2012) 56–60. [29] Z. Liu, M.S. Williamson, S.J. Lansdell, Z. Han, I. Denholm, N.S. Millar, A nicotinic acetylcholine receptor mutation (Y151S) causes reduced agonist potency to a range of neonicotinoid insecticides, J. Neurochem. 99 (2006) 1273–1281. [30] R. Nauen, U. Ebbinghaus-Kintscher, A. Elbert, P. Jeschke, K. Tietjen, Acetylcholine receptors as sites for developing neonicotinoid insecticides, in: I. Ishaaya (Ed.), Biochemical Sites of Insecticide Action and Resistance, Springer, 2001, pp. 77–105. [31] Y. Zhang, Z. Liu, Z. Han, F. Song, X. Yao, Y. Shao, J. Li, N.S. Millar, Functional co-expression of two insect nicotinic receptor subunits (Nl␣3 and Nl␣8) reveals the effects of a resistance-associated mutation (Nl␣3Y151S ) on neonicotinoid insecticides, J. Neurochem. 110 (2009) 1855–1862. [32] G. Katti, I. Pasalu, A. Padmakumari, C. Padmavathi, V. Jhansilakshmi, V. Krishnaiah, J. Bentur, J. Prasad, Y. Rao, Biological control of insect pests of rice, in: R. Hyderabad (Ed.), Technical Bulletin, Directorate of Rice Research, India, 2007, p. 22. [33] Z. Ding, Y. Wen, B. Yang, Y. Zhang, S. Liu, Z. Liu, Z. Han, Biochemical mechanisms of imidacloprid resistance in Nilaparvata lugens: over-expression of cytochrome P450CYP6AY1, Insect Biochem. Mol. Biol. 43 (2013) 1021–1027. [34] I.N. Widiarta, M. Matsumura, Y. Suzuki, F. Nakasuji, Effects of sublethal doses of imidacloprid on the fecundity of green leafhoppers, Nephotettix spp. (Hemiptera: Cicadellidae) and their natural enemies, Appl. Entomol. Zool. 36 (2001) 501–507. [35] M. Tomizawa, J.E. Casida, Neonicotinoid insecticide toxicology: mechanisms of selective action, Annu. Rev. Pharmacol. Toxicol. 45 (2005) 247. [36] R.J. Lind, M.S. Clough, S.E. Reynolds, F.G.P. Earley, [3 H]Imidacloprid labels high- and low-affinity nicotinic acetylcholine receptor-like binding sites in the aphid Myzus persicae (Hemiptera: Aphididae), Pest. Biochem. Physiol. 62 (1998) 3–14. [37] M. Shimomura, H. Satoh, M. Yokota, M. Ihara, K. Matsuda, D.B. Sattelle, Insect-vertebrate chimeric nicotinic acetylcholine receptors identify a region loop B to the N-terminus of the Drosophila D alpha 2 subunit, which contributes to neonicotinoid sensitivity, Neurosci. Lett. 385 (2005) 168–172.
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Research article
Identification of key amino acid differences between Cyrtorhinus lividipennis and Nilaparvata lugens nAChR ␣8 subunits contributing to neonicotinoid sensitivity Beina Guo a,1 , Yixi Zhang a,1 , Xiangkun Meng a , Haibo Bao a,b , Jichao Fang b , Zewen Liu a,∗ a Key Laboratory of Integrated Management of Crop Diseases and Pests (Ministry of Education), College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China b Institute of Plant Protection, Jiansu Academy of Agricultural Sciences, Nanjing 210014, China
h i g h l i g h t s • • • • •
Neonicotinoids showed high toxicity to Cyrtorhinus lividipennis. A novel nAChR subunit Cl␣8 was cloned from Cyrtorhinus lividipennis. Key amino acid differences were found between Cl␣8 and Nilaparvata lugens ␣8. One different residue contributed to neonicotinoid sensitivity directly. One residue influenced sensitivity by enhancing direct effect of the other.
a r t i c l e
i n f o
Article history: Received 29 August 2014 Received in revised form 10 December 2014 Accepted 16 January 2015 Available online 20 January 2015 Keywords: Cyrtorhinus lividipennis Neonicotinoid selectivity Nicotinic acetylcholine receptor ␣8 subunit
a b s t r a c t High sensitivity to neonicotinoid insecticides have been reported in the miridbug Cyrtorhinus lividipennis, an important predatory enemy of rice planthoppers, such as Nilaparvata lugens (brown planthopper). In the present study, the sensitivity of neonicotinoid insecticides between C. lividipennis and N. lugens were detected and compared. The results showed that neonicotinoid insecticides were much more toxic to the miridbug than to the brown planthopper. A nicotinic acetylcholine receptor subunit was cloned from the miridbug and denoted as ␣8 subunit (Cl␣8) according to sequence similarities and important functional motifs. Key amino acid differences were found in specific loops from ␣8 subunits between C. lividipennis (Cl␣8) and N. lugens (Nl␣8). In order to understand the roles of key amino acid differences in insecticide sensitivities, the different amino acid residues in specific loops of Nl␣8 were introduced into the corresponding sites in Cl␣8 to construct several subunit mutants. Cl␣8 or subunit mutants were coexpressed with rat 2 to obtain the functional receptors in Xenopus oocytes. The single mutation N191F in loop B reduced imidacloprid sensitivity, with EC50 value in Cl␣8N191F /2 of 15.21 M and 5.74 M in Cl␣8/2. Interestingly, although the single mutation E240T in loop C did not cause the significant change in imidacloprid sensitivity, it could enhance the effects of N191F and cause more decrease in imidacloprid sensitivity. The results indicated that E240T might contribute to neonicotinoid sensitivity in an indirect way. © 2015 Elsevier Ireland Ltd. All rights reserved.
1. Introduction With the development of agriculture science and technology, a variety of pest control methods are available, such as chemi-
∗ Corresponding author at: Tongwei Road 6, Nanjing 210095, PR China. Tel.: +86 25 84399051; fax: +86 25 84399051. E-mail address: [email protected] (Z. Liu). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.neulet.2015.01.046 0304-3940/© 2015 Elsevier Ireland Ltd. All rights reserved.
cal control, biological control, physical control and remote sensing [1]. Chemical and biological controls have been studied by many researchers, especially for two species predator–prey system or three-specie food chain system [2–4]. Chemical insecticides are considered useful because they can quickly wipe out a significant portion of pest population. However, the overuse of chemical insecticides causes many ecological and environmental problems and becomes a big health hazard to human being and natural enemies. Thus, in many cases, the biological and chemical control methods should be considered together for a better balance [5,6].
164
B. Guo et al. / Neuroscience Letters 589 (2015) 163–168
In previous researches, the brown planthopper outbreaks appeared to be prevented by predation of Cyrtorhinus lividipennis (Reuter) (Hemiptera: Miridae) [7,8], Microvelia douglasi atrolineata Bergroth (Hemiptera: Veliidae) [9] and spiders [10,11] in tropical rice without insecticides. Among several predators reported on rice hoppers, the green miridbug, C. lividipennis, is widely distributed in rice fields and plays important roles in biological controls against rice planthoppers. As the dominant predator in the irrigated rice, C. lividipennis mainly preyed on both eggs and young nymphs of rice planthoppers [11]. A predator nymph consumed an average of 7.5 eggs or 1.4 hoppers per day for a period of 14 days. Adults consumed about 10.2 eggs or 4.7 nymphs or 2.4 adults per day for a period of 10 days [12]. However, the irrational use of insecticides has led to the strong lethality to C. lividipennis. High sensitivity to neonicotinoid insecticides have been reported previously in C. lividipennis, in a laboratory study, and under field conditions [13,14]. Previous studies found that neonicotinoid insecticides like imidacloprid (selectivity ratio = 0.05) and clothianidin (selectivity ratio = 0.02) have no selectivity between C. lividipennis and Nilaparvata lugens, and C. lividipennis was more sensitive to these insecticides [15]. In addition, the sublethal dose of the neonicotinoid insecticides significantly impacted the egg hatchability, predacious number and fecundity of C. lividipennis [14,16]. Nicotinic acetylcholine receptors (nAChRs), the targets of neonicotinoid insecticides [17,18], are receptors of acetylcholine, the neurotransmitter of synaptic transmission in the nervous systems of insects [19]. The binding site for neurotransmitter or other agonist ligand exists on the interface of the N-terminal domains of two adjacent subunits [18,20]. Amino acid mutations located in 6 loops (loop A–C from ␣ subunit and loop D–F from  subunit) which constitute the binding pocket have been reported to associate with resistance to neonicotinoids in various insect species [21,22]. For example, mutations in these loops of insect ␣ subunits and  subunits were reported to be involved in neonicotinoid resistance insecticides in Myzus persicae, Aphis gossypii, N. lugens and Drosophila melanogaster [23–28]. Thus, researches on these domains of nAChR subunits are significantly important for the insecticide sensitivity and target resistance in insects. High sensitivity to neonicotinoid insecticides of C. lividipennis was well-documented, but there is little information and knowledge about the possible molecular mechanism. In this study, the toxicity of neonicotinoid insecticides to C. lividipennis and N. lugens was compared. The trials to understand the different toxicity between two insect species were performed through the comparison of insecticide sensitivities on nAChRs from two species.
2. Materials and methods
2.2. Chemicals Acetylcholine, Imidacloprid and Clothianidin were purchased from Sigma–Aldrich (St. Louis, MO, USA) 2.3. Contact acute toxicity (LC50 ) and selectivity assessment The contact acute toxicity was tested according to the method described by Preetha et al. [15]. Glass scintillation vials (15 ml) were coated with 0.5 ml of tested insecticide and rolled until no drops were seen on the glass wall to insure the uniformity of insecticide membrane. The vials were air dried for 1 h to allow all the acetone to evaporate before introducing the tested insects. A pre-experiment was performed to estimate the range of insecticide concentrations. Then five proper concentrations were selected with 10–90% mortalities. Acetone alone was used as the control. Approximately 30 tritonymphs of uniform size insects (miridbug/BPH) were introduced into the treated vials and the mouth was covered with double gauze. After 3 h exposure, the tested nymphs were transferred into a plastic cup containing fresh rice plants pre-oviposited by BPH for miridbugs and rice plants only for BPH. The mortalities were recorded in 48 h after treatments and the mortality in each treatment was corrected by Abbott formula. The data obtained was analyzed using software Polo. Selectivity ratio was calculated as described previously [13] using the following formula: Selectivityratio = LC50 ofbeneficialspecies/LC50 ofpestspecies The insecticide is selective when the value is >1 and nonselective when the value is ≤1. 2.4. Molecular cloning of Cl˛8 Total RNA was isolated from approximately 10 C. lividipennis using TRIzol® reagent (Invitrogen, Life Technologies, Carlsbad, CA, USA). Specific primers (5 GSP: GTAATTGGACAGCAGATCGTCGTACAGCC; 3 GSP: GGAGTCTGGGT ACGTCAATGATGGG) were designed according to the unigene (CL1597.Contig1) from a transcriptome to obtain the full length by RACE technique using GeneRacerTM (Invitrogen). The amplified product was separated by the agarose gel electrophoresis and purified using Wizard PCR Preps DNA Purification System (Promega, Madison, WI, USA). Purified DNA was ligated into the pGEM-T Easy vector (Promega) and several independent sub-clones were sequenced from both directions. Sequence homology was determined using the NCBI BLAST online services at http://www.ncbi.nlm.nih.gov/BLAST. Protein alignments were performed using the ClustalW program (http://www.ebi.ac.uk/services/).
2.1. Insects
2.5. Expression and electrophysiological recording in Xenopus oocyte
The field populations of the brown planthopper (BPH) and the green miridbug were collected from the same rice field in Nanning (Guangxi) in July 2013. The susceptible strain of BPH was original collected from Taizhou (Zhejiang) in August 2003 and reared in the laboratory without the contact of any insecticides. The susceptible strain of the green miridbug was originally collected from Taizhou (Zhejiang) in July 2007 and reared in the laboratory without the contact of any insecticides. Uniform sized BPH were selected and reared on rice plants kept in the illumination incubator. Rice plants pre-oviposited by BPH were used to rear miridbugs. Adult green miridbug were inoculated to these plants and confined for 2–3 days for the oviposition to obtain nymphs with specific ages. All plants and insects were maintained at 26 ± 1 ◦ C, 75 ± 5% RH in the illumination incubator.
The N. lugens Nl␣8 (FJ481979) and Rattus norvegicus subunit rat 2 (L31622) were subcloned into the expression vector pGH19 as described previously [29,30]. Cl␣8 was subcloned into vector pGH19 at EcoRI and XbaI sites. Cl␣8 mutants (Cl␣8N191F , Cl␣8E240T and Cl␣ N191F/E240T ) were constructed by the overlap extension PCR using QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA). Subunit cRNAs were generated using the mMESSAGE mMACHINE T7 transcription kit (ABI-Ambion, Foster, CA, USA). Xenopus oocyte preparation and cRNA injection were performed as described previously [29]. Electrophysiological recordings were made using a two-electrode voltage clamp (Multiclamp 700B Amplifier; Axon Instruments, Foster, CA, USA) as previously described [29].
B. Guo et al. / Neuroscience Letters 589 (2015) 163–168
165
Table 1 Comparison of insecticide toxicities against field populations and susceptible strains of Cyrtorhinus lividipennis and Nilaparvata lugens. Insecticides
Insects
LC50 (95% CL) mg/l
Slope
Selectivity ratio
Imidacloprid
C. lividipennis N. lugens C. lividipennis* N. lugens*
0.9624 (0.7240–1.2794) 16.5040 (12.6132–21.5949) 0.1038 (0.0922–0.1194) 1.2766 (1.1015–1.5821)
1.1319 1.1503 2.5349 2.0731
0.0583
C. lividipennis N. lugens C. lividipennis* N. lugens*
0.4736 (0.3625–0.6187) 3.6081 (2.8203–4.6158) 0.0624 (0.0571–0.0693) 0.4449 (0.4116–0.4812)
1.2354 1.3508 2.3950 2.2727
0.1313
Thiacloprid
C. lividipennis N. lugens
0.2038 (0.1823–0.2355) 5.9225 (4.6702–7.7310)
1.5223 1.2704
0.0344
Dinotefuran
C. lividipennis N. lugens
0.3639 (0.3250–0.4118) 0.7142 (0.5716–0.8824)
1.7924 1.4336
0.5095
Clothianidin
0.0813
0.1403
The field populations of Cyrtorhinus lividipennis and Nilaparvata lugens were collected from the same rice field in Nanning (Guangxi) in July 2013. The asterisk (*) showed the data for the susceptible strains of two insects.
2.6. Statistical analysis Differences in responses (currents), Imax and EC50 values were analyzed by one-way ANOVA with at least three repeats (different batches of oocytes from different frogs). Multiple comparisons between the groups were performed using S–N–K method. The level of significance for results was set at p < 0.05. 3. Result 3.1. Contact toxicity and selectivity The toxicities of 4 neonicotinoid insecticides against C. lividipennis and N. lugens populations (tritonymphs) from the same field were tested (Table 1). The results showed that the acute contact toxicities of neonicotinoid insecticides to C. lividipennis were significantly higher than that to N. lugens. The selectivity ratios for thiacloprid, imidacloprid and clothianidin were much less than 1 (0.034, 0.058 and 0.131), which indicated that these three insecticides had no selectivities between BPH and the nature enemy, green miridbug. By contrast, dinotefuran had the selectivity ratio of 0.510 and showed the comparable toxic to C. lividipennis and N. lugens. The much lower toxicity of neonicotinoid insecticides against N. lugens than C. lividipennis might be because of high imidacloprid resistance in N. lugens field population and cross-resistances to thiacloprid and clothianidin. In order to evaluate this possibility, the toxicity comparison was also performed in the susceptible strains of N. lugens and C. lividipennis. The results showed the selectivity ratios for imidacloprid and clothianidin were 0.081 and 0.140 (Table 1), which were close to the values tested in the field populations. 3.2. Cloning of C. lividipennis nAChR ˛8 subunit (Cl˛8) The full sequence of ␣8 subunit (Cl␣8, KJ747359) was isolated from C. lividipennis with specific primers PCR and RACE technique. The nucleotide sequence revealed an open reading frame (ORF) of 546 amino acids with features typical of a nAChR ␣ subunit (Fig. S1), such as conserved residues within loops A, B and C involved in ligand binding, four conserved transmembrane regions (TM1–TM4) and a variable intracellular region between TM3 and TM4. The subunit demonstrates high similarities with other insect nAChR subunits and most closely resembles ␣8 subunit (Fig. S2). Although high similarity (75.9%) was found between Cl␣8 and Nl␣8 from N. lugens, two amino acid differences were found within loop B and loop C between Cl␣8 and Nl␣8, which were N191F and E240T (Fig. 1).
Supplementry material related to this article found, in the online version, at http://dx.doi.org/10.1016/j.neulet.2015.01.046. 3.3. Influence of key amino acid differences on imidacloprid sensitivity Functional nAChRs were detected when Cl␣8 was co-expressed with the rat 2 subunit, which was consistent with Nl␣8, nAChR ␣8 subunit of N. lugens [31]. Maximal agonist-induced responses in oocytes expressing Cl␣8/2 nAChRs were obviously bigger than that of Nl␣8/2 (Fig. 2a). All responses elicited by either acetylcholine or imidacloprid were dose-dependent (Fig. 2b and c). The maximal agonist response (Imax ) detected with imidacloprid in oocytes expressing Nl8/2 nAChRs was 11.56 ± 2.27 nA, with 19.44 ± 3.15 for Cl␣8/2 (Fig. 3). The receptors Cl␣8/2 (EC50 = 5.74 ± 0.92 M) were more sensitive to imidacloprid than Nl␣8/2 (66.59 ± 8.33 M). In order to evaluate the effects of key amino acid differences on agonist potencies, mutations N191F and E240T were introduced into Cl␣8 singly or together to construct mutants Cl␣8N191F , Cl␣8E240T and Cl␣8N191F/E240T . Comparisons of Cl␣8N191F /2 and Cl␣8/2 nAChRs expressed in oocytes revealed that the Cl␣8N191F mutation caused a significant rightward shift in the agonist doseresponse curve for imidacloprid (2.65-fold; Fig. 2d). In contrast, E240T did not cause the significant influence on EC50 values of ACh and imidacloprid (Fig. 3). However, E240T caused a further rightward shift in the agonist dose-response curve for imidacloprid on Cl␣8N191F/E240T /2, compared to Cl␣8N191F /2. 4. Discussion Neonicotinoids were found with high contact toxicities to the predator, C. lividipennis and have no obvious selectivities between pests and the predator [14,15,32]. The present study showed that imidacloprid, clothianidin and thiacloprid were non-selective and high toxic to C. lividipennis than to N. lugens collected from the same rice fields in Nanning (Guangxi, China). Such toxicity difference might be from the high imidacloprid resistance and cross-resistance to clothianidin and thiacloprid in N. lugens field populations, because high imidacloprid resistances were often reported recently in China [33]. However, the toxicities of imidacloprid and clothianidin against the susceptible strains for both C. lividipennis than N. lugens clearly showed that the sensitivity difference was because of different insect species, but not mainly from insecticide resistance in N. lugens. The high toxicity of neonicotinoids against C. lividipennis made us to find more safe ways to apply neonicotinoids and protect this nature enemy. Some
166
B. Guo et al. / Neuroscience Letters 589 (2015) 163–168
Fig. 1. Sequences alignment of Cyrtorhinus Lividipennis Cl␣8 and Nilaparvata lugens Nl␣8. Loops A–C, important to agonist binding site in nAChR ␣ subunit, are underlined. In loop B and C, the amino acid residues different between Cl␣8 and Nl␣8 subunits are marked by asterisks. The identical amino acid residues are showed by dots in Cl␣8 sequence.
studies showed that C. lividipennis adult and nymph were sensitive to thiamethoxam and imidacloprid, while the egg was less sensitive [14]. Besides that, low doses of imidacloprid can reduce the predation rate of adults of C. lividipennis, inducing the resurgence of N. lugens [34]. Given all of these results, using neonicotinoids during the egg stage of C. lividipennis in rice fields if possibly may protect it and increase the selectivity of insecticides. The sensitivity mechanisms of neonicotinoids against C. lividipennis than N. lugens might include metabolic factors and target differences. The preliminary bioassay led us to suspect target sensitivity of C. lividipennis was related to its high sensitivity to imidacloprid. In order to evaluate whether the neonicotinoid
sensitivity difference may also from target differences between C. lividipennis than N. lugens, sequence differences in a key subunit (␣8) of nAChRs were compared and identified. The subunit Cl␣8 was considered to play an important role in imidacloprid binding in C. lividipennis, an insect belongs to Hemiptera as well as N. lugens. Studies have demonstrated that Nl␣8 was involved in the receptor for the higher affinity binding site of imidacloprid in N. lugens [31]. The presence of very high-affinity imidacloprid binding sites in hemipteran insects were believed to be the cause why imidacloprid is particularly useful in controlling insect pests from the insect order Hemiptera [35,36]. Despite the high similarity between Cl␣8 and Nl␣8, two amino acid differences were found
Fig. 2. Representative whole-cell responses and agonist dose–response curves from hybrid nAChRs expressed in Xenopus oocytes. (a) Representative responses elicited by acetylcholine and imidacloprid. (b) Dose–response curves for acetylcholine on Nl␣8/r2 and Cl␣8/r2. (c) Dose–response curves for imidacloprid on Nl␣8/r2 and Cl␣8/r2. (d) Dose–response curves for imidacloprid on receptors with Cl␣8 or Cl␣8 mutant plus r2. Data are means of at least five independent experiments.
B. Guo et al. / Neuroscience Letters 589 (2015) 163–168
167
Fig. 3. Imax and EC50 values of acetylcholine and imidacloprid on hybrid nAChRs containing 2 plus insect ␣8 subunit in Xenopus oocytes. (A) Multiple comparisons of EC50 values for each drug among different receptors. (B) Multiple comparisons of Imax values for each drug among different receptors. The asterisk (*) and double asterisk (**) above each line indicated the significant difference between two receptors connected by the line at 0.05 and 0.01 levels. Data are means of at least three independent experiments ± SEM.
within loops B (N191F) and C (E240T). Because of the importance of amino acid residues with loops on neonicotinoid sensitivities [26–28,37], N191F and E240T might also be important in neonicotinoid sensitivities between C. lividipennis than N. lugens. Functional nAChRs were detected when Cl␣8 was co-expressed with the rat 2 subunit. The mutations N191F and E240T were introduced into Cl␣8 singly or together to construct mutants Cl␣8N191F , Cl␣8E240T and Cl␣8N191F/E240T , which then was coexpressed with r2. As the previous report on Y151S mutation in N. lugens ␣ subunits [26,29], all mutations had little effects on agonist potencies of acetylcholine. In contrast, the single mutation N191F in loop B and the double mutation N191F/E240T caused the significant decrease in imidacloprid potencies, reflecting in the increase of EC50 values. It was worth noting that the mutation E240T had little effect on agonist potency of imidacloprid, but it could enhance the effects of N191F and cause more decrease in imidacloprid sensitivity on receptor Cl␣8N191F/E240T /2 than Cl␣8N191F /2. These results implied that the N191F mutation played key roles in imidacloprid sensitivity on nAChRs in a direct way and E240T mutation contributed to imidacloprid sensitivity in an indirect style. Because of the lack of direct influences on insecticide sensitivities, the influence of mutations like E240T may be ignored when they were studied separately. There might be even more amino acid differences in insect nAChRs or other targets associated with insecticide
sensitivities (resistances) in the way like E240T and the possible indirect effects should be considered. In conclusion, the present results may contribute to our understanding of the molecular mechanism underlying the high neonicotinoid sensitivity on C. lividipennis and suggest the possible target regions for the design of new selective insecticides. Residue changes in loops B and C of Hemipteran insect ␣8 subunits may also lead to a neonicotinoid resistant phenotype because the effects of such changes on ACh potencies are minimal. Acknowledgements This work was supported by National High Technology Research and Development Program of China (863 Program, 2011AA10A207 and 2012AA101502), National Natural Science Foundation of China (31322045, 31130045and 31171869), Jiangsu Science for Distinguished Young Scholars (BK20130028), National Key Technology Research and Development Program(2012BAD19B01). References [1] K.S. Jatav, J. Dhar, Hybrid approach for pest control with impulsive releasing of natural enemies and chemical pesticides: a plant-pest-natural enemy model, Nonlinear Anal. Hybrid Syst. 12 (2014) 79–92.
168
B. Guo et al. / Neuroscience Letters 589 (2015) 163–168
[2] X. Song, Z. Xiang, The prey-dependent consumption two-prey one-predator models with stage structure for the predator and impulsive effects, J. Theor. Biol. 242 (2006) 683–698. [3] Z. Ma, J. Yang, G. Jiang, Impulsive control in a stage structure population model with birth pulses, Appl. Math. Comput. 217 (2010) 3453–3460. [4] W. Wang, L. Chen, A predator-prey system with stage-structure for predator, Comput. Math. Appl. 33 (1997) 83–91. [5] J.R. Beddington, C.A. Free, J.H. Lawton, Characteristics of successful natural enemies in models of biological control of insect pests, Nature 273 (1978) 513–519. [6] P. DeBach, D. Rosen, Biological Control by Natural Enemies, Cambridge University Press, 1991. [7] P.E. Kenmore, Ecology and Outbreaks of a Tropical Insect Pest of the Green Revolution, the Rice Brown Planthopper, Nilaparvata lugens (Stål), University of California, Berkeley, 1980. [8] P.E. Kenmore, F. Carino, C. Perez, V.A. Dyck, A. Gutierrez, Population regulation of the rice brown planthopper (Nilaparvata lugens Stål) within rice fields in the Philippines, J. Plant Protect. Trop. 1 (1984) 19–37. [9] F. Nakasuji, V. Dyck, Evaluation of the role of Microvelia douglasi atrolineata (Bergroth)(Heteroptera: Veliidae) as predator of the brown planthopper Nilaparvata lugens (Stål)(Homoptera: Delphacidae), Res. Popul. Ecol. 26 (1984) 134–149. [10] S. Sahu, R. Singh, P. Kumar, Host preference and feeding potential of spiders predaceous on insect pests of rice, J. Entomol. Res. (New Delhi) 20 (1996) 145–150. [11] L. Sigsgaard, Early season natural control of the brown planthopper, Nilaparvata lugens: the contribution and interaction of two spider species and a predatory bug, Bull. Entomol. Res. 97 (2007) 533–544. [12] T. Reyes, B. Gabriel, The life history and consumption habits of Cyrtorhinus lividipennis Reuter (Hemiptera: Miridae), Philip. Entomol. 3 (1975) 79–88. [13] K. Tanaka, S. Endo, H. Kazano, Toxicity of insecticides to predators of rice planthoppers: spiders, the mirid bug and the dryinid wasp, Appl. Entomol. Zool. 35 (2000) 177–187. [14] V. Jhansi Lakshmi, N.V. Krishnaiah, I.C. Pasalu, T. Lingaiah, K. Krishnaiah, Safety of thiamethoxam to Cyrtorhinus lividipennis Reuter (Hemiptera: Miridae), a predator of brown planthopper, Nilaparvata lugens (Stål) in rice, J. Biol. Control 15 (2001) 53–58. [15] G. Preetha, J. Stanley, S. Suresh, R. Samiyappan, Risk assessment of insecticides used in rice on miridbug Cyrtorhinus lividipennis Reuter, the important predator of brown planthopper, Nilaparvata lugens (Stål.), Chemosphere 80 (2010) 498–503. [16] R. Suvaparp, Effects of Sublethal Doses of Insecticides on the Mirid Predator, Cyrtorhinus lividipennis (Reuter)(Heteroptera:Miridae), Kasetsart University, 1993. [17] R. Nauen, I. Denholm, Resistance of insect pests to neonicotinoid insecticides: current status and future prospects, Arch. Insect Biochem. Physiol. 58 (2005) 200–215. [18] N. Millar, I. Denholm, Nicotinic acetylcholine receptors: targets for commercially important insecticides, Invertebrate Neurosci. 7 (2007) 53–66. [19] H. Breer, D.B. Sattelle, Molecular properties and functions of insect acetylcholine receptors, J. Insect Physiol. 33 (1987) 771–790. [20] N. Unwin, Refined structure of the nicotinic acetylcholine receptor at 4 angstrom resolution, J. Mol. Biol. 346 (2005) 967–989. [21] C. Gotti, F. Clementi, Neuronal nicotinic receptors: from structure to pathology, Prog. Neurobiol. 74 (2004) 363–396. [22] M. Shimomura, M. Yokota, K. Matsuda, D.B. Sattelle, K. Komai, Roles of loop C and the loop B–C interval of the nicotinic receptor at subunit in its selective interactions with imidacloprid in insects, Neurosci. Lett. 363 (2004) 195–198.
[23] X. Yao, F. Song, F. Chen, Y. Zhang, J. Gu, S. Liu, Z. Liu, Amino acids within loops D, E and F of insect nicotinic acetylcholine receptor  subunits influence neonicotinoid selectivity, Insect Biochem. Mol. Biol. 38 (2008) 834–840. [24] C. Bass, A.M. Puinean, M. Andrews, P. Cutler, M. Daniels, J. Elias, V.L. Paul, A.J. Crossthwaite, I. Denholm, L.M. Field, S.P. Foster, R. Lind, M.S. Williamson, R. Slater, Mutation of a nicotinic acetylcholine receptor beta subunit is associated with resistance to neonicotinoid insecticides in the aphid Myzus persicae, BMC Neurosci. 12 (2011) 51. [25] H.N. Koo, J.J. An, S.E. Park, J.I. Kim, G.H. Kim, Regional susceptibilities to 12 insecticides of melon and cotton aphid, Aphis gossypii (Hemiptera: Aphididae) and a point mutation associated with imidacloprid resistance, Crop Protect. 55 (2014) 91–97. [26] Z. Liu, M.S. Williamson, S.J. Lansdell, I. Denholm, Z. Han, N.S. Millar, A nicotinic acetylcholine receptor mutation conferring target-site resistance to imidacloprid in Nilaparvata lugens (brown planthopper), Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 6. [27] T. Perry, D.G. Heckel, J.A. McKenzie, P. Batterham, Mutations in D alpha 1 or D beta 2 nicotinic acetylcholine receptor subunits can confer resistance to neonicotinoids in Drosophila melanogaster, Insect Biochem. Mol. Biol. 38 (2008) 520–528. [28] T. Perry, J.Q. Chan, P. Batterham, G.B. Watson, C.X. Geng, T.C. Sparks, Effects of mutations in Drosophila nicotinic acetylcholine receptor subunits on sensitivity to insecticides targeting nicotinic acetylcholine receptors, Pest. Biochem. Physiol. 102 (2012) 56–60. [29] Z. Liu, M.S. Williamson, S.J. Lansdell, Z. Han, I. Denholm, N.S. Millar, A nicotinic acetylcholine receptor mutation (Y151S) causes reduced agonist potency to a range of neonicotinoid insecticides, J. Neurochem. 99 (2006) 1273–1281. [30] R. Nauen, U. Ebbinghaus-Kintscher, A. Elbert, P. Jeschke, K. Tietjen, Acetylcholine receptors as sites for developing neonicotinoid insecticides, in: I. Ishaaya (Ed.), Biochemical Sites of Insecticide Action and Resistance, Springer, 2001, pp. 77–105. [31] Y. Zhang, Z. Liu, Z. Han, F. Song, X. Yao, Y. Shao, J. Li, N.S. Millar, Functional co-expression of two insect nicotinic receptor subunits (Nl␣3 and Nl␣8) reveals the effects of a resistance-associated mutation (Nl␣3Y151S ) on neonicotinoid insecticides, J. Neurochem. 110 (2009) 1855–1862. [32] G. Katti, I. Pasalu, A. Padmakumari, C. Padmavathi, V. Jhansilakshmi, V. Krishnaiah, J. Bentur, J. Prasad, Y. Rao, Biological control of insect pests of rice, in: R. Hyderabad (Ed.), Technical Bulletin, Directorate of Rice Research, India, 2007, p. 22. [33] Z. Ding, Y. Wen, B. Yang, Y. Zhang, S. Liu, Z. Liu, Z. Han, Biochemical mechanisms of imidacloprid resistance in Nilaparvata lugens: over-expression of cytochrome P450CYP6AY1, Insect Biochem. Mol. Biol. 43 (2013) 1021–1027. [34] I.N. Widiarta, M. Matsumura, Y. Suzuki, F. Nakasuji, Effects of sublethal doses of imidacloprid on the fecundity of green leafhoppers, Nephotettix spp. (Hemiptera: Cicadellidae) and their natural enemies, Appl. Entomol. Zool. 36 (2001) 501–507. [35] M. Tomizawa, J.E. Casida, Neonicotinoid insecticide toxicology: mechanisms of selective action, Annu. Rev. Pharmacol. Toxicol. 45 (2005) 247. [36] R.J. Lind, M.S. Clough, S.E. Reynolds, F.G.P. Earley, [3 H]Imidacloprid labels high- and low-affinity nicotinic acetylcholine receptor-like binding sites in the aphid Myzus persicae (Hemiptera: Aphididae), Pest. Biochem. Physiol. 62 (1998) 3–14. [37] M. Shimomura, H. Satoh, M. Yokota, M. Ihara, K. Matsuda, D.B. Sattelle, Insect-vertebrate chimeric nicotinic acetylcholine receptors identify a region loop B to the N-terminus of the Drosophila D alpha 2 subunit, which contributes to neonicotinoid sensitivity, Neurosci. Lett. 385 (2005) 168–172.