Identification of serum microRNAs as diagnostic and prognostic biomarkers for acute pancreatitis

Pancreatology 14 (2014) 159e166

Contents lists available at ScienceDirect

Pancreatology journal homepage: www.elsevier.com/locate/pan

Original article

Identification of serum microRNAs as diagnostic and prognostic biomarkers for acute pancreatitis Pi Liu a,1, Liang Xia a,1, Wei-long Zhang b, Hua-jing Ke a, Tao Su a, Li-bing Deng b, You-xiang Chen a, Nong-hua Lv a, * a b

Department of Gastroenterology, The First Affiliated Hospital of Nanchang University, Nanchang 330006, China Nanchang University, Nanchang 330031, China

a r t i c l e i n f o

a b s t r a c t

Available online 28 March 2014

Background/objectives: To identify serum microRNA (miRNA) as diagnostic and prognostic biomarkers for acute pancreatitis (AP). Materials and methods: Sera microRNA expression was profiled from 12 AP patients with varying disease severity and three healthy controls. Differentially expressed miRNAs were validated in a larger cohort of patients and controls. The diagnostic and prognostic potentials of differentially expressed miRNAs were evaluated using receiver operating characteristic (ROC) curve analysis and compared to that of classic prognostic markers for AP. Results: miRNA microarray analyses identified 205 differentially expressed miRNAs between sera from AP patients and that from controls. Nine miRNAs were differentially expressed between severe and mild AP patients. Further validation confirmed the down-regulation of miR-92b, miR-10a, and miR-7 in AP patients, and ROC analysis revealed that these miRNAs can differentiate AP from health cases. Furthermore, the serum miR-551b-5p level was significantly higher in patients with disease complications or a low plasma calcium level. ROC analysis showed that the serum miR-551b-5p level can distinguish between severe and mild AP. Conclusion: The expressions of miR-92b, miR-10a, and miR-7 in AP might be used for the early diagnosis of AP and miR-551b-5p may be used for predicting AP severity. Copyright Ó 2014, IAP and EPC. Published by Elsevier India, a division of Reed Elsevier India Pvt. Ltd. All rights reserved.

Keywords: microRNA Acute pancreatitis Early diagnosis Prognosis Biomarker Prediction

1. Introduction Acute pancreatitis (AP) is a reversible inflammatory process of the pancreas with a wide range of clinical variations. Mild AP (MAP) is often self-limited and has a very low mortality rate (<1%). However, severe AP (SAP) can progress rapidly, leading to multiple organ failure and becoming life threatening. The death rate for SAP has been reported to be as high as 30% [1e4]. The clinical management of AP depends largely on disease severity. Treatment for MAP patients is relatively straightforward and requires only brief hospitalization, whereas treatment for SAP patients often involves intensive care. Therefore, identifying SAP patients during an early stage of the disease is critical for achieving optimal outcomes.

* Corresponding author. Tel.: þ86 791 88692505. E-mail addresses: [email protected] (P. Liu), [email protected] (N.-h. Lv). 1 These authors contributed equally.

Although several blood-based biomarkers, such as serum amylase and lipase levels, have been applied to AP diagnosis for decades, no single biochemical or clinical parameter is considered a gold-standard in predicting AP severity [5]. Many scoring systems, such as Ranson’s criteria, the Imrie scoring system, the Acute Physiology and Chronic Health Evaluation (APACHE II) scale, and the Computed Tomography (CT) Severity Index, have been developed [6e8]. The Atlanta classification has been established to standardize AP severity determination [9,10]. The accuracy of those scoring systems in predicting AP severity is better than that of any single biomarker, but their comprehensive assessment requires multiple biochemical analyses and complicated calculations. In addition, many scoring systems cannot be perfectly performed within the first 48 h after patient admission, when severity diagnosis is most critical for optimal disease management. Therefore, it is necessary to develop novel biomarkers that can promptly predict the severity of AP with high accuracy at an early stage of the disease. miRNAs are 22-nucleotide, non-coding RNA molecules that are involved in post-transcriptional regulation either by promoting

http://dx.doi.org/10.1016/j.pan.2014.03.019 1424-3903/Copyright Ó 2014, IAP and EPC. Published by Elsevier India, a division of Reed Elsevier India Pvt. Ltd. All rights reserved.

160

P. Liu et al. / Pancreatology 14 (2014) 159e166

mRNA degradation or by repressing mRNA translation into proteins. miRNAs play important roles in embryonic development, cell proliferation, apoptosis, and differentiation [11]. Recently, miRNAs were shown to regulate various pancreatic biological processes including development, regeneration, beta cell proliferation, and apoptosis [12]. Moreover, miRNA expression profiles in chronic pancreatitis and pancreatic cancer are significantly different from those in normal pancreas [13]. These findings suggest that miRNAs may be functionally involved in the development of different pathological conditions of the pancreas, and miRNA expression signatures may serve as diagnostic or prognostic markers for different pancreatic diseases. Increasing evidence has shown that miRNAs can be detected in human serum or plasma. Serum miRNAs are relatively stable compared to other blood-based biomarkers and easily detected using quantitative reverse transcription polymerase chain reaction (RT-qPCR) [14]. In 2008, Mitchell et al. reported that serum miRNAs in combination with CA19-9 are effective for distinguishing early stage pancreatic cancer from non-cancer cases. More recently, Liu et al. identified a serum miRNA signature for pancreatic cancer diagnosis and prognosis [15]. Furthermore, Kong et al. identified plasma miR-216a as a marker for pancreatic injury in a rat AP model [16]. However, it remains unclear whether serum miRNAs can be used as biomarkers in AP diagnosis and severity prediction. Here, we explored the possibility of miRNAs as non-invasive circulating biomarkers for AP diagnosis and severity prediction. The serum miRNAs that are differentially expressed in AP were first identified using miRNA microarray analysis. Candidate miRNAs were selected by logistic screening and validated in an independent cohort of AP patients and controls. miR-92b, miR-10a, and miR-7 were found to be down-regulated in the blood of AP patients, and their expression levels showed promising diagnostic potential in distinguishing AP patients from healthy controls using receiver operating characteristic (ROC) curve analysis. Furthermore, miR-551b-5p expression was significantly correlated with well-known clinical characteristics for SAP, such as low serum calcium level and the presence of complications. ROC analysis revealed that miR-551b-5p’s predicting power as a severity marker is comparable to that of well-known severity markers, including serum calcium level, CT, and APACHE II scores. Together, the results of our study strongly suggest that circulating miR-92b, miR-10a, and miR-7 may serve as early detection markers and miR-551b-5p may function as a severity prediction marker for the diagnosis of AP. 2. Materials and methods 2.1. Study design The present study included 74 patients who had been clinically classified as having AP in the Nanchang first Affiliated Hospital (Nanchang, China), from October 2011 to May 2012. Twenty-one healthy volunteers were also recruited. To identify a serum miRNA signature for AP, we designed a three-stage screening strategy (Fig. 1). During the first stage or initial discovery phase, serum samples were collected from 3 healthy controls and 12 AP patients (6 SAP and 6 MAP) and subjected to miRNA profiling analyses using miRCURYÔ LNA Array (v. 16.0, Exqon), which contains probes for 895 miRNAs. Next, we refined the number of serum miRNA candidates by logistic screening with multiple criteria. Finally, we validated the expression alterations of candidate miRNAs in an independent cohort of 62 patients and 18 controls. All protocols used in this study were approved by the ethics committee of Nanchang First Affiliated Hospital. Written informed consent was obtained from all patients and volunteers.

Fig. 1. Overview of the study design.

2.2. Patient information The clinical characteristics of patients, including levels of serum calcium, C reactive protein (CRP), and procalcitonin (PCT), APACHE II scores, the status of complications, and disease progression for all patients involved in this study were recorded by two designated clinicians. The clinical diagnosis of AP severity for all the patients was retrospectively determined by the same clinicians, according to following criteria: A) patients were admitted to the hospital within 48 h of initial disease presentation; B) patients demonstrated two of the three AP clinical features: i) AP-characteristic abdominal pain, ii) serum amylase and/or lipase levels at least 3-fold higher than the upper limit of the normal range, and iii) AP-characteristic CT scan results; C) MAP refers to AP with clinical and biochemical features but no organ failure or complications; D) SAP refers to AP with clinical and biochemical features as well as organ failure and/ or complications. Based these criteria, 74 AP patients including 43 MAP and 31 SAP patients were recruited for participation in this study. Twenty-one healthy volunteers were also recruited to participate in the study. 2.3. Blood collection and miRNA isolation Peripheral blood samples were collected from patients within the first 24 h after hospital admission. Peripheral blood (4 ml) was collected from each donor and supplemented with EDTA to avoid

P. Liu et al. / Pancreatology 14 (2014) 159e166

coagulation. Plasma was isolated within 30 min after blood collection by centrifugation at 820g for 10 min at room temperature, followed by another 10-min centrifugation at 10,000 g to further eliminate the cellular components in the plasma. Total serum miRNA was isolated using Trizol in combination with the miRNeasy mini kit (QIAGEN) according to the manufacturer’s instructions. A Nanodrop spectrophotometer (ND-2000, Nanodrop Technologies) was used to determine the quality and quantity of the isolated RNA.

161

significance of differences in miRNA expression between groups. The selection criteria for differentially expressed miRNAs included: (1) fold change > 2, and (2) p value < 0.01. Hierarchical clustering of differentially expressed miRNAs was analyzed as a heat map, using MEV (version 4.6). Furthermore, RT-qPCR data were analyzed using the comparative CT method. DCT for each target miRNA was defined as CTtarget miRNA e CT miR-16. Two-sided, two-tailed Student t-tests were performed to determine the statistical significance (p < 0.05) of differences between groups. ROC curve analysis was performed using GraphPad Prism version 5.

2.4. miRNA microarray 3. Results Total serum miRNAs including six SAP, six MAP, and three control cases were used for miRNA profiling. The miRCURYÔHy3Ô/ Hy5Ô Power labeling kit (Exiqon, Vedbaek, Denmark) was used for miRNA labeling according to the manufacturer’s instructions. The labeled miRNA samples were hybridized onto the miRCURYÔ LNA Array (v. 16.0, Exqo). The complete procedures of hybridization, incubation, and washing were conducted according to the manufacturer’s instructions. The resulting signals were scanned using an Axon GenePix 4000B microarray scanner. 2.5. miRNA quantification by RT-qPCR Total serum miRNAs (15 ng) isolated from the validation cohort (18 controls and 62 patients) were reverse transcribed using the One Step PrimeScript miRNA cDNA Synthesis Kit (Takara Biotechnology, D350A) with a universal adaptor primer. The RT reaction was performed at 37  C for 60 min, followed by 85  C for 5 s. The synthesized cDNA was then amplified by quantitative PCR, using SYBR Premix EX Taq II (Takara Biotechnology, DRR081A), Uni-miRQ PCR Primer (Takara Biotechnology), and primers specific to each individual miRNA (Table 1). The reactions were conducted using PRISM 7500 System (Applied Biosystems, USA). Reactions with no template were used as negative controls, and has-miR-16 was used as internal control [17]. The reaction conditions were 95  C for 30 s followed by 40 cycles of 95  C for 15 s and 60  C for 60 s (ramping was set to 1.6  C/sec). 2.6. Statistical analysis The miRNA array results were extracted and analyzed using GenePix Pro 6.0 software (Axon). The miRNA expression signals were normalized using median normalization. miRNAs with signal values higher than 50 in all groups were included in further analyses. The signals from multiple probes for each miRNA were averaged to represent the expression of the miRNA. Two-tailed ManneWhitney unpaired test was used to determine the

Table 1 miRNA-specific primers. 0

0

ID

miRNA

Sequence (from 5 to 3 )

Number of nucleotides

01 02 03 04 05 06 07 08 09 10 11 12

hsa-miR-92b hsa-miR-10a ebv-miR-BART6-3p hsa-miR-132* hsa-miR-146b-5p hsa-miR-30c hsa-miR-7 hsa-miR-890 hsa-miR-551b-5p hsa-miR-514b-3p hsa-miR-214 hsa-miR-16

AGGGACGGGACGCGGTG GTACCCTGTAGATCCGAATTTGTG CGGGGATCGGACTAGCCTTAGA ACCGTGGCTTTCGATTGTTAC GGCTGAGAACTGAATTCCATAGGC CGCTGTAAACATCCTACACTCTCAG CGGTGGAAGACTAGTGATTTTGTTG CGTACTTGGAAAGGCATCAGTTG GAAATCAAGCGTGGGTGAGACC CCATTGACACCTCTGTGAGTGGA TGCCTGTCTACACTTGCTGTGC TAGCAGCACGTAAATATTGGCG

17 24 22 21 24 25 25 23 22 23 22 22

3.1. Serum miRNA expression profiling in AP To identify differentially expressed miRNAs in blood from AP patients, we performed miRNA microarray analyses on serum miRNA samples from 3 healthy control and 12 AP patients (6 SAP and 6 MAP). All blood samples were collected within the first 24 h after hospital admission. MiRNAs with expression fold change greater than 2 with a p value less than 0.01 were considered as differentially expressed. Using these criteria, we identified 205 differentially expressed miRNAs in AP. Among these miRNAs, 62 (30%) were up-regulated and 143 (70%) were down-regulated (Fig. 2A and B). Between SAP and MAP cases, nine miRNAs were differentially expressed, with four up-regulated and five downregulated in SAP compared to MAP patients (Fig. 2C). These results revealed unique serum miRNA expression profiles in AP, in particular in SAP, therefore suggesting that serum miRNAs may serve as biomarkers for AP diagnosis and prognosis. 3.2. Selection of serum miRNA candidates for AP diagnosis To identify serum miRNAs with diagnostic potential, we further screened miRNA candidates using the following four criteria. First, a candidate gene must be differentially expressed (fold change greater than 2 and p value less than 0.01) between AP patients and controls or between SAP and MAP cases. Second, the trend of altered expression of a given candidate gene between AP patients and controls must be the same as that between the SAP and MAP groups. Third, miRNAs with greater fold changes or lesser p values between the different groups are preferred. Last, miRNAs expressed with high abundance in serum are preferred. Although the first criterion is required, the other three criteria are optional. Based on these criteria, we identified 11 candidate miRNAs (Table 2), including seven down-regulated miRNAs and four up-regulated miRNAs, in the blood from AP patients compared to that from the controls. Among the four up-regulated miRNAs, miR-551b-5p and miR-890 also showed significantly higher expression in the blood from SAP patients than in that from MAP patients (Table 2). 3.3. Validation of candidate miRNAs in an independent cohort of AP patients and controls Next, we sought to validate the differential expression of serum miRNA candidates by RT-qPCR in an independent cohort that included 62 AP patients (37 MAP cases and 25 SAP cases) and 18 controls. Although the MAP and SAP groups were of comparable age and gender composition, significant differences were observed in their serum calcium concentrations, CRP levels, and CT and APACHE II scores (Table 3). We reasoned that the internal control miRNA for RT-qPCR should be consistently expressed regardless the origin of the miRNA sample and it should be present in high abundance in serum. After analyzing the 15 miRNA profiles from our initial

162

P. Liu et al. / Pancreatology 14 (2014) 159e166

Fig. 2. Hierarchical clustering analysis of differentially expressed serum miRNAs in AP. A, Two hundred five miRNAs were differentially expressed between acute pancreatitis patients (AP, n ¼ 12) and controls (N, n ¼ 3). B, Thirty-one most differentially expressed serum miRNAs between AP patients and healthy controls. C, Nine differentially expressed serum miRNAs between MAP and SAP cases (n ¼ 6 for each). Red indicates high level expression, and blue indicates low level expression.

screening and conducting a literature review, we selected has-miR16 as the internal control. RT-qPCR for all 11 candidate miRNAs confirmed the downregulation of three miRNAs, miR-92b, miR-10a, and miR-7, in AP (Fig. 3). A low level of serum calcium is known to correlate with poor prognosis in AP patients [18], and high CRP (>150 mg/L) is a marker of severe AP [19,20]. In addition, a plasma PCT level greater than 0.5 ng/mL has been used to determine infection status in AP and predict disease severity [21,22]. Therefore, we investigated whether the serum miR-551b-5p level correlates with any of these AP severity biomarkers. As demonstrated in Fig. 4, miR-551b-5p expression was significantly higher in patients who had low plasma calcium levels or presented with complications (Fig. 4).

When patients were stratified by PCT or CRP levels, miR-551b-5p expression was not different between different groups (Fig. 4). Taken together, these results confirmed the down-regulation of miR-92b, miR-10a, and miR-7 in the blood of AP patients and demonstrated that elevated miR-551b-5p expression correlated with some severity markers, suggesting that these miRNAs may serve as biomarkers for AP detection and severity prediction. 3.4. Diagnostic potential of differentially expressed miRNAs in AP Given that the expression levels of miR-92b, miR-10a, and miR-7 were significantly down-regulated in blood samples from AP patients collected within 24 h of hospital admission, we reasoned that these three miRNAs might serve as biomarkers for the early

Table 2 List of candidate miRNAs. ID

145897 17561 10306 29490 13485 145634 42923 147809 11014 42781 28047

Name

hsa-miR-92b ebv-miR-BART6-3p hsa-miR-146b-5p hsa-miR-7 hsa-miR-10a hsa-miR-132* hsa-miR-30c hsa-miR-514b-3p hsa-miR-214 hsa-miR-551b-5p hsa-miR-890

AP vs Normal

SAP vs MAP

Fold change

p Value

Mean of normal

Mean of AP

Fold change

p Value

Mean of MAP

Mean of SAP

0.25 0.35 0.38 0.43 0.32 0.36 0.43 8.81 13.54 5.43 3.93

1.16E-05 1.62E-05 2.01E-05 5.35E-05 9.04E-05 1.06E-04 1.86E-03 2.36E-03 5.33E-03 9.61E-03 5.00E-02

1.87 4.28 7.99 17.90 8.03 1.60 4.29 0.03 0.04 0.06 0.22

0.47 1.49 3.04 7.69 2.59 0.58 1.85 0.23 0.50 0.34 0.88

2.00 2.38

3.30E-03 6.44E-03

0.23 0.52

0.46 1.24

P. Liu et al. / Pancreatology 14 (2014) 159e166

4. Discussion

Table 3 Clinical characteristics of patients with MAP and SAP.

Age (years) Sex (male) Ca (mmol/L) PCT (ng/ml) CRP (mg/L) CT A B C D E APACHE II

MAP (n ¼ 37)

SAP (n ¼ 25)

p Valuea

49.32 23 1.96 3.70 99.34

54.20 18 1.8 18.81 220.4

0.29 0.6447b 0.02 0.10 0.00 <0.0001b

3 6 12 11 2 3.16

(3.04) (62%) (0.036) (1.84) (19.06) (5.08%) (10.17%) (20.34%) (18.64%) (3.39%) (0.43)

0 0 3 12 10 7.52

163

(3.32) (72%) (0.053) (10.34) (23.25) (0%) (0%) (5.08%) (20.34%) (16.95%) (0.65)

<0.0001

Data are presented as mean  SEM or %. CT, computed tomography. a Student’s t test. b c2 test or Fisher’s exact test.

detection of AP. To evaluate the diagnostic potential of these three miRNAs, we performed ROC analysis in our validation cohort. As shown in Fig. 5, all three miRNAs gave an area under the curve (AUC) value of 0.69 (95% confidence intervals [CIs]: 0.57e0.82, 0.55e0.83, and 0.54e0.84 for miR-92b, miR-10a, and miR-7, respectively), suggesting that these serum miRNAs may be used to distinguish AP patients from healthy controls. 3.5. Evaluation of serum miR-551b-5p as a predictor of AP disease severity Because elevated serum miRNA-551b-5p expression was closely correlated with the clinical characteristics of SAP, we reasoned that miRNA-551b-5p may serve as a non-invasive biomarker for the prediction of AP severity during an early stage of AP. To evaluate the predicting power of miR-551b-5p for disease severity, we performed ROC analysis for the 62 AP patients in our validation cohort. As shown in Fig. 6, the ROC curve for miR-551b5p gave an AUC value of 0.69 (95% CI: 0.54e0.85). In the same cohort, the ROC curves for plasma calcium, CT results, and APACHE II scores gave AUC values of 0.70, 0.80, and 0.84, respectively. However, no statistically significant differences were detected between the ROC curve for miR-551b-5p and the ROC curves generated from the other three classifiers. These results suggest that the serum miR-551b-5p level can be valuable in determining the severity of AP during an early stage of disease progression. Investigations in larger patient cohorts are warranted to further validate these findings.

AP is a pathological condition in which the enzymes produced by the pancreas become active inside the organ, leading to pancreatic tissue self-destruction. The best-known causes of AP are gallstones and alcohol abuse. Other causes include hyperlipidemia, hypercalcemia, abdominal surgery, and drug addiction [1,2]. The characteristic symptom for AP is the acute onset of pain in the upper abdomen. Other symptoms include fever, nausea, vomiting, gaseous abdominal fullness, clay-colored stools, sweating, indigestion, jaundice, and swelling of the abdomen [1]. The clinical management of AP depends primarily on disease severity. MAP is often self-limited and has no organ failure or complications, whereas SAP is often accompanied by multiple organ failure and complications. For this reason, MAP patients only need short hospitalization, but SAP patients often need intensive care. Accurately predicting disease severity at an early phase of disease progression is critical for achieving optimal outcomes in AP patients. To date, no single laboratory or clinical parameter is sufficient to allow for accurate prediction of AP severity [5]. The initial laboratory evaluations of AP often include serum amylase and lipase levels. Amylase and lipase are secreted from the acinar cells of the pancreas and often become elevated in cases of AP. However, other conditions, such as rental insufficiency can also cause amylase and lipase elevation. In addition, in some AP patients with alcohol abuse, the levels of amylase and lipase do not increase [23]. Therefore, these serum markers are not optimal for predicting AP severity. To improve accuracy in AP diagnosis, multiple scoring systems have been developed based on the levels of various biochemical makers as well as clinical imaging characteristics. The most commonly used scoring systems are the APACHE II and CT severity index. To enable direct comparison of results obtained from different scoring systems, the Atlantic classification of severe AP was established [9]. The scoring systems greatly helped clinicians perform a comprehensive evaluation and risk stratification in AP patients, but their processes require information regarding many aspects of the disease, ranging from clinical manifestations to biochemical marker expressions to radiographic images. It is obvious that such a complicated evaluation procedure is difficult to implement in the setting of emergency medicine. Therefore, it is necessary to develop novel biomarkers that can reliably predict the severity of AP within the first 48 h after patient admission. In recent years, miRNA expression has been implicated in numerous physiological and pathological processes, ranging from embryonic development to tumorigenesis. Because miRNAs are relatively stable in blood and their expression is easy to quantify, serum miRNAs are promising as biomarkers for the diagnosis of

Fig. 3. Validation of altered expression of candidate miRNAs in an independent cohort of AP patients and controls. A, miR-92b; B, miR-10a; and C, miR-7 expression. AP, acute pancreatitis, N, healthy controls. Data are presented as mean  SEM, and p values were determined by two-sample independent t-tests. A p value <0.05 is considered significant.

164

P. Liu et al. / Pancreatology 14 (2014) 159e166

Fig. 4. Elevated serum miR-551b level in AP patients correlated with low plasma calcium concentration and the disease stage (MAP and SAP), but not with PCT or CRP levels. A, By plasma calcium concentration (Low, [Ca] <1.8 mmol/L, High, [Ca] 1.8 mmol/L); B, by PCT level (Low <0.5 ng/ml, High 0.5 ng/ml); C, by CRP level (Low <150 mg/L, High 150 mg/L); D, MAP refers to AP patients with clinical and biochemical features but without organ failure or complications; SAP refers to AP patients with both clinical and biochemical features and organ failure and/or complications. Data are presented as mean  SEM, and p values were determined by two-sample independent t-tests. A p value less than 0.05 is considered significant.

various diseases and corresponding prognosis predictions. However, the diagnostic potentials of serum miRNAs in AP remained unknown. To this end, we explored the clinical applicability of miRNAs as non-invasive circulating biomarkers in predicting the severity of AP. Here, we isolated miRNAs from blood samples of AP

patient obtained within the first 24 h after admission and compared the serum miRNA profiles of AP patients to those of healthy controls. After statistical comparison, logistical screening, and further validation, three miRNAs, miR-92b, miR-10a, and miR7, were found to be down-regulated in the blood samples from AP

Fig. 5. ROC curves of serum miRNAs down-regulated in AP. A, miR-92b; B, miR-10a; and C, miR-7. AUC, area under the curve; CI, confidence interval.

P. Liu et al. / Pancreatology 14 (2014) 159e166

165

Fig. 6. ROC curve analyses and performance comparisons between serum miR-551b-5p level, calcium concentration, CT results, and APACHE II scores in AP patients. A, ROC curves for serum miR-551b-5p level, calcium concentration, CT results, and APACHE II scores. B, Performance comparison between different ROC curves.

patients. Using ROC curve analyses, we found that as early as 24 h after admission the expression of these three miRNAs already demonstrated diagnostic potential in disease detection in a cohort of 62 patients and 18 controls. To fully explore the diagnostic potentials of these miRNAs, it will be essential to continue this study in much larger populations. In addition, as collecting and processing blood samples within the first 24 h after admission is not always practical, analysis of the diagnostic powers of the serum miRNAs in blood samples collected between 24 and 48 h after patient admission will be helpful in determining the prognostic values of these altered miRNAs in a more realistic clinical setting. Under abnormal circumstances of AP, pancreatic damage occurs when the digestive enzymes are activated inside the pancreas and begin attacking the gland itself. Such organ damage may result in the release of pancreatic miRNAs into circulation, leading to a general increase in serum miRNAs levels. Given that the levels of miR-92b, miR-10a, and miR-7 were significantly down-regulated in the sera of AP patients, we reasoned that the altered expression of these miRNAs is not the result of tissue damageeinduced pancreatic miRNA release. Instead, their expression may be functionally involved in the pathogenesis of AP. miR-7 is highly expressed in the pancreas [24], and its expression is regulated in pancreas development in zebra fish and humans [25]. Recently, it was found that miR-7 can target the mammalian target of rapamycin (mTOR) pathway and regulate pancreatic b-cell proliferation [26]. Other potential targets of miR-7 include calmodulin 2 (CALM2) and voltage-dependent anion channel 1 (VDAC1) [27e29], both of which are involved in the calcium signaling pathway [30,31]. We postulate that miR-7 down-regulation in AP is functionally related to the serum calcium change that occurs during AP pathogenesis. Intriguingly, gene ontology analysis demonstrated that the target genes, which are regulated by the differentially expressed miRNAs between SAP and MAP, are enriched in the calcium signaling pathway. These observations suggest that the calcium signaling pathway may be systemically affected in AP, instead of being altered locally according to the conventional understanding of AP [32,33]. The function of miR-10a has been well elucidated. miR-10a was found to promote pancreatic cancer cell invasion presumably via targeting homeobox A1 (HOXA1) [34], and miR-10a overexpression correlates with poor survival in pancreatic cancer patients. In hepatocarcinoma cells, miR-10a was found to target the Eph tyrosine kinase receptor, EphA4, which in turn regulates the epitheliale mesenchymal transition process and modulates cell motility [35]. Moreover, miR-10a was also implicated in the development of gastric cancer metastasis [36]. Recently, miR-10a was found to be

specifically expressed in regulatory T cells, indicating a role of miR10a in fine-tuning the plasticity and fate of these T cells [37,38]. Interestingly, interleukin (IL)-12/IL-23p40, a key molecule for innate immune responses to commensal bacteria, is a target of miR10a, and mice with colitis had lower levels of intestinal miR-10a than controls, suggesting that miR-10a expression may be involved in intestinal homeostasis [39]. It is possible that the decrease of serum miR-10a in AP may be related to the changes of immune-homeostasis during disease progression. Further analysis is needed to elucidate the role of miR-10a in AP pathogenesis. Although miR-92b has not yet been reported to be involved in AP pathogenesis, the function of this miRNA has been reported in several studies. For example, miR-92b was reported to regulate the expression of Peptide transporter 1 (PepT1) in intestinal epithelial cells [34]. In Drosophila, miR-92b targets myocyte enhancer factor2 (Mef2), the abnormal expression of which can cause muscle defects and lethality [40]. In glioma cells, miR-92b was found to be important in regulating cell growth, apoptosis, and invasion by targeting nemo-like kinase (NLK) and modulating the beta-catenin/ TCF-4 pathway [41]. Further investigations are needed to elucidate the mechanisms underlying the down-regulation of miR-92b, miR10, and miR-7 during AP and to determine if these miRNAs are functionally important in AP disease progression. Our study also found that serum miR-551b-5p had one of the most dramatic expression differences between SAP and MAP patients (p < 0.005). Analyses in the validation cohort revealed that serum miR-551b-5p expression was not only higher in SAP cases than in MAP cases, but it also correlated with low serum calcium level and the presence of complications (p < 0.05). Although there is little information regarding the function of miR-551b-5p, our data strongly suggest that the serum miR-551b-5p level is a useful marker in predicting the severity of AP. In summary, we identified several miRNAs that are differentially expressed in AP during the early phase of disease progression. Our analyses revealed that the expression levels of these miRNAs have promising diagnostic value for disease detection and severity prediction. Further investigations are needed to confirm the diagnostic values of these serum miRNAs, to elucidate the molecular mechanisms underlying AP pathogenesis, and to develop a new therapeutic method for treating severe AP.

Funding This research was sponsored by the National Natural Science Foundation of China (Grant No. 81160068/H0320).

166

P. Liu et al. / Pancreatology 14 (2014) 159e166

Potential competing interests None. Acknowledgments We thank Medjaden Bioscience Limited for assisting in the preparation of this manuscript.

[21]

[22]

[23]

References [24] [1] Carroll JK, Herrick B, Gipson T, Lee SP. Acute pancreatitis: diagnosis, prognosis, and treatment. Am Fam Physician 2007;75:1513e20. [2] Dervenis C, Johnson CD, Bassi C, Bradley E, Imrie CW, McMahon MJ, et al. Diagnosis, objective assessment of severity, and management of acute pancreatitis. Santorini consensus conference. Int J Pancreatol 1999;25:195e210. [3] Harper SJ, Cheslyn-Curtis S. Acute pancreatitis. Ann Clin Biochem 2011;48: 23e37. [4] Gravante G, Garcea G, Ong SL, Metcalfe MS, Berry DP, Lloyd DM, et al. Prediction of mortality in acute pancreatitis: a systematic review of the published evidence. Pancreatology 2009;9:601e14. [5] Lippi G, Valentino M, Cervellin G. Laboratory diagnosis of acute pancreatitis: in search of the Holy Grail. Crit Rev Clin Lab Sci 2012;49:18e31. [6] Wu BU, Johannes RS, Sun X, Tabak Y, Conwell DL, Banks PA. The early prediction of mortality in acute pancreatitis: a large population-based study. Gut 2008;57:1698e703. [7] Papachristou GI, Muddana V, Yadav D, O’Connell M, Sanders MK, Slivka A, et al. Comparison of BISAP, Ranson’s, APACHE-II, and CTSI scores in predicting organ failure, complications, and mortality in acute pancreatitis. Am J Gastroenterol 2010;105:435e41. [8] Singh VK, Wu BU, Bollen TL, Repas K, Maurer R, Johannes RS, et al. A prospective evaluation of the bedside index for severity in acute pancreatitis score in assessing mortality and intermediate markers of severity in acute pancreatitis. Am J Gastroenterol 2009;104:966e71. [9] Bradley 3rd EL. A clinically based classification system for acute pancreatitis. Summary of the International Symposium on Acute Pancreatitis, Atlanta, Ga, September 11 through 13, 1992. Arch Surg 1993;128:586e90. [10] Brun A, Agarwal N, Pitchumoni CS. Fluid collections in and around the pancreas in acute pancreatitis. J Clin Gastroenterol 2011;45:614e25. [11] Ambros V. The functions of animal microRNAs. Nature 2004;431:350e5. [12] Joglekar MV, Parekh VS, Hardikar AA. Islet-specific microRNAs in pancreas development, regeneration and diabetes. Indian J Exp Biol 2011;49:401e8. [13] Bloomston M, Frankel WL, Petrocca F, Volinia S, Alder H, Hagan JP, et al. MicroRNA expression patterns to differentiate pancreatic adenocarcinoma from normal pancreas and chronic pancreatitis. JAMA 2007;297:1901e8. [14] Mitchell PS, Parkin RK, Kroh EM, Fritz BR, Wyman SK, PogosovaAgadjanyan EL, et al. Circulating microRNAs as stable blood-based markers for cancer detection. Proc Natl Acad Sci U S A 2008;105:10513e8. [15] Liu R, Chen X, Du Y, Yao W, Shen L, Wang C, et al. Serum microRNA expression profile as a biomarker in the diagnosis and prognosis of pancreatic cancer. Clin Chem 2012;58:610e8. [16] Kong XY, Du YQ, Li L, Liu JQ, Wang GK, Zhu JQ, et al. Plasma miR-216a as a potential marker of pancreatic injury in a rat model of acute pancreatitis. World J Gastroenterol 2010;16:4599e604. [17] Kroh EM, Parkin RK, Mitchell PS, Tewari M. Analysis of circulating microRNA biomarkers in plasma and serum using quantitative reverse transcription-PCR (qRTPCR). Methods 2010;50:298e301. [18] Millat B, El Hamiani O, Zazzo JF, Gayral F, Larrieu H. Acute pancreatitis: severity factors. Retrospective analysis of 78 cases. J Chir (Paris) 1983;120: 681e6. [19] Mayerle J, Dummer A, Sendler M, Malla SR, van den Brandt C, Teller S, et al. Differential roles of inflammatory cells in pancreatitis. J Gastroenterol Hepatol 2012;27:47e51. [20] Bezmarevi c M, Kosti c Z, Jovanovi c M, Mickovi c S, Mirkovi c D, Soldatovi c I, et al. Procalcitonin and BISAP score versus C-reactive protein and APACHE II

[25]

[26]

[27]

[28] [29]

[30]

[31] [32]

[33]

[34]

[35]

[36]

[37]

[38] [39]

[40]

[41]

score in early assessment of severity and outcome of acute pancreatitis. Vojnosanit Pregl 2012;69:425e31. Bezmarevic M, Mirkovic D, Soldatovic I, Stamenkovic D, Mitrovic N, Perisic N, et al. Correlation between procalcitonin and intra-abdominal pressure and their role in prediction of the severity of acute pancreatitis. Pancreatology 2012;12:337e43. Qu R, Ji Y, Ling Y, Ye CY, Yang SM, Liu YY, et al. Procalcitonin is a good tool to guide duration of antibiotic therapy in patients with severe acute pancreatitis. A randomized prospective singlecenter controlled trial. Saudi Med J 2012;33: 382e7. Lankisch PG, Burchard-Reckert S, Lehnick D. Underestimation of acute pancreatitis: patients with only a small increase in amylase/lipase levels can also have or develop severe acute pancreatitis. Gut 1999;44:542e4. Bravo-Egana V, Rosero S, Molano RD, Pileggi A, Ricordi C, DomínguezBendala J, et al. Quantitative differential expression analysis reveals miR-7 as major islet microRNA. Biochem Biophys Res Commun 2008;366:922e6. Joglekar MV, Joglekar VM, Hardikar AA. Expression of islet-specific microRNAs during human pancreatic development. Gene Expr Patterns 2009;9:109e13. Wang Y, Liu J, Liu C, Naji A, Stoffers DA. MicroRNA-7 regulates the mTOR pathway and proliferation in adult pancreatic beta-cells. Diabetes 2013;62: 887e95. S1 Griffiths-Jones, Grocock RJ, van Dongen S, Bateman A, Enright AJ. miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res 2006;34:D140e4. Betel D, Wilson M, Gabow A, Marks DS, Sander C. The microRNA.org resource: targets and expression. Nucleic Acids Res 2008;36:D149e53. Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 2005;120:15e20. De Stefani D, Bononi A, Romagnoli A, Messina A, De Pinto V, Pinton P, et al. VDAC1 selectively transfers apoptotic Ca2+ signals to mitochondria. Cell Death Differ 2012;19:267e73. Racioppi L, Means AR. Calcium/calmodulin-dependent protein kinase kinase 2: roles in signaling and pathophysiology. J Biol Chem 2012;287:31658e65. Booth DM, Mukherjee R, Sutton R, Criddle DN. Calcium and reactive oxygen species in acute pancreatitis: friend or foe? Antioxid Redox Signal 2011;15: 2683e98. Petersen OH, Gerasimenko OV, Gerasimenko JV. Pathobiology of acute pancreatitis: focus on intracellular calcium and calmodulin. F1000 Med Rep 2011;3:15. Dalmasso G, Nguyen HT, Yan Y, Laroui H, Charania MA, Obertone TS, et al. MicroRNA-92b regulates expression of the oligopeptide transporter PepT1 in intestinal epithelial cells. Am J Physiol Gastrointest Liver Physiol 2011;300: G52e9. Yan Y, Luo YC, Wan HY, Wang J, Zhang PP, Liu M, et al. MicroRNA-10a is involved in the metastatic process by regulating Eph tyrosine kinase receptor A4-mediated epithelial-mesenchymal transition and adhesion in hepatoma cells. Hepatology 2013;57:667e77. Chen W, Tang Z, Sun Y, Zhang Y, Wang X, Shen Z, et al. miRNA expression profile in primary gastric cancers and paired lymph node metastases indicates that miR-10a plays a role in metastasis from primary gastric cancer to lymph nodes. Exp Ther Med 2012;3:351e6. Takahashi H, Kanno T, Nakayamada S, Hirahara K, Sciumè G, Muljo SA, et al. TGF-beta and retinoic acid induce the microRNA miR-10a, which targets Bcl-6 and constrains the plasticity of helper T cells. Nat Immunol 2012;13: 587e95. Jeker LT, Zhou X, Gershberg K, de Kouchkovsky D, Morar MM, Stadthagen G, et al. MicroRNA 10a marks regulatory T cells. PLoS One 2012;7:e36684. Xue X, Feng T, Yao S, Wolf KJ, Liu CG, Liu X, et al. Microbiota downregulates dendritic cell expression of miR-10a, which targets IL-12/IL-23p40. J Immunol 2011;187:5879e86. Chen Z, Liang S, Zhao Y, Han Z. miR-92b regulates Mef2 levels through a negative feedback circuit during Drosophila muscle development. Development 2012;139:3543e52. Wang K, Wang X, Zou J, Zhang A, Wan Y, Pu P, et al. miR-92b controls glioma proliferation and invasion through regulating Wnt/beta-catenin signaling via Nemo-like kinase. Neuro Oncol 2013;15:578e88.