- Email: [email protected]
Identification of serum microRNAs as potential toxicological biomarkers for toosendanin-induced liver injury in mice
Phytomedicine 58 (2019) 152867
Contents lists available at ScienceDirect
Phytomedicine journal homepage: www.elsevier.com/locate/phymed
Original Article
Identification of serum microRNAs as potential toxicological biomarkers for toosendanin-induced liver injury in mice Yang Fana,b,1, Li Lic,1, Yang Ruia,b, Wei Mengjuana, Sheng Yuchenb, Ji Lilia,
T
⁎
a The MOE Key Laboratory for Standardization of Chinese Medicines, Shanghai Key Laboratory of Compound Chinese Medicines and The SATCM Key Laboratory for New Resources and Quality Evaluation of Chinese Medicines, Institute of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine, Shanghai 201203, China b Center for Drug Safety Evaluation and Research, Innovation Research Institute of Traditional Chinese Medicine, Shanghai University of Traditional Chinese Medicine, 1200 Cailun Road, Shanghai 201203, China c Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing 210008, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Toosendanin Hepatotoxicity MicroRNA Biomarker
Background: Toosendan Fructus is traditionally used as an insecticide or digestive tract parasiticide for treating digestive parasites in China. It is recorded to have little toxicity in Chinese Pharmacopoeia and has been found to cause severe liver injury during clinical practice. Purpose: This study aims to identify candidate serum microRNAs (miRNAs) as potential toxicological biomarkers for reflecting the hepatotoxicity induced by toosendanin (TSN), which is the main toxic compound isolated from Toosendan Fructus Methods: Alanine/aspartate aminotransferase (ALT/AST) activities detection and liver histological observation were performed to evaluate the liver injury induced by TSN or other hepatotoxicants in mice. miRNAs chip analysis and Real-time PCR assay were conducted to identify the altered miRNAs in serum from TSN-treated mice Results: The results of serum ALT/AST and liver histological evaluation showed that TSN (10 mg/kg) induced hepatotoxicity in mice. The results of miRNAs chip showed that the expression of 81 serum miRNAs was obviously altered in mice treated with TSN for 12 h, and 22 of them have passed the further validation in serum from mice treated with TSN for both 6 h and 12 h. These 22 miRNAs were supposed to be the candidate toxicological biomarkers for TSN-induced hepatotoxicity with more sensitivity as compared to the alteration of AST or ALT activity. Moreover, the expression of miRNA-122-3p and mcmv-miRNA-m01-4-3p was not only increased in TSN-treated mice, but also increased in mice treated with other hepatotoxicants including acetaminophen (APAP), monocrotaline (MCT) and diosbuibin B (DB). Only the expression of serum miRNA-367-3p was increased in TSN-treated mice but not changed in the liver injury induced by APAP, MCT or DB Conclusion: miR-122-3p and mcmv-miRNA-m01-4-3p may be two commonly sensitive biomarkers for reflecting the hepatotoxicity induced by exogenous hepatotoxicants, and miR-367-3p may be a specific biomarker for reflecting the liver injury induced by TSN.
Introduction The liver damage caused by the drug itself or/and its metabolites is called drug-induced liver injury (DILI). Drugs may cause liver injury in a predictable dose-dependent manner in most human and experimental animals (intrinsic DILI) or in an unpredictable non-dose-dependent
manner (idiosyncratic DILI) (Kurt et al., 2015). With the wide acceptance and application of traditional Chinese medicines (TCMs) in the world, the hepatotoxicity induced by herbal and dietary supplements has become a rising cause for DILI (Zhang et al., 2016; Medina-Caliz et al., 2018). Recent studies have shown that DILI caused by TCMs accounts for about 25.71% of clinical drugs-induced liver injury and a
Abbreviations: ALT, alanine aminotransferase; APAP, acetaminophen; AST, aspartate aminotransferase; CMC-Na, carboxymethylcellulose sodium; DB, diosbuibin B; DILI, drug-induced liver injury; HCA, hierarchical clustering analysis; H&E, haematoxylin and eosin; HSECs, hepatic sinusoidal endothelial cells; HSOS, hepatic sinusoidal obstruction syndrome; i.g., intragastric administration; i.p, intraperitoneal administration; MCT, monocrotaline; miRNAs, microRNAs; PBS, phosphate buffered saline; PG, propylene glycol; SEM, standard error of the mean; snRNA, small nuclear RNA; TCMs, traditional Chinese medicines; TSN, toosendanin ⁎ Corresponding author. E-mail address: [email protected] (L. Ji). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.phymed.2019.152867 Received 18 October 2018; Received in revised form 26 January 2019; Accepted 17 February 2019 0944-7113/ © 2019 Elsevier GmbH. All rights reserved.
Phytomedicine 58 (2019) 152867
F. Yang, et al.
Treatment of animals
gradually increased proportion of TCMs-induced liver injury was observed over the years, which has become a non-negligible problem (Wang et al., 2018). Toosendan Fructus, the ripe fruit of Melia toosendan Sieb. et Zucc. (Meliaceae), is traditionally used as an insecticide or digestive tract parasiticide for treating digestive parasites in China for thousands of years. Toosendan Fructus has also been recorded as a little toxic drug in Chinese Pharmacopoeia (Chinese Pharmacopoeia, 2015). TSN is the main active ingredient with anti-tumor and insecticidal activity isolated from Toosendan Fructus (Xu and Zhang, 2011; Li et al., 2017; Zhang et al., 2017, 2018). However, TSN is also reported to induce serious hepatotoxicity both in vivo and in vitro (Zhang et al., 2008; Lu et al., 2016; Jin et al., 2019). The current gold-standard biomarkers for reflecting liver injury are the elevated serum ALT and AST activities, which are also generally used for DILI diagnosis in clinic. Due to the limitation in sensitivity and specificity, detecting the increased serum ALT and AST activities failed to meet current requirements for reflecting drug-induced hepatotoxicity in clinic. Except distributed in liver, ALT or AST also exists in the heart and skeletal muscles, and some studies reported that the elevation of these two conventional biomarkers was not only related to liver injury (Nathwani et al., 2005; Shen et al., 2015). So, more sensitive and specific biomarkers for reflecting DILI are needed. microRNAs are endogenously expressed small non-coding RNA molecules, and they are reported to be involved in various physiological and pathological processes in human (Bartel, 2004). It has been reported that miRNAs are associated with the hepatotoxicity induced by toxins such as microcystin (Ma and Li, 2017). miRNA has the possibility to be served as a biomarker for reflecting liver injury due to its stability in blood or other biofluids (Wang et al., 2014). In previous studies, some miRNAs have already been found as potential biomarkers for reflecting liver injury induced by drugs, especially like miR-122 (Lin et al., 2017; Howell et al., 2018). This study aims to find the candidate miRNA biomarkers with high sensitivity or specificity for reflecting the liver injury induced by TSN.
In the first experiment, the C57BL/6 mice were randomly divided into 5 groups, respectively. (1) Normal control group (n = 7), (2) vehicle control group (n = 7), (3) TSN (6 h) group (n = 7), (4) TSN (12 h) group (n = 7), (5) TSN (24 h) group (n = 7). TSN was dissolved in 10% propylene glycol (PG). Mice were given (intraperitoneal administration, i.p.) with TSN once with the dose of 10 mg/kg. Mice in vehicle control group were given with 10% PG (i.p.). Mice were sacrificed at different times after TSN injection. After treatment, blood and liver tissues from each group were collected. In the second experiment, the C57BL/6 mice were randomly divided into 6 groups. (1) APAP vehicle control (n = 6), (2) APAP (300 mg/kg) (n = 6), (3) MCT vehicle control (n = 6); (4) MCT (360 mg/kg) (n = 6), (5) DB vehicle control (n = 6), (6) DB (300 mg/kg) (n = 6). APAP was dissolved in hot normal saline solution. DB was dissolved in 0.5% carboxymethylcellulose sodium (CMC-Na) solution. MCT was added to distilled water and titrated to pH 3.0 with 0.1 N HCl to completely dissolve the solid. Subsequently, the solution was neutralized using 0.5 N NaOH to pH 7.0. Mice were given (intragastric administration,i.g.) with APAP and sacrificed at 6 h after APAP treatment. Mice were given (i.g.) with DB and sacrificed at 24 h after DB treatment. Mice were given (i.g.) with MCT and sacrificed at 48 h after MCT treatment. After treatment, blood from each group was collected. Serum ALT/AST activity detection The blood samples obtained from mice of all groups were allowed to coagulate for 2 h. Serum was then isolated following centrifugation at 860 × g for 15 min. Serum ALT and AST activities were measured with kits according to the manufacturer's instructions. Liver histological observation Slices of livers were fixed in 10% phosphate buffered saline (PBS)formalin and then embedded in paraffin. Samples were subsequently sectioned (5 μm), stained with haematoxylin and eosin (H&E), and then observed under a light microscope (Olympus, Japan) to evaluate liver damage.
Material and method Chemical compounds and reagents
MicroRNA microarray and data analysis
TSN (Purity > 98.0%) was purchased from Shanghai Yuanye Biological Technology Co., Ltd (Shanghai, China). DB (Purity > 98.0%) was purchased from Shanghai Tauto Biotech Co., Ltd. (Shanghai, China). APAP (Purity > 99.0%) was obtained from Sigma (St Louis, MO). MCT (Purity > 98.0%) was purchased from Nanjing GuangRun Biotechnology Co., Ltd (Nanjing, China). The analytic kits for detecting serum ALT and AST activities were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Trizol was purchased from Life Technology (Carlsbad, CA). MiRNeasy mini kit and miScript PCR starter kit were obtained from Qiagen (Hilden, German). miRCURYTM LNA Array (v.18.0) was purchased from Exiqon (Vedbaek, Denmark). PrimeScript Master Mix and SYBR Premix Ex Taq were purchased from Takara (Shiga, Japan).
Serum total RNA from C57BL/6 mice treated with TSN for 12 h as well as vehicle control group was harvested by using Trizol and miRNeasy mini kits according to manufacturer's instructions. After having passed RNA quantity measurement, the samples were labeled using the miRCURY™ Array Power Labeling kit and hybridized on the miRCURY™ Array (v.18.0). Following the washing steps the slides were scanned using the Axon GenePix 4000 B microarray scanner. Scanned images were then imported into GenePix Pro 6.0 software (Axon) for grid alignment and data extraction. Expressed data were normalized using the median normalization. After normalization, differentially expressed miRNAs were identified through Fold Change filtering. Only those miRNAs with the fold difference >10.0 were considered significant, and hierarchical clustering analysis (HCA) was performed to show different miRNA expression profiling among vehicle control mice and mice treated with TSN (10 mg/kg) for 12 h by using MEV software (v4.6, TIGR).
Experimental animals Specific pathogen free male C57BL/6 mice (weight: 20 ± 2 g) were purchased from Shanghai Experimental Animal Center of Chinese Academy of Sciences (Shanghai, China). The mice were fed with a standard laboratory diet and given free access to tap water, living in a controlled room temperature (22 ± 1 °C), humidity (65 ± 5%) with a 12:12 h light/dark cycle. All animals have received humane care in compliance with the institutional animal care guidelines approved by the Experimental Animal Ethical Committee of Shanghai University of Traditional Chinese Medicine (Approval nzumber: PZSHUTCM19011801).
RNA isolation and Real-time PCR analysis Serum total RNA from C57BL/6 mice treated with TSN for both 6 h and 12 h as well as vehicle control group was isolated by using Trizol reagent. The RNA content was determined and cDNA was synthesized using reverse transcriptase kits according to the instruction. The primers for miRNA were obtained from Sangon Biotech. (Shanghai) and 2
Phytomedicine 58 (2019) 152867
F. Yang, et al.
Table 1 (continued)
Table 1 List of the miRNA primers.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53
54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71
Name
Forward primer sequence
mmu-miR-122-3p mmu-miR-1b-5p mmu-miR-141-5p mmu-miR-669i mghv-miR-M1-14-5p mmu-miR-344d-2-5p mmu-miR-344d-3-5p mmu-miR-192-3p mcmv-miR-m01-4-3p mcmv-miR-m108-1-3p mmu-miR-599 mmu-miR-96-3p mmu-miR-217-3p mmu-miR-670-3p mmu-miR-669m-3p mmu-miR-708-3p mmu-miR-679-5p mmu-miR-135b-5p mmu-miR-5104 mmu-miR-3105-3p mmu-miR-1946b mmu-miR-1933-3p mmu-miR-125a-3p mmu-miR-1198-3p mmu-miR-467b-3p mmu-miR-669a-3-3p mmu-miR-697 mmu-miR-3061-3p mmu-miR-770-3p mmu-miR-5108 mmu-miR-680 mmu-miR-3087-5p mmu-miR-298-5p mmu-miR-5121 mmu-miR-7b-5p mmu-miR-3085-5p mmu-miR-3103-5p mmu-miR-5621-5p mmu-miR-125b-1-3p mmu-miR-3102-5p mmu-miR-5615-5p mmu-miR-666-5p mmu-miR-493-5p mmu-miR-511-3p mmu-miR-299a-5p/mmumiR-299b-5p mmu-miR-1249-5p mmu-miR-5129-5p mmu-miR-3074-5p mmu-miR-133a-5p mmu-miR-344i mmu-miR-3067-3p mmu-miR-3092-3p mmu-miR-465a-3p/mmumiR-465b-3p/mmu-miR465c-3p mmu-miR-295-5p mmu-miR-1982-5p mmu-miR-3094-5p mmu-miR-365-1-5p mmu-miR-1962 mmu-miR-5625-5p mmu-miR-879-3p mmu-miR-26a-1-3p mmu-miR-3077-5p mghv-miR-M1-13-5p mmu-miR-380-5p mmu-miR-3102-5p.2-5p mmu-miR-292a-5p mmu-miR-367-3p mmu-miR-700-3p mmu-miR-1948-3p mmu-miR-540-5p mmu-miR-1966-5p
CGCGCGCGAAACGCCATTATCACACTAA GCGCGCGCGTACATACTTCTTTACATTCCA AGCGCATCTTCCAGTGCAGTGTTGGA GCGCGCGTGCATATACACACATGCATAC CCCCGTTCTGGATGCTGTGGGAC CGCGAGTCTGGTTGCTGGCTATATTCCA AGCGCGAGTCAGGCTAGTGGTTATACTCC CGCGCTGCCAATTCCATAGGTCACAG AGCGCCGCGTGGTAGCATTAGAAC CGTTTCTGACGGTGGCTCGTGTCG GCGCGCGCGTTGTGTCAGTTTATCAAAC CGCGCGCAATCATGTGTAGTGCCAATAT CGCGCCATCAGTTCCTAATGCATTGCCT CGCGCGTTTCCTCATATCCATTCAGGAGTGT CGGCCGCGCATATACATCCACACAAACATAT CGCGCGCAACTAGACTGTGAGCTTCTAG GCGGGACTGTGAGGTGACTCTTGGT GCGCGCGTATGGCTTTTCATTCCTATGTGA CCTGTGCTAGTGAGGTGGCTCAGCA CGCGACTGCTTATGAGCTTGCACTCC GCCGGGCAGTGGTGGC CGCGCCAGGACCATCAGTGTGACTAT CGACAGGTGAGGTTCTTGGGAGCC CGCGAAGCTAGCCTCTAACTCATGGC CGCGCGCGATATACATACACACACCAACAC CGCGCGCGACATAACATACACACACATGTAT CGCGAACATCCTGGTCCTGTGGAGA CGCGCTACCTTTGATAGTCCACTGCC CGTGGGCCTGACGTGGAGC GCGCGGTAGAGCACTGGATGGTTT GGGCATCTGCTGACATGGGGG GCAGGGCAGGGCAAGAGTTGAG GGCAGAGGAGGGCTGTTCTTCCC GCGCGAGCTTGTGATGAGACATCTCC CCGCGCGTGGAAGACTTGTGATTTTGTTGT AGGTGCCATTCCGAGGGCCAAG GCGGGAGGGAGGATCTGCTGTTAG AGGAGGTCCTGGGGCCG CACGGGTTAGGCTCTTGGGAGCT GTGAGTGGCCAGGGTGGGG CGCGCGCTTGGTTGTTTTCTGAGACAGA GCGGGCACAGCTGTGAGAGC CCGCGCGTTGTACATGGTAGGCTTTC GCGCGCGAATGTGTAGCAAAAGACAGGAT GCGCGTGGTTTACCGTCCCACATACAT
72 73 74 75 76 77 78 79 80 81 82
Name
Forward primer sequence
mmu-miR-3472 mmu-miR-208b-3p mmu-miR-327 mmu-miR-3104-5p mmu-miR-212-5p mmu-miR-1912-3p mmu-miR-3063-3p mmu-miR-299a-3p mmu-miR-450b-3p mmu-miR-188-3p RNU6-2
CGCGTAATAGCCAGAAGCTGGAAGGAACC CGCGCGCGATAAGACGAACAAAAGGTTTGT CGCGACTTGAGGGGCATGAGGAT TAGGGGGCAGGAGCCGGA CGCGACCTTGGCTCTAGACTGCTTACT CGCGCACAGAACATGCAGTGAGAACT GCGTGAGGAATCCTGATCTCTCGCC AGCGTATGTGGGACGGTAAACCGCTT CGCGCGATTGGGAACATTTTGCATGCAT CGCTCCCACATGCAGGGTTTGCA AACGCTTCACGAATTTGCGT
GGAGGGAGGGGATGGGCC GCGCGATGTGGGGGCATTGGTATTTTC CGGTTCCTGCTGAACTGAGCCAGT CGCGCGGCTGGTAAAATGGAACCAAAT CGAAGTCAGGCTCCTGGCTGGA CCAAGCGGCTGCCCTGG CGGAATGGGGCTGTTTCCCCTCC GCGCGGATCAGGGCCTTTCTAAGTAGA
CGCGACTCAAATGTGGGGCACACTTC TTGGGAGGGTCCTGGGGAGG GCGCGCGTGTTGGGGACATTTTTAAAGC CGAGGGACTTTTGGGGGCAGATGTG GAGAGGCTGGCACTGGGACACAT CGCGCCCGGAAGTTCTTGAGTAGGA CGCGGCTTATGGCTTCAAGCTTTCGG GCGCGCCTATTCTTGGTTACTTGCACG GCGGACGGGTGGGCG GCGTGGGAAGAGTCTGTTGAGTGGC GCGCGATGGTTGACCATAGAACATGCG GGTGGTGCAGGCAGGAGAGC CGCGACTCAAACTGGGGGCTCTTTTG CGCGCGAATTGCACTTTAGCAATGGTGA CACGCGGGAACCGAGTCCAC CGCGTTTAGGCAGAGCACTCGTACAG GCCAAGGGTCACCCTCTGACTCTGT AAGGGAGCTGGCTCAGGAGAGAGTC
Fig. 1. TSN induced liver injury in mice. (A) TSN increased serum ALT and AST activities in mice. (B) Liver histological evaluation. Representative images from each experimental group in C57BL/6 mice are shown. Arrows indicate nuclear shrinkage and hepatocellular necrosis. Data is shown as means ± SEM (n = 7), *p < 0.05, **p < 0.01 compared with vehicle control group.
3
Phytomedicine 58 (2019) 152867
F. Yang, et al.
Table 2 The up-regulated and down-regulated hepatic miRNAs in mice-treated with TSN for 12 h (>10 fold).
Fig. 2. Effects of TSN on serum miRNA expression profile. HCA of altered miRNA expression in serum from control vehicle mice and mice treated with TSN for 12 h. HCA was performed with miRNAs of 10 fold-changed. Rows, miRNA; Column, Vehicle control (10% PG) group and TSN-treated 12 h group. For each miRNA, red color indicates miRNA with high expression, while green color indicates miRNA with low expression.
were shown in Table 1. Real-time PCR was performed by using miScript PCR Starter Kit according to the instruction. The relative expression level of miRNA was normalized to the level of U6 small nuclear RNA (snRNA) levels, analyzed by the 2−△△Ct method and given as ratio compared with the control. Statistical analysis Data were expressed as means ± standard error of the mean (SEM). The significance of differences between two groups was evaluated by Student's t-test, and between multiple groups was evaluated by one-way ANOVA with LSD post hoc test. p < 0.05 was considered as statistically significant. Results TSN induced liver injury in mice As shown in Fig. 1A, TSN elevated serum ALT (p < 0.01) and AST (p < 0.01) activities when mice were intraperitoneally injected with TSN (10 mg/kg) for both 12 h and 24 h. The results of liver histological evaluation further confirmed that TSN (10 mg/kg) induced obvious liver damages including nuclear shrinkage and hepatocellular necrosis when mice were treated with TSN (10 mg/kg) for both 12 h and 24 h (Fig. 1B). The elevation of serum ALT/AST activities in mice treated with TSN for 6 h was just about twice, and this elevation is too weak to indicate the occurrence of liver injury (Fig. 1A). Additionally, the
Accession ID
Name
Fold change
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53
MIMAT0017005 MIMAT0005835 MIMAT0004533 MIMAT0005840 MIMAT0018174 MIMAT0014961 MIMAT0014807 MIMAT0017012 MIMAT0005539 MIMAT0005558 MIMAT0012772 MIMAT0017021 MIMAT0017072 MIMAT0017242 MIMAT0009419 MIMAT0003498 MIMAT0003455 MIMAT0000612 MIMAT0020611 MIMAT0014942 MIMAT0009443 MIMAT0009397 MIMAT0004528 MIMAT0017332 MIMAT0003478 MIMAT0017251 MIMAT0003487 MIMAT0014829 MIMAT0003891 MIMAT0020616 MIMAT0003457 MIMAT0014895 MIMAT0000376 MIMAT0020629 MIMAT0000678 MIMAT0014878 MIMAT0014937 MIMAT0022369 MIMAT0004669 MIMAT0014933 MIMAT0022355 MIMAT0003737 MIMAT0017276 MIMAT0017281 MIMAT0000377 MIMAT0014804 MIMAT0020640 MIMAT0014856 MIMAT0003473 MIMAT0022503 MIMAT0014841 MIMAT0014906 MIMAT0004217
722.260 153.972 68.519 63.120 43.417 39.653 39.436 30.895 29.769 27.125 24.575 20.120 19.718 19.305 19.207 17.815 17.355 16.802 16.504 16.317 15.551 14.959 13.948 12.721 12.094 11.601 10.979 10.939 10.692 −10.101 −10.309 −10.417 −10.989 −10.989 −11.364 −11.628 −11.765 −12.195 −12.346 −12.658 −12.821 −12.821 −12.821 −12.987 −13.514 −13.889 −14.085 −14.286 −15.152 −16.129 −16.393 −17.544 −18.182
54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72
MIMAT0004575 MIMAT0009459 MIMAT0014909 MIMAT0017077 MIMAT0009435 MIMAT0022379 MIMAT0004843 MIMAT0017020 MIMAT0014862 MIMAT0018172 MIMAT0000744 MIMAT0014934 MIMAT0000369 MIMAT0003181 MIMAT0003490 MIMAT0009415 MIMAT0004786 MIMAT0009439 MIMAT0015643
mmu-miR-122-3p mmu-miR-1b-5p mmu-miR-141-5p mmu-miR-669i mghv-miR-M1-14-5p mmu-miR-344d-2-5p mmu-miR-344d-3-5p mmu-miR-192-3p mcmv-miR-m01-4-3p mcmv-miR-m108-1-3p mmu-miR-599 mmu-miR-96-3p mmu-miR-217-3p mmu-miR-670-3p mmu-miR-669m-3p mmu-miR-708-3p mmu-miR-679-5p mmu-miR-135b-5p mmu-miR-5104 mmu-miR-3105-3p mmu-miR-1946b mmu-miR-1933-3p mmu-miR-125a-3p mmu-miR-1198-3p mmu-miR-467b-3p mmu-miR-669a-3-3p mmu-miR-697 mmu-miR-3061-3p mmu-miR-770-3p mmu-miR-5108 mmu-miR-680 mmu-miR-3087-5p mmu-miR-298-5p mmu-miR-5121 mmu-miR-7b-5p mmu-miR-3085-5p mmu-miR-3103-5p mmu-miR-5621-5p mmu-miR-125b-1-3p mmu-miR-3102-5p mmu-miR-5615-5p mmu-miR-666-5p mmu-miR-493-5p mmu-miR-511-3p mmu-miR-299a-5p/mmu-miR-299b-5p mmu-miR-1249-5p mmu-miR-5129-5p mmu-miR-3074-5p mmu-miR-133a-5p mmu-miR-344i mmu-miR-3067-3p mmu-miR-3092-3p mmu-miR-465a-3p/mmu-miR-465b-3p/ mmu-miR-465c-3p mmu-miR-295-5p mmu-miR-1982-5p mmu-miR-3094-5p mmu-miR-365-1-5p mmu-miR-1962 mmu-miR-5625-5p mmu-miR-879-3p mmu-miR-26a-1-3p mmu-miR-3077-5p mghv-miR-M1-13-5p mmu-miR-380-5p mmu-miR-3102-5p.2-5p mmu-miR-292a-5p mmu-miR-367-3p mmu-miR-700-3p mmu-miR-1948-3p mmu-miR-540-5p mmu-miR-1966-5p mmu-miR-3472
−18.868 −18.868 −18.868 −19.231 −19.608 −20.000 −21.739 −23.810 −23.810 −23.810 −24.390 −29.412 −30.303 −31.250 −31.250 −32.258 −32.258 −34.483 −35.714
(continued on next page) 4
Phytomedicine 58 (2019) 152867
F. Yang, et al.
analyzed by using the miRNA array. The results of HCA showed that there was a large amount of differentially expressed miRNAs in serum between vehicle control mice with mice treated with TSN (Fig. 2). As shown in Table 2, there were total 81 miRNAs with the fold difference >10.0 that were differentially expressed in serum from mice treated with TSN for 12 h as compared with vehicle control mice. Among these altered 81 miRNAs, 29 miRNAs were up-regulated and 52 miRNA were down-regulated in serum from TSN-treated mice.
Table 2 (continued)
73 74 75 76 77 78 79 80 81
Accession ID
Name
Fold change
MIMAT0004939 MIMAT0004867 MIMAT0014939 MIMAT0017053 MIMAT0014958 MIMAT0014833 MIMAT0004577 MIMAT0003512 MIMAT0004541
mmu-miR-208b-3p mmu-miR-327 mmu-miR-3104-5p mmu-miR-212-5p mmu-miR-1912-3p mmu-miR-3063-3p mmu-miR-299a-3p mmu-miR-450b-3p mmu-miR-188-3p
−50.000 −55.556 −58.824 −66.667 −71.429 −71.429 −90.909 −250.000 −333.333
Validation of these differentially expressed miRNAs Next, we further validated the expression of those altered 81 miRNAs in serum from vehicle control mice and TSN-treated mice by using Real-time PCR assay. The results showed that the expression of 22 miRNAs was in coinciding with the results from miRNA chip, including miR-122-3p, mcmv-miR-m01-4-3p, miR-1946b, miR-217-3p, miR-6703p, miR-770-3p, miR-1198-3p, miR-125a-3p, miR-1933-3p, miR-30613p, miR-3105-3p, miR-5104, miR-669a-3-3p, miR-697, miR-708-3p, miR-367-3p, miR-292a-5p, miR-3102-5p, miR-188-3p, miR-212-5p,
results of liver histological evaluation showed that TSN did not induce obvious liver damages when mice were treated with TSN (10 mg/kg) for 6 h (Fig. 1B) Effects of TSN on serum miRNA expression profile The effects of TSN on serum miRNA expression profile were
Fig. 3. Validation of these differentially expressed miRNAs. The expression of 81 altered miRNAs in serum from TSN-treated mice from miRNA array was further detected by Real-time PCR assay and 22 of them were coinciding with the results from miRNA chip. (A) Up-regulated serum miRNAs. (B) Down-regulated serum miRNAs. (C & D) The change of miRNA is not match with the results from miRNA chip. Data is shown as means ± SEM (n = 7), *p < 0.05, **p < 0.01, ***p < 0.001 compared with vehicle control group. 5
Phytomedicine 58 (2019) 152867
F. Yang, et al.
Fig. 4. Determination of the specificity of these 22 above candidate miRNAs. (A) Serum ALT/AST activities in mice treated with APAP or DB. (B) Serum ALT/ AST activities in mice treated with MCT. (C) The results of the change of these above 22 miRNAs in serum from APAP-treated mice. (D) The results of the change of these above 22 miRNAs in serum from DB-treated mice. (E) The results of the change of these above 22 miRNAs in serum from MCT-treated mice. Data is shown as means ± SEM (n = 6), *p < 0.05, **p < 0.01, ***p < 0.001 compared with vehicle control group.
From the results, we found that the expression of serum miR-31025p and miR-292a-5p was decreased in mice treated with TSN, APAP and DB, but had no alteration in mice treated with MCT (Figs. 3A and 4C–E, Table 3). Besides, the expression of miR-1946b, miR-217-3p, miR-670-3p and miR-770-3p in serum was found to be significantly increased in TSN-, APAP- and DB-induced liver injury, but had a remarkable decrease in mice treated with MCT (Figs. 3A and 4C–E, Table 3).
miR-3092-3p and miR-365-1-5p (Fig. 3A–B). The change of other 59 miRNAs was not consistent with the results from miRNA chip (Fig. 3C–D). Data in Fig. 1A showed that TSN obviously enhanced serum ALT/ AST activities when mice were treated with TSN (10 mg/kg) for both 12 h and 24 h (p < 0.01). When mice were treated with TSN (10 mg/ kg) for 6 h, the increase of serum ALT/AST activities is too weak to indicate the liver injury. Additionally, the results of liver histological evaluation also did not show obvious liver damages. However, data in Fig. 3A showed that the expression of these above 22 miRNAs was all obviously changed in serum from mice treated with TSN for 6 h.
Discussion Drug-induced liver injury (DILI) is one of the most serious adverse drug reactions and may result in acute liver failure (Hunt et al., 2017). The serious cases may be life-threatening (Hayashi et al., 2017). With the rapid development of the pharmaceutical industry, new drugs have come out at home and abroad, and the incidence of DILI has increased accordingly, which even leads to clinical trial failure and drug withdrawal from the market worldwide (Chen et al., 2015; Regev, 2014). With the wide application of TCMs in the world, TCMs-induced liver
Determining the specificity of these 22 above candidate miRNAs Data in Fig. 4C–E and Table 3 showed that the expression of miR367-3p was not changed in serum from APAP-, DB- or MCT-treated mice. The expression of miR-122-3p and mcmv-miR-m01-4-3p was increased in serum from mice treated with all those above hepatotoxicants including TSN, APAP, DB and MCT (Figs. 3A and 4C–E, Table 3). 6
Phytomedicine 58 (2019) 152867
F. Yang, et al.
The expression of serum miR-367-3p was significantly decreased in TSN-treated mice in this study. Notably, this decrease was not occurred in serum from APAP, MCT or DB-treated mice. These results imply that miR-367-3p may be a specific and sensitive biomarker for TSN-induced liver injury, which will be helpful for the quick diagnosis of liver injury induced by TSN and Toosendan Fructus. Meanwhile, this guess also needs further validation in more studies from liver injury induced by other drugs or hepatotoxicants. It is reported that miR-367-3p was involved in the metastasis or growth of hepatocelluar carcinoma, glioma and endometrial cancer (Xu et al., 2016; Ma et al., 2018; Liu et al., 2018). Furthermore, miR-367-3p was used to be served as a potential serum diagnostic biomarker for germ cell cancer (Leão et al., 2018; Murray et al., 2016; Syring et al., 2015). There is still no evidence that miR-367-3p is related to DILI. So it is the first time that miR-367-3p has been shown to be a potential candidate biomarker for liver injury. microRNA-122 has already been found to be a very early and sensitive biomarker for DILI, and it constitutes 50% (human) and 70% (mouse) of all miRNA transcripts in the liver (Lagos-Quintana et al., 2002). It is reported that miR-122 is decreased in the liver and increased in serum after insult, which has been found to be elevated in serum sooner than the change of ALT activity (Starkey et al., 2011; Girard et al., 2008). miR-122 is a precursor for miR-122-3p, and the expression of serum miR-122-3p was significantly elevated in TSN-treated mice. Additionally, this change is more sensitive than the alternation of serum ALT and AST activities. Further results showed that miR-122-3p also increased in serum from APAP-, DB- and MCT-treated mice. Our results further evidenced that miR-122-3p may be a universal sensitive biomarker for reflecting liver injury. The increased expression of serum mcmv-miR-m01-4-3p was not only occurred in serum from TSN-treated mice, but also in serum from APAP, MCT and DB-treated mice. We think that mcmv-miR-m01-4-3p may also be a universal sensitive biomarker indicating the occurrence of liver injury but lack of specificity. It is lack of the reports about this miRNA, so this hypothesis needs further validation in more studies from liver injury induced by other hepatotoxicants. It has been reported that MCT, belongs to pyrrolizidine alkaloids, is generally used to induce experimental HSOS (DeLeve et al., 1999; Nakamura et al., 2012). The primary site of the toxic injury involved in MCT-induced HSOS is the damage on hepatic sinusoidal endothelial cells (HSECs) (DeLeve et al., 1999; Nakamura et al., 2012; Vion et al., 2015). The liver injury induced by APAP, DB and TSN mainly belongs to liver parenchymal injury. We found that serum expression of miR292a-5p and miR-3102-5p was not only decreased in TSN-treated mice, but also decreased in APAP- and DB-induced liver injury. However, serum expression of miR-292a-5p and miR-3102-5p was not altered in serum from MCT-treated mice. What's more, serum expression of miR1946b, miR-217-3p, miR-670-3p and miR-770-3p was found to be significantly increased in serum from TSN-, APAP- and DB-treated mice, whereas serum expression of these above 4 miRNAs was decreased in serum from MCT-treated mice. It might be due to the fact that MCTinduced HSOS is different from hepatic parenchymal injury caused by APAP, DB and TSN. Except miR-770-3p has been reported to be potentially used as a candidate biomarker for aging (Lee et al., 2018), there are still no reports about miR-292a-5p, miR-3102-5p, miR-1946b, miR-217-3p and miR-670-3p. We speculated that the decreased expression of serum miR-292a-5p and miR-3102-5p, and the increased expression of serum miR-1946b, miR-217-3p, miR-670-3p and miR770-3p may be related with liver parenchymal injury. In conclusion, we found that miR-367-3p might be a specific and sensitive biomarker for reflecting TSN-induced liver injury, while miR122-3p and mcmv-miR-m01-4-3p might be commonly universal biomarkers for liver injury induced by exogenous hepatotoxicants with high sensitivity. Moreover, miR-292a-5p, miR-3102-5p miR-1946b, miR-217-3p, miR-670-3p and miR-770-3p might be related with liver parenchymal injury. The discovery of more and more biomarkers will contribute to the diagnosis and therapeutic intervention of liver injury
Table 3 The alternation of 22 miRNAs in the liver injury induced by TSN, APAP, DB and MCT in mice. Name
TSN
APAP
DB
MCT
miR-367-3p miR-122-3p mcmv-miR-m01-4-3p miR-292a-5p miR-3102-5p miR-1946b miR-217-3p miR-670-3p miR-770-3p miR-1198-3p miR-125a-3p miR-1933-3p miR-3061-3p miR-3105-3p miR-5104 miR-669a-3-3p miR-697 miR-708-3p miR-188-3p miR-212-5p miR-3092-3p miR-365-1-5p
↓ ↑ ↑ ↓ ↓ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↓ ↓ ↑ ↓
NC ↑ ↑ ↓ ↓ ↑ ↑ ↑ ↑ ↓ NC ↑ ↓ NC NC ↑ NC NC ↓ ↓ ↑ ↓
NC ↑ ↑ ↓ ↓ ↑ ↑ ↑ ↑ ↑ ↑ ↓ ↑ ↑ ↓ NC ↑ ↑ NC ↑ NC ↑
NC ↑ ↑ NC NC ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↑ NC ↓ ↓ NC NC NC NC
injury frequently develops in cases of their excessive or inappropriate use. It is usually self-limited, but sometimes it causes serious complications, such as liver cirrhosis, acute liver failure and even death, unless an emergent liver transplantation is performed (Wang et al., 2018). However, due to non-specific or hidden clinical manifestations, DILI is not easily detected or diagnosed. Serum ALT and AST activities are generally used for DILI diagnosis, but they suffer from a lack of liver specificity and sensitivity. Thus, to find new sensitive and specific biomarkers for DILI become urgent, which will be helpful for its diagnosis and treatment. Toosendanin (TSN) is the main active compound in Toosendan Fructus with good insecticidal activity and promising anti-tumor capacity (Wu et al., 2010; Zhang et al., 2005). However, its hepatotoxicity has severely limited the clinical application of TSN and Toosendan Fructus. In this study, the results of serum ALT/AST activities and liver histological evaluation showed that TSN induced obvious liver injury in mice, and this result is consistent with those previous reported studies (Qi et al., 2008; Zhang et al., 2008; Lu et al., 2016; Jin et al., 2019). After integrative analysis of altered miRNAs from the results of miRNA array and further Real-time PCR validation, the expression of total 22 miRNAs was found to be changed in serum from mice treated with TSN for both 6 h and 12 h. However, the results of serum ALT/AST activities and liver histological evaluation did not show any obvious liver damages in mice treated with TSN for 6 h. These results imply that these above 22 miRNAs may be candidate biomarkers for reflecting TSN-induced liver injury. Acetaminophen is a commonly used antipyretic and analgesic drug, but the hepatotoxicity due to its overdose is classic DILI (Bunchorntavakul and Reddy, 2018). DB is the main hepatotoxic compound isolated from Airpotato yam, a traditionally used herbal medicine in China, which is also reported to induce serious liver injury both in clinic and in experimental studies (Wang et al., 2010, 2011; Ma et al., 2014). MCT is abundant in Crotalaria genus, which is also a traditionally used herbal medicine in China (Tu et al., 2013). MCT is generally used to induce experimental hepatic sinusoidal obstruction syndrome (HSOS) (DeLeve et al., 1999; Nakamura et al., 2012). To find a specific miRNA biomarker for reflecting the hepatotoxicity induced by TSN, we further analyzed whether these above 22 miRNAs were also changed in liver injuries induced by other hepatotoxicants including APAP, DB and MCT, or just specifically changed in liver injury induced by TSN. 7
Phytomedicine 58 (2019) 152867
F. Yang, et al.
induced by TSN or other hepatotoxicants, which will be helpful for improving the safety and medicinal value of Toosendan Fructus or other drugs including TCMs in clinic.
of microRNA and mRNA expression profiles highlights the complex and dynamic behavior of toosendanin-induced liver injury in mice. Sci. Rep. 6 (1), 34225. Ma, J., Li, D., Kong, F.F., Yang, D., Yang, H., Ma, X.X., 2018. miR-302a-5p/367-3pHMGA2 axis regulates malignant processes during endometrial cancer development. J. Exp. Clin. Cancer Res. 37 (1), 19. Ma, J.G., Li, X.Y., 2017. MicroRNAs are involved in the toxicity of microcystins. Toxin Rev. 36 (2), 165–175. Ma, Y.B., Niu, C.W., Wang, J.M., Ji, L.L., Wang, Z.T., 2014. Diosbulbin B-induced liver injury in mice and its mechanism. Hum. Exp. Toxicol. 33 (7), 729–736. Medina-Caliz, I., Garcia-Cortes, M., Gonzalez-Jimenez, A., Cabello, M.R., Robles-Diaz, M., Sanabria-Cabrera, J., Sanjuan-Jimenez, R., Ortega-Alonso, A., Garcia-Munoz, B., Moreno, I., Jimenez-Perez, M., Fernandez, M.C., Gines, P., Prieto, M., Conde, I., Hallal, H., Soriano, G., Roman, E., Castiella, A., Blanco-Reina, E., Montes, M.R., Quiros-Cano, M., Martin-Reyes, F., Lucena, M.I., Andrade, R.J., Spanish DILI Registry, 2018. Herbal and dietary supplement-induced liver injuries in the Spanish DILI registry. Clin. Gastroenterol. Hepatol. 16 (9), 1495–1502. Murray, M.J., Huddart, R.A., Coleman, N., 2016. The present and future of serum diagnostic tests for testicular germ cell tumours. Nat. Rev. Urol. 13 (12), 715–725. Nakamura, K., Hatano, E., Narita, M., Miyaqawa-Hayashino, A., Koyama, Y., Naqata, H., 2012. Sorafenib attenuates monocrotaline-induced sinusoidal obstruction syndrome in rats through suppression of JNK and MMP-9. J. Hepatol. 57 (5), 1037–1043. Nathwani, R.A., Pais, S., Reynolds, T.B., Kaplowitz, N., 2005. Serum alanine aminotransferase in skeletal muscle diseases. Hepatology 41 (5), 380–382. Qi, S.Y., Jin, R.M., Liu, H.J., Huang, Y.W., 2008. Mechanism studies on hepatotoxicity of rats induced by Fructus Toosendan. Zhongguo Zhong Yao Za Zhi 33, 2045–2047. Regev, A., 2014. Drug-induced liver injury and drug development: industry perspective. Semin. Liver. Dis. 34 (02), 227–239. Shen, J., Zhang, J., Wen, J., Ming, Q., Zhang, J., Xu, Y., 2015. Correlation of serum alanine aminotransferase and aspartate aminotransferase with coronary heart disease. Int. J. Clin. Exp. Med. 8, 4399–4404. Starkey, L., Philip, J., Dear, J., Platt, V., Simpson, K.J., Craig, D.N., Antoine, D.J., Park, B.K., 2011. Circulating microRNAs as potential markers of human drug-induced liver injury. Hepatology 54 (5), 1767–1776. Syring, I., Bartels, J., Holdenrieder, S., Kristiansen, G., Müller, S.C., Ellinger, J., 2015. Circulating serum miRNA (miR-367-3p, miR-371a-3p, miR-372-3p and miR-373-3p) as biomarkers in patients with testicular germ cell cancer. J. Urol. 193 (1), 331–337. Tu, M.J., Sun, S.Y., Wang, K., Peng, X.Y., Wang, R.H., Li, L.P., Zeng, S., Zhou, H., Jiang, H.D., 2013. Organic cation transporter 1 mediates the uptake of monocrotaline and plays an important role in its hepatotoxicity. Toxicology 311 (3), 225–230. Vion, A.C., Rautou, P.E., Durand, F., Boulanger, C.M., Valla, D.C., 2015. Interplay of inflammation and endothelial dysfunction in bone marrow transplantation: focus on hepatic veno-occlusive disease. Semin. Thromb. Hemost. 41 (06), 629–643. Wang, J.M., Ji, L.L., Liu, H., Wang, Z.T., 2010. Study of the hepatotoxicity induced by Dioscorea bulbifera L. rhizome in mice. Biosci. Trends 4, 79–85. Wang, J.M., Liang, Q.N., Ji, L.L., Liu, H., Wang, C.H., Wang, Z.T., 2011. Gender-related difference in liver injury induced by Dioscorea bulbifera L. rhizome in mice. Hum. Exp. Toxicol 30 (9), 1333–1341. Wang, R., Qi, X.S., Yoshida, E.M., Méndez-Sánchez, N., Teschke, R., Sun, M., Liu, X., Su, C., Deng, J., Deng, H., Hou, F., Guo, X., 2018. Clinical characteristics and outcomes of traditional Chinese medicine-induced liver injury: a systematic review. Expert Rev. Gastroenterol. Hepatol. 12 (4), 425–434. Wang, Y., Chen, T., Tong, W., 2014. miRNAs and their application in drug-induced liver injury. Biomark. Med. 8 (2), 161–172. Wu, S.B., Su, J.J., Sun, L.H., Wang, W.X., Zhao, Y., Li, H., Hu, J.F., 2010. Triterpenoids and steroids from the fruits of Melia toosendan and their cytotoxic effects on two human cancer cell lines. J. Nat. Prod. 73 (11), 1898–1906. Xu, H., Zhang, J.L., 2011. Natural products-based insecticidal agents 9. Design, semisynthesis and insecticidal activity of 28-acyloxy derivatives of toosendanin against Mythimna separata Walker in vivo. Bioorg. Med. Chem. Lett. 21 (7), 1974–1977. Xu, J., Lin, H., Li, G., Sun, Y., Chen, J., Shi, L., Cai, X., Chang, C., 2016. The miR-367-3p increases sorafenib chemotherapy efficacy to suppress hepatocellular carcinoma metastasis through altering the androgen receptor signals. EBioMedicine 12, 55–67. Zhang, B., Wang, Z.F., Tang, M.i., Shi, Y.L., 2005. Growth inhibition and apoptosis-induced effect on human cancer cells of toosendanin, a triterpenoid derivative from chinese traditional medicine. Invest. New Drugs 23 (6), 547–553. Zhang, P., Ye, Y.G., Yang, X.Z., Jiao, Y.T., 2016. Systematic review on Chinese herbal medicine induced liver injury. Evid. Based Complement. Altern. Med. 2016, 3560812. Zhang, S., Cao, L., Wang, Z.R., Li, Z., Ma, J., 2018. Anti-cancer effect of toosendanin and its underlying mechanisms. J. Asian Nat. Prod. Res. 1–13. https://doi.org/10.1080/ 10286020.2018.1451516. Zhang, T., Li, J., Yin, F., Lin, B., Wang, Z., Xu, J., Wang, H., Zuo, D., Wang, G., Hua, Y., Cai, Z., 2017. Toosendanin demonstrates promising antitumor efficacy in osteosarcoma by targeting STAT3. Oncogene 36 (47), 6627–6639. Zhang, Y.H., Qi, X.M., Gong, L.K., Li, Y., Liu, L.L., Xue, X., Xiao, Y., Wu, X., Ren, J., 2008. Roles of reactive oxygen species and MAP kinases in the primary rat hepatocytes death induced by toosendanin. Toxicology 249 (1), 62–68.
Acknowledgments The authors would like to thank KangChen Bio-tech Inc. (Shanghai) for the kind assistant in miRNA array analysis. This work was financially supported by State major science and technology special projects during the 12th five year plan (2015ZX09501004-002-002), the leadership in Science and Technology innovation of the third batch of national “Ten Thousand People Plan” for Lili Ji and the National Key Research and Development Program of China (2018YFC1707302). Conflict of interest We wish to confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome. References Bartel, D.P., 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281–297. Bunchorntavakul, C., Reddy, K.R., 2018. Acetaminophen (APAP or N-Acetyl-pAminophenol) and acute liver failure. Clin. Liver Dis. 22 (2), 325–346. Chinese Pharmacopoeia Commission, 2015. Pharmacopeia of Thepeople's Republic of China (2015) Version. The Medicine Science and Technology Press of China, Beijing, pp. 42. Chen, M.J., Suzuki, A., Borlak, J., Andrade, R.J., Lucena, M.I., 2015. Drug-induced liver injury: interactions between drug properties and host factors. J. Hepatol. 63 (2), 503–514. DeLeve, L.D., McCuskey, R.S., Wang, X.D., Hu, L.P., McCuskey, M.K., Epstein, R.B., Kanel, C.C., 1999. Characterization of a reproducible rat model of hepatic veno-occlusive disease. Hepatology 29 (6), 1779–1991. Girard, M., Jacquemin, E., Munnich, A., Lyonnet, S., Henrion-Caude, A., 2008. miR-122, a paradigm for the role of microRNAs in the liver. J. Hepatol. 48 (4), 648–656. Hayashi, P.H., Rockey, D.C., Fontana, R.J., Tillmann, H.L., Kaplowitz, N., Barnhart, H.X., 2017. Death and liver transplantation within 2 years of onset of drug-induced liver injury. Hepatology 66 (4), 1275–1285. Howell, L.S., Ireland, L., Park, B.K., Goldring, C.E., 2018. MiR-122 and other microRNAs as potential circulating biomarkers of drug-induced liver injury. Expert Rev. Mol. Diagn. 18 (1), 47–54. Hunt, C.M., Papay, J.I., Stanulovic, V., Regev, A., 2017. Drug rechallenge following druginduced liver injury. Hepatology 66 (2), 646–654. Jin, Y., Huang, Z.L., Li, L., Yang, Y., Wang, C.H., Wang, Z.T., Ji, L.L., 2019. Quercetin attenuates toosendanin-induced hepatotoxicity through inducing the Nrf2/GCL/GSH antioxidant signaling pathway. Acta Pharmacol. Sin. 40 (1), 75–85. Kurt, F., Raj, V., Romil, S., 2015. Drug-induced liver injury. Arch. Pathol. Lab. Med. 7, 876–887. Lagos-Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel, W., Tuschl, T., 2002. Identification of tissue-specific microRNAs from mouse. Curr. Biol. 12 (9), 735–739. Leão, R., Agthoven, T., Figueiredo, A., Jewett, M., Fadaak, K., Sweet, J., Ahmad, A.E., Anson-Cartwright, L., Chung, P., Hansen, A., Warde, P., Castelo-Branco, P., O'Malley, M., Bedard, P.L., Looijenga, L., Hamilton, R.J., 2018. Serum miRNA predicts viable disease after chemotherapy in patients with testicular nonseminoma germ cell tumor. J. Urol. 200 (1), 126–135. Lee, E.K., Jeong, H.O., Bang, E.J., Kim, C.H., Mun, J.Y., Noh, S., Gim, J.A., Kim, D.H., Chung, K.W., Yu, B.P., Chung, H.Y., 2018. The involvement of serum exosomal miR500-3p and miR-770-3p in aging: modulation by calorie restriction. Oncotarget 9 (5), 5578–5587. Li, X., You, M., Liu, Y.J., Ma, L., Jin, P.P., Zhou, R., Zhang, Z.X., Hua, B., Ji, X.J., Cheng, X.Y., Yin, F., Chen, Y., Yin, W., 2017. Reversal of the apoptotic resistance of nonsmall-cell lung carcinoma towards TRAIL by natural product toosendanin. Sci. Rep. 7 (1), 42748. Lin, H.X., Ewing, L.E., Koturbash, I., Gurley, B.J., Miousse, I.R., 2017. MicroRNAs as biomarkers for liver injury: current knowledge, challenges and future prospects. Food Chem. Toxicol. 110, 229–239. Liu, X., Zheng, J., Xue, Y., Yu, H., Gong, W., Wang, P., Li, Z., Liu, Y., 2018. PIWIL3/OIP5AS1/miR-367-3p/CEBPA feedback loop regulates the biological behavior of glioma cells. Theranostics 8, 1084–1105. Lu, X.Y., Ji, C., Tong, W., Lian, X.P., Wu, Y., Fan, X.H., Gao, Y., 2016. Integrated analysis
8
Contents lists available at ScienceDirect
Phytomedicine journal homepage: www.elsevier.com/locate/phymed
Original Article
Identification of serum microRNAs as potential toxicological biomarkers for toosendanin-induced liver injury in mice Yang Fana,b,1, Li Lic,1, Yang Ruia,b, Wei Mengjuana, Sheng Yuchenb, Ji Lilia,
T
⁎
a The MOE Key Laboratory for Standardization of Chinese Medicines, Shanghai Key Laboratory of Compound Chinese Medicines and The SATCM Key Laboratory for New Resources and Quality Evaluation of Chinese Medicines, Institute of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine, Shanghai 201203, China b Center for Drug Safety Evaluation and Research, Innovation Research Institute of Traditional Chinese Medicine, Shanghai University of Traditional Chinese Medicine, 1200 Cailun Road, Shanghai 201203, China c Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing 210008, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Toosendanin Hepatotoxicity MicroRNA Biomarker
Background: Toosendan Fructus is traditionally used as an insecticide or digestive tract parasiticide for treating digestive parasites in China. It is recorded to have little toxicity in Chinese Pharmacopoeia and has been found to cause severe liver injury during clinical practice. Purpose: This study aims to identify candidate serum microRNAs (miRNAs) as potential toxicological biomarkers for reflecting the hepatotoxicity induced by toosendanin (TSN), which is the main toxic compound isolated from Toosendan Fructus Methods: Alanine/aspartate aminotransferase (ALT/AST) activities detection and liver histological observation were performed to evaluate the liver injury induced by TSN or other hepatotoxicants in mice. miRNAs chip analysis and Real-time PCR assay were conducted to identify the altered miRNAs in serum from TSN-treated mice Results: The results of serum ALT/AST and liver histological evaluation showed that TSN (10 mg/kg) induced hepatotoxicity in mice. The results of miRNAs chip showed that the expression of 81 serum miRNAs was obviously altered in mice treated with TSN for 12 h, and 22 of them have passed the further validation in serum from mice treated with TSN for both 6 h and 12 h. These 22 miRNAs were supposed to be the candidate toxicological biomarkers for TSN-induced hepatotoxicity with more sensitivity as compared to the alteration of AST or ALT activity. Moreover, the expression of miRNA-122-3p and mcmv-miRNA-m01-4-3p was not only increased in TSN-treated mice, but also increased in mice treated with other hepatotoxicants including acetaminophen (APAP), monocrotaline (MCT) and diosbuibin B (DB). Only the expression of serum miRNA-367-3p was increased in TSN-treated mice but not changed in the liver injury induced by APAP, MCT or DB Conclusion: miR-122-3p and mcmv-miRNA-m01-4-3p may be two commonly sensitive biomarkers for reflecting the hepatotoxicity induced by exogenous hepatotoxicants, and miR-367-3p may be a specific biomarker for reflecting the liver injury induced by TSN.
Introduction The liver damage caused by the drug itself or/and its metabolites is called drug-induced liver injury (DILI). Drugs may cause liver injury in a predictable dose-dependent manner in most human and experimental animals (intrinsic DILI) or in an unpredictable non-dose-dependent
manner (idiosyncratic DILI) (Kurt et al., 2015). With the wide acceptance and application of traditional Chinese medicines (TCMs) in the world, the hepatotoxicity induced by herbal and dietary supplements has become a rising cause for DILI (Zhang et al., 2016; Medina-Caliz et al., 2018). Recent studies have shown that DILI caused by TCMs accounts for about 25.71% of clinical drugs-induced liver injury and a
Abbreviations: ALT, alanine aminotransferase; APAP, acetaminophen; AST, aspartate aminotransferase; CMC-Na, carboxymethylcellulose sodium; DB, diosbuibin B; DILI, drug-induced liver injury; HCA, hierarchical clustering analysis; H&E, haematoxylin and eosin; HSECs, hepatic sinusoidal endothelial cells; HSOS, hepatic sinusoidal obstruction syndrome; i.g., intragastric administration; i.p, intraperitoneal administration; MCT, monocrotaline; miRNAs, microRNAs; PBS, phosphate buffered saline; PG, propylene glycol; SEM, standard error of the mean; snRNA, small nuclear RNA; TCMs, traditional Chinese medicines; TSN, toosendanin ⁎ Corresponding author. E-mail address: [email protected] (L. Ji). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.phymed.2019.152867 Received 18 October 2018; Received in revised form 26 January 2019; Accepted 17 February 2019 0944-7113/ © 2019 Elsevier GmbH. All rights reserved.
Phytomedicine 58 (2019) 152867
F. Yang, et al.
Treatment of animals
gradually increased proportion of TCMs-induced liver injury was observed over the years, which has become a non-negligible problem (Wang et al., 2018). Toosendan Fructus, the ripe fruit of Melia toosendan Sieb. et Zucc. (Meliaceae), is traditionally used as an insecticide or digestive tract parasiticide for treating digestive parasites in China for thousands of years. Toosendan Fructus has also been recorded as a little toxic drug in Chinese Pharmacopoeia (Chinese Pharmacopoeia, 2015). TSN is the main active ingredient with anti-tumor and insecticidal activity isolated from Toosendan Fructus (Xu and Zhang, 2011; Li et al., 2017; Zhang et al., 2017, 2018). However, TSN is also reported to induce serious hepatotoxicity both in vivo and in vitro (Zhang et al., 2008; Lu et al., 2016; Jin et al., 2019). The current gold-standard biomarkers for reflecting liver injury are the elevated serum ALT and AST activities, which are also generally used for DILI diagnosis in clinic. Due to the limitation in sensitivity and specificity, detecting the increased serum ALT and AST activities failed to meet current requirements for reflecting drug-induced hepatotoxicity in clinic. Except distributed in liver, ALT or AST also exists in the heart and skeletal muscles, and some studies reported that the elevation of these two conventional biomarkers was not only related to liver injury (Nathwani et al., 2005; Shen et al., 2015). So, more sensitive and specific biomarkers for reflecting DILI are needed. microRNAs are endogenously expressed small non-coding RNA molecules, and they are reported to be involved in various physiological and pathological processes in human (Bartel, 2004). It has been reported that miRNAs are associated with the hepatotoxicity induced by toxins such as microcystin (Ma and Li, 2017). miRNA has the possibility to be served as a biomarker for reflecting liver injury due to its stability in blood or other biofluids (Wang et al., 2014). In previous studies, some miRNAs have already been found as potential biomarkers for reflecting liver injury induced by drugs, especially like miR-122 (Lin et al., 2017; Howell et al., 2018). This study aims to find the candidate miRNA biomarkers with high sensitivity or specificity for reflecting the liver injury induced by TSN.
In the first experiment, the C57BL/6 mice were randomly divided into 5 groups, respectively. (1) Normal control group (n = 7), (2) vehicle control group (n = 7), (3) TSN (6 h) group (n = 7), (4) TSN (12 h) group (n = 7), (5) TSN (24 h) group (n = 7). TSN was dissolved in 10% propylene glycol (PG). Mice were given (intraperitoneal administration, i.p.) with TSN once with the dose of 10 mg/kg. Mice in vehicle control group were given with 10% PG (i.p.). Mice were sacrificed at different times after TSN injection. After treatment, blood and liver tissues from each group were collected. In the second experiment, the C57BL/6 mice were randomly divided into 6 groups. (1) APAP vehicle control (n = 6), (2) APAP (300 mg/kg) (n = 6), (3) MCT vehicle control (n = 6); (4) MCT (360 mg/kg) (n = 6), (5) DB vehicle control (n = 6), (6) DB (300 mg/kg) (n = 6). APAP was dissolved in hot normal saline solution. DB was dissolved in 0.5% carboxymethylcellulose sodium (CMC-Na) solution. MCT was added to distilled water and titrated to pH 3.0 with 0.1 N HCl to completely dissolve the solid. Subsequently, the solution was neutralized using 0.5 N NaOH to pH 7.0. Mice were given (intragastric administration,i.g.) with APAP and sacrificed at 6 h after APAP treatment. Mice were given (i.g.) with DB and sacrificed at 24 h after DB treatment. Mice were given (i.g.) with MCT and sacrificed at 48 h after MCT treatment. After treatment, blood from each group was collected. Serum ALT/AST activity detection The blood samples obtained from mice of all groups were allowed to coagulate for 2 h. Serum was then isolated following centrifugation at 860 × g for 15 min. Serum ALT and AST activities were measured with kits according to the manufacturer's instructions. Liver histological observation Slices of livers were fixed in 10% phosphate buffered saline (PBS)formalin and then embedded in paraffin. Samples were subsequently sectioned (5 μm), stained with haematoxylin and eosin (H&E), and then observed under a light microscope (Olympus, Japan) to evaluate liver damage.
Material and method Chemical compounds and reagents
MicroRNA microarray and data analysis
TSN (Purity > 98.0%) was purchased from Shanghai Yuanye Biological Technology Co., Ltd (Shanghai, China). DB (Purity > 98.0%) was purchased from Shanghai Tauto Biotech Co., Ltd. (Shanghai, China). APAP (Purity > 99.0%) was obtained from Sigma (St Louis, MO). MCT (Purity > 98.0%) was purchased from Nanjing GuangRun Biotechnology Co., Ltd (Nanjing, China). The analytic kits for detecting serum ALT and AST activities were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Trizol was purchased from Life Technology (Carlsbad, CA). MiRNeasy mini kit and miScript PCR starter kit were obtained from Qiagen (Hilden, German). miRCURYTM LNA Array (v.18.0) was purchased from Exiqon (Vedbaek, Denmark). PrimeScript Master Mix and SYBR Premix Ex Taq were purchased from Takara (Shiga, Japan).
Serum total RNA from C57BL/6 mice treated with TSN for 12 h as well as vehicle control group was harvested by using Trizol and miRNeasy mini kits according to manufacturer's instructions. After having passed RNA quantity measurement, the samples were labeled using the miRCURY™ Array Power Labeling kit and hybridized on the miRCURY™ Array (v.18.0). Following the washing steps the slides were scanned using the Axon GenePix 4000 B microarray scanner. Scanned images were then imported into GenePix Pro 6.0 software (Axon) for grid alignment and data extraction. Expressed data were normalized using the median normalization. After normalization, differentially expressed miRNAs were identified through Fold Change filtering. Only those miRNAs with the fold difference >10.0 were considered significant, and hierarchical clustering analysis (HCA) was performed to show different miRNA expression profiling among vehicle control mice and mice treated with TSN (10 mg/kg) for 12 h by using MEV software (v4.6, TIGR).
Experimental animals Specific pathogen free male C57BL/6 mice (weight: 20 ± 2 g) were purchased from Shanghai Experimental Animal Center of Chinese Academy of Sciences (Shanghai, China). The mice were fed with a standard laboratory diet and given free access to tap water, living in a controlled room temperature (22 ± 1 °C), humidity (65 ± 5%) with a 12:12 h light/dark cycle. All animals have received humane care in compliance with the institutional animal care guidelines approved by the Experimental Animal Ethical Committee of Shanghai University of Traditional Chinese Medicine (Approval nzumber: PZSHUTCM19011801).
RNA isolation and Real-time PCR analysis Serum total RNA from C57BL/6 mice treated with TSN for both 6 h and 12 h as well as vehicle control group was isolated by using Trizol reagent. The RNA content was determined and cDNA was synthesized using reverse transcriptase kits according to the instruction. The primers for miRNA were obtained from Sangon Biotech. (Shanghai) and 2
Phytomedicine 58 (2019) 152867
F. Yang, et al.
Table 1 (continued)
Table 1 List of the miRNA primers.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53
54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71
Name
Forward primer sequence
mmu-miR-122-3p mmu-miR-1b-5p mmu-miR-141-5p mmu-miR-669i mghv-miR-M1-14-5p mmu-miR-344d-2-5p mmu-miR-344d-3-5p mmu-miR-192-3p mcmv-miR-m01-4-3p mcmv-miR-m108-1-3p mmu-miR-599 mmu-miR-96-3p mmu-miR-217-3p mmu-miR-670-3p mmu-miR-669m-3p mmu-miR-708-3p mmu-miR-679-5p mmu-miR-135b-5p mmu-miR-5104 mmu-miR-3105-3p mmu-miR-1946b mmu-miR-1933-3p mmu-miR-125a-3p mmu-miR-1198-3p mmu-miR-467b-3p mmu-miR-669a-3-3p mmu-miR-697 mmu-miR-3061-3p mmu-miR-770-3p mmu-miR-5108 mmu-miR-680 mmu-miR-3087-5p mmu-miR-298-5p mmu-miR-5121 mmu-miR-7b-5p mmu-miR-3085-5p mmu-miR-3103-5p mmu-miR-5621-5p mmu-miR-125b-1-3p mmu-miR-3102-5p mmu-miR-5615-5p mmu-miR-666-5p mmu-miR-493-5p mmu-miR-511-3p mmu-miR-299a-5p/mmumiR-299b-5p mmu-miR-1249-5p mmu-miR-5129-5p mmu-miR-3074-5p mmu-miR-133a-5p mmu-miR-344i mmu-miR-3067-3p mmu-miR-3092-3p mmu-miR-465a-3p/mmumiR-465b-3p/mmu-miR465c-3p mmu-miR-295-5p mmu-miR-1982-5p mmu-miR-3094-5p mmu-miR-365-1-5p mmu-miR-1962 mmu-miR-5625-5p mmu-miR-879-3p mmu-miR-26a-1-3p mmu-miR-3077-5p mghv-miR-M1-13-5p mmu-miR-380-5p mmu-miR-3102-5p.2-5p mmu-miR-292a-5p mmu-miR-367-3p mmu-miR-700-3p mmu-miR-1948-3p mmu-miR-540-5p mmu-miR-1966-5p
CGCGCGCGAAACGCCATTATCACACTAA GCGCGCGCGTACATACTTCTTTACATTCCA AGCGCATCTTCCAGTGCAGTGTTGGA GCGCGCGTGCATATACACACATGCATAC CCCCGTTCTGGATGCTGTGGGAC CGCGAGTCTGGTTGCTGGCTATATTCCA AGCGCGAGTCAGGCTAGTGGTTATACTCC CGCGCTGCCAATTCCATAGGTCACAG AGCGCCGCGTGGTAGCATTAGAAC CGTTTCTGACGGTGGCTCGTGTCG GCGCGCGCGTTGTGTCAGTTTATCAAAC CGCGCGCAATCATGTGTAGTGCCAATAT CGCGCCATCAGTTCCTAATGCATTGCCT CGCGCGTTTCCTCATATCCATTCAGGAGTGT CGGCCGCGCATATACATCCACACAAACATAT CGCGCGCAACTAGACTGTGAGCTTCTAG GCGGGACTGTGAGGTGACTCTTGGT GCGCGCGTATGGCTTTTCATTCCTATGTGA CCTGTGCTAGTGAGGTGGCTCAGCA CGCGACTGCTTATGAGCTTGCACTCC GCCGGGCAGTGGTGGC CGCGCCAGGACCATCAGTGTGACTAT CGACAGGTGAGGTTCTTGGGAGCC CGCGAAGCTAGCCTCTAACTCATGGC CGCGCGCGATATACATACACACACCAACAC CGCGCGCGACATAACATACACACACATGTAT CGCGAACATCCTGGTCCTGTGGAGA CGCGCTACCTTTGATAGTCCACTGCC CGTGGGCCTGACGTGGAGC GCGCGGTAGAGCACTGGATGGTTT GGGCATCTGCTGACATGGGGG GCAGGGCAGGGCAAGAGTTGAG GGCAGAGGAGGGCTGTTCTTCCC GCGCGAGCTTGTGATGAGACATCTCC CCGCGCGTGGAAGACTTGTGATTTTGTTGT AGGTGCCATTCCGAGGGCCAAG GCGGGAGGGAGGATCTGCTGTTAG AGGAGGTCCTGGGGCCG CACGGGTTAGGCTCTTGGGAGCT GTGAGTGGCCAGGGTGGGG CGCGCGCTTGGTTGTTTTCTGAGACAGA GCGGGCACAGCTGTGAGAGC CCGCGCGTTGTACATGGTAGGCTTTC GCGCGCGAATGTGTAGCAAAAGACAGGAT GCGCGTGGTTTACCGTCCCACATACAT
72 73 74 75 76 77 78 79 80 81 82
Name
Forward primer sequence
mmu-miR-3472 mmu-miR-208b-3p mmu-miR-327 mmu-miR-3104-5p mmu-miR-212-5p mmu-miR-1912-3p mmu-miR-3063-3p mmu-miR-299a-3p mmu-miR-450b-3p mmu-miR-188-3p RNU6-2
CGCGTAATAGCCAGAAGCTGGAAGGAACC CGCGCGCGATAAGACGAACAAAAGGTTTGT CGCGACTTGAGGGGCATGAGGAT TAGGGGGCAGGAGCCGGA CGCGACCTTGGCTCTAGACTGCTTACT CGCGCACAGAACATGCAGTGAGAACT GCGTGAGGAATCCTGATCTCTCGCC AGCGTATGTGGGACGGTAAACCGCTT CGCGCGATTGGGAACATTTTGCATGCAT CGCTCCCACATGCAGGGTTTGCA AACGCTTCACGAATTTGCGT
GGAGGGAGGGGATGGGCC GCGCGATGTGGGGGCATTGGTATTTTC CGGTTCCTGCTGAACTGAGCCAGT CGCGCGGCTGGTAAAATGGAACCAAAT CGAAGTCAGGCTCCTGGCTGGA CCAAGCGGCTGCCCTGG CGGAATGGGGCTGTTTCCCCTCC GCGCGGATCAGGGCCTTTCTAAGTAGA
CGCGACTCAAATGTGGGGCACACTTC TTGGGAGGGTCCTGGGGAGG GCGCGCGTGTTGGGGACATTTTTAAAGC CGAGGGACTTTTGGGGGCAGATGTG GAGAGGCTGGCACTGGGACACAT CGCGCCCGGAAGTTCTTGAGTAGGA CGCGGCTTATGGCTTCAAGCTTTCGG GCGCGCCTATTCTTGGTTACTTGCACG GCGGACGGGTGGGCG GCGTGGGAAGAGTCTGTTGAGTGGC GCGCGATGGTTGACCATAGAACATGCG GGTGGTGCAGGCAGGAGAGC CGCGACTCAAACTGGGGGCTCTTTTG CGCGCGAATTGCACTTTAGCAATGGTGA CACGCGGGAACCGAGTCCAC CGCGTTTAGGCAGAGCACTCGTACAG GCCAAGGGTCACCCTCTGACTCTGT AAGGGAGCTGGCTCAGGAGAGAGTC
Fig. 1. TSN induced liver injury in mice. (A) TSN increased serum ALT and AST activities in mice. (B) Liver histological evaluation. Representative images from each experimental group in C57BL/6 mice are shown. Arrows indicate nuclear shrinkage and hepatocellular necrosis. Data is shown as means ± SEM (n = 7), *p < 0.05, **p < 0.01 compared with vehicle control group.
3
Phytomedicine 58 (2019) 152867
F. Yang, et al.
Table 2 The up-regulated and down-regulated hepatic miRNAs in mice-treated with TSN for 12 h (>10 fold).
Fig. 2. Effects of TSN on serum miRNA expression profile. HCA of altered miRNA expression in serum from control vehicle mice and mice treated with TSN for 12 h. HCA was performed with miRNAs of 10 fold-changed. Rows, miRNA; Column, Vehicle control (10% PG) group and TSN-treated 12 h group. For each miRNA, red color indicates miRNA with high expression, while green color indicates miRNA with low expression.
were shown in Table 1. Real-time PCR was performed by using miScript PCR Starter Kit according to the instruction. The relative expression level of miRNA was normalized to the level of U6 small nuclear RNA (snRNA) levels, analyzed by the 2−△△Ct method and given as ratio compared with the control. Statistical analysis Data were expressed as means ± standard error of the mean (SEM). The significance of differences between two groups was evaluated by Student's t-test, and between multiple groups was evaluated by one-way ANOVA with LSD post hoc test. p < 0.05 was considered as statistically significant. Results TSN induced liver injury in mice As shown in Fig. 1A, TSN elevated serum ALT (p < 0.01) and AST (p < 0.01) activities when mice were intraperitoneally injected with TSN (10 mg/kg) for both 12 h and 24 h. The results of liver histological evaluation further confirmed that TSN (10 mg/kg) induced obvious liver damages including nuclear shrinkage and hepatocellular necrosis when mice were treated with TSN (10 mg/kg) for both 12 h and 24 h (Fig. 1B). The elevation of serum ALT/AST activities in mice treated with TSN for 6 h was just about twice, and this elevation is too weak to indicate the occurrence of liver injury (Fig. 1A). Additionally, the
Accession ID
Name
Fold change
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53
MIMAT0017005 MIMAT0005835 MIMAT0004533 MIMAT0005840 MIMAT0018174 MIMAT0014961 MIMAT0014807 MIMAT0017012 MIMAT0005539 MIMAT0005558 MIMAT0012772 MIMAT0017021 MIMAT0017072 MIMAT0017242 MIMAT0009419 MIMAT0003498 MIMAT0003455 MIMAT0000612 MIMAT0020611 MIMAT0014942 MIMAT0009443 MIMAT0009397 MIMAT0004528 MIMAT0017332 MIMAT0003478 MIMAT0017251 MIMAT0003487 MIMAT0014829 MIMAT0003891 MIMAT0020616 MIMAT0003457 MIMAT0014895 MIMAT0000376 MIMAT0020629 MIMAT0000678 MIMAT0014878 MIMAT0014937 MIMAT0022369 MIMAT0004669 MIMAT0014933 MIMAT0022355 MIMAT0003737 MIMAT0017276 MIMAT0017281 MIMAT0000377 MIMAT0014804 MIMAT0020640 MIMAT0014856 MIMAT0003473 MIMAT0022503 MIMAT0014841 MIMAT0014906 MIMAT0004217
722.260 153.972 68.519 63.120 43.417 39.653 39.436 30.895 29.769 27.125 24.575 20.120 19.718 19.305 19.207 17.815 17.355 16.802 16.504 16.317 15.551 14.959 13.948 12.721 12.094 11.601 10.979 10.939 10.692 −10.101 −10.309 −10.417 −10.989 −10.989 −11.364 −11.628 −11.765 −12.195 −12.346 −12.658 −12.821 −12.821 −12.821 −12.987 −13.514 −13.889 −14.085 −14.286 −15.152 −16.129 −16.393 −17.544 −18.182
54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72
MIMAT0004575 MIMAT0009459 MIMAT0014909 MIMAT0017077 MIMAT0009435 MIMAT0022379 MIMAT0004843 MIMAT0017020 MIMAT0014862 MIMAT0018172 MIMAT0000744 MIMAT0014934 MIMAT0000369 MIMAT0003181 MIMAT0003490 MIMAT0009415 MIMAT0004786 MIMAT0009439 MIMAT0015643
mmu-miR-122-3p mmu-miR-1b-5p mmu-miR-141-5p mmu-miR-669i mghv-miR-M1-14-5p mmu-miR-344d-2-5p mmu-miR-344d-3-5p mmu-miR-192-3p mcmv-miR-m01-4-3p mcmv-miR-m108-1-3p mmu-miR-599 mmu-miR-96-3p mmu-miR-217-3p mmu-miR-670-3p mmu-miR-669m-3p mmu-miR-708-3p mmu-miR-679-5p mmu-miR-135b-5p mmu-miR-5104 mmu-miR-3105-3p mmu-miR-1946b mmu-miR-1933-3p mmu-miR-125a-3p mmu-miR-1198-3p mmu-miR-467b-3p mmu-miR-669a-3-3p mmu-miR-697 mmu-miR-3061-3p mmu-miR-770-3p mmu-miR-5108 mmu-miR-680 mmu-miR-3087-5p mmu-miR-298-5p mmu-miR-5121 mmu-miR-7b-5p mmu-miR-3085-5p mmu-miR-3103-5p mmu-miR-5621-5p mmu-miR-125b-1-3p mmu-miR-3102-5p mmu-miR-5615-5p mmu-miR-666-5p mmu-miR-493-5p mmu-miR-511-3p mmu-miR-299a-5p/mmu-miR-299b-5p mmu-miR-1249-5p mmu-miR-5129-5p mmu-miR-3074-5p mmu-miR-133a-5p mmu-miR-344i mmu-miR-3067-3p mmu-miR-3092-3p mmu-miR-465a-3p/mmu-miR-465b-3p/ mmu-miR-465c-3p mmu-miR-295-5p mmu-miR-1982-5p mmu-miR-3094-5p mmu-miR-365-1-5p mmu-miR-1962 mmu-miR-5625-5p mmu-miR-879-3p mmu-miR-26a-1-3p mmu-miR-3077-5p mghv-miR-M1-13-5p mmu-miR-380-5p mmu-miR-3102-5p.2-5p mmu-miR-292a-5p mmu-miR-367-3p mmu-miR-700-3p mmu-miR-1948-3p mmu-miR-540-5p mmu-miR-1966-5p mmu-miR-3472
−18.868 −18.868 −18.868 −19.231 −19.608 −20.000 −21.739 −23.810 −23.810 −23.810 −24.390 −29.412 −30.303 −31.250 −31.250 −32.258 −32.258 −34.483 −35.714
(continued on next page) 4
Phytomedicine 58 (2019) 152867
F. Yang, et al.
analyzed by using the miRNA array. The results of HCA showed that there was a large amount of differentially expressed miRNAs in serum between vehicle control mice with mice treated with TSN (Fig. 2). As shown in Table 2, there were total 81 miRNAs with the fold difference >10.0 that were differentially expressed in serum from mice treated with TSN for 12 h as compared with vehicle control mice. Among these altered 81 miRNAs, 29 miRNAs were up-regulated and 52 miRNA were down-regulated in serum from TSN-treated mice.
Table 2 (continued)
73 74 75 76 77 78 79 80 81
Accession ID
Name
Fold change
MIMAT0004939 MIMAT0004867 MIMAT0014939 MIMAT0017053 MIMAT0014958 MIMAT0014833 MIMAT0004577 MIMAT0003512 MIMAT0004541
mmu-miR-208b-3p mmu-miR-327 mmu-miR-3104-5p mmu-miR-212-5p mmu-miR-1912-3p mmu-miR-3063-3p mmu-miR-299a-3p mmu-miR-450b-3p mmu-miR-188-3p
−50.000 −55.556 −58.824 −66.667 −71.429 −71.429 −90.909 −250.000 −333.333
Validation of these differentially expressed miRNAs Next, we further validated the expression of those altered 81 miRNAs in serum from vehicle control mice and TSN-treated mice by using Real-time PCR assay. The results showed that the expression of 22 miRNAs was in coinciding with the results from miRNA chip, including miR-122-3p, mcmv-miR-m01-4-3p, miR-1946b, miR-217-3p, miR-6703p, miR-770-3p, miR-1198-3p, miR-125a-3p, miR-1933-3p, miR-30613p, miR-3105-3p, miR-5104, miR-669a-3-3p, miR-697, miR-708-3p, miR-367-3p, miR-292a-5p, miR-3102-5p, miR-188-3p, miR-212-5p,
results of liver histological evaluation showed that TSN did not induce obvious liver damages when mice were treated with TSN (10 mg/kg) for 6 h (Fig. 1B) Effects of TSN on serum miRNA expression profile The effects of TSN on serum miRNA expression profile were
Fig. 3. Validation of these differentially expressed miRNAs. The expression of 81 altered miRNAs in serum from TSN-treated mice from miRNA array was further detected by Real-time PCR assay and 22 of them were coinciding with the results from miRNA chip. (A) Up-regulated serum miRNAs. (B) Down-regulated serum miRNAs. (C & D) The change of miRNA is not match with the results from miRNA chip. Data is shown as means ± SEM (n = 7), *p < 0.05, **p < 0.01, ***p < 0.001 compared with vehicle control group. 5
Phytomedicine 58 (2019) 152867
F. Yang, et al.
Fig. 4. Determination of the specificity of these 22 above candidate miRNAs. (A) Serum ALT/AST activities in mice treated with APAP or DB. (B) Serum ALT/ AST activities in mice treated with MCT. (C) The results of the change of these above 22 miRNAs in serum from APAP-treated mice. (D) The results of the change of these above 22 miRNAs in serum from DB-treated mice. (E) The results of the change of these above 22 miRNAs in serum from MCT-treated mice. Data is shown as means ± SEM (n = 6), *p < 0.05, **p < 0.01, ***p < 0.001 compared with vehicle control group.
From the results, we found that the expression of serum miR-31025p and miR-292a-5p was decreased in mice treated with TSN, APAP and DB, but had no alteration in mice treated with MCT (Figs. 3A and 4C–E, Table 3). Besides, the expression of miR-1946b, miR-217-3p, miR-670-3p and miR-770-3p in serum was found to be significantly increased in TSN-, APAP- and DB-induced liver injury, but had a remarkable decrease in mice treated with MCT (Figs. 3A and 4C–E, Table 3).
miR-3092-3p and miR-365-1-5p (Fig. 3A–B). The change of other 59 miRNAs was not consistent with the results from miRNA chip (Fig. 3C–D). Data in Fig. 1A showed that TSN obviously enhanced serum ALT/ AST activities when mice were treated with TSN (10 mg/kg) for both 12 h and 24 h (p < 0.01). When mice were treated with TSN (10 mg/ kg) for 6 h, the increase of serum ALT/AST activities is too weak to indicate the liver injury. Additionally, the results of liver histological evaluation also did not show obvious liver damages. However, data in Fig. 3A showed that the expression of these above 22 miRNAs was all obviously changed in serum from mice treated with TSN for 6 h.
Discussion Drug-induced liver injury (DILI) is one of the most serious adverse drug reactions and may result in acute liver failure (Hunt et al., 2017). The serious cases may be life-threatening (Hayashi et al., 2017). With the rapid development of the pharmaceutical industry, new drugs have come out at home and abroad, and the incidence of DILI has increased accordingly, which even leads to clinical trial failure and drug withdrawal from the market worldwide (Chen et al., 2015; Regev, 2014). With the wide application of TCMs in the world, TCMs-induced liver
Determining the specificity of these 22 above candidate miRNAs Data in Fig. 4C–E and Table 3 showed that the expression of miR367-3p was not changed in serum from APAP-, DB- or MCT-treated mice. The expression of miR-122-3p and mcmv-miR-m01-4-3p was increased in serum from mice treated with all those above hepatotoxicants including TSN, APAP, DB and MCT (Figs. 3A and 4C–E, Table 3). 6
Phytomedicine 58 (2019) 152867
F. Yang, et al.
The expression of serum miR-367-3p was significantly decreased in TSN-treated mice in this study. Notably, this decrease was not occurred in serum from APAP, MCT or DB-treated mice. These results imply that miR-367-3p may be a specific and sensitive biomarker for TSN-induced liver injury, which will be helpful for the quick diagnosis of liver injury induced by TSN and Toosendan Fructus. Meanwhile, this guess also needs further validation in more studies from liver injury induced by other drugs or hepatotoxicants. It is reported that miR-367-3p was involved in the metastasis or growth of hepatocelluar carcinoma, glioma and endometrial cancer (Xu et al., 2016; Ma et al., 2018; Liu et al., 2018). Furthermore, miR-367-3p was used to be served as a potential serum diagnostic biomarker for germ cell cancer (Leão et al., 2018; Murray et al., 2016; Syring et al., 2015). There is still no evidence that miR-367-3p is related to DILI. So it is the first time that miR-367-3p has been shown to be a potential candidate biomarker for liver injury. microRNA-122 has already been found to be a very early and sensitive biomarker for DILI, and it constitutes 50% (human) and 70% (mouse) of all miRNA transcripts in the liver (Lagos-Quintana et al., 2002). It is reported that miR-122 is decreased in the liver and increased in serum after insult, which has been found to be elevated in serum sooner than the change of ALT activity (Starkey et al., 2011; Girard et al., 2008). miR-122 is a precursor for miR-122-3p, and the expression of serum miR-122-3p was significantly elevated in TSN-treated mice. Additionally, this change is more sensitive than the alternation of serum ALT and AST activities. Further results showed that miR-122-3p also increased in serum from APAP-, DB- and MCT-treated mice. Our results further evidenced that miR-122-3p may be a universal sensitive biomarker for reflecting liver injury. The increased expression of serum mcmv-miR-m01-4-3p was not only occurred in serum from TSN-treated mice, but also in serum from APAP, MCT and DB-treated mice. We think that mcmv-miR-m01-4-3p may also be a universal sensitive biomarker indicating the occurrence of liver injury but lack of specificity. It is lack of the reports about this miRNA, so this hypothesis needs further validation in more studies from liver injury induced by other hepatotoxicants. It has been reported that MCT, belongs to pyrrolizidine alkaloids, is generally used to induce experimental HSOS (DeLeve et al., 1999; Nakamura et al., 2012). The primary site of the toxic injury involved in MCT-induced HSOS is the damage on hepatic sinusoidal endothelial cells (HSECs) (DeLeve et al., 1999; Nakamura et al., 2012; Vion et al., 2015). The liver injury induced by APAP, DB and TSN mainly belongs to liver parenchymal injury. We found that serum expression of miR292a-5p and miR-3102-5p was not only decreased in TSN-treated mice, but also decreased in APAP- and DB-induced liver injury. However, serum expression of miR-292a-5p and miR-3102-5p was not altered in serum from MCT-treated mice. What's more, serum expression of miR1946b, miR-217-3p, miR-670-3p and miR-770-3p was found to be significantly increased in serum from TSN-, APAP- and DB-treated mice, whereas serum expression of these above 4 miRNAs was decreased in serum from MCT-treated mice. It might be due to the fact that MCTinduced HSOS is different from hepatic parenchymal injury caused by APAP, DB and TSN. Except miR-770-3p has been reported to be potentially used as a candidate biomarker for aging (Lee et al., 2018), there are still no reports about miR-292a-5p, miR-3102-5p, miR-1946b, miR-217-3p and miR-670-3p. We speculated that the decreased expression of serum miR-292a-5p and miR-3102-5p, and the increased expression of serum miR-1946b, miR-217-3p, miR-670-3p and miR770-3p may be related with liver parenchymal injury. In conclusion, we found that miR-367-3p might be a specific and sensitive biomarker for reflecting TSN-induced liver injury, while miR122-3p and mcmv-miR-m01-4-3p might be commonly universal biomarkers for liver injury induced by exogenous hepatotoxicants with high sensitivity. Moreover, miR-292a-5p, miR-3102-5p miR-1946b, miR-217-3p, miR-670-3p and miR-770-3p might be related with liver parenchymal injury. The discovery of more and more biomarkers will contribute to the diagnosis and therapeutic intervention of liver injury
Table 3 The alternation of 22 miRNAs in the liver injury induced by TSN, APAP, DB and MCT in mice. Name
TSN
APAP
DB
MCT
miR-367-3p miR-122-3p mcmv-miR-m01-4-3p miR-292a-5p miR-3102-5p miR-1946b miR-217-3p miR-670-3p miR-770-3p miR-1198-3p miR-125a-3p miR-1933-3p miR-3061-3p miR-3105-3p miR-5104 miR-669a-3-3p miR-697 miR-708-3p miR-188-3p miR-212-5p miR-3092-3p miR-365-1-5p
↓ ↑ ↑ ↓ ↓ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↓ ↓ ↑ ↓
NC ↑ ↑ ↓ ↓ ↑ ↑ ↑ ↑ ↓ NC ↑ ↓ NC NC ↑ NC NC ↓ ↓ ↑ ↓
NC ↑ ↑ ↓ ↓ ↑ ↑ ↑ ↑ ↑ ↑ ↓ ↑ ↑ ↓ NC ↑ ↑ NC ↑ NC ↑
NC ↑ ↑ NC NC ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↑ NC ↓ ↓ NC NC NC NC
injury frequently develops in cases of their excessive or inappropriate use. It is usually self-limited, but sometimes it causes serious complications, such as liver cirrhosis, acute liver failure and even death, unless an emergent liver transplantation is performed (Wang et al., 2018). However, due to non-specific or hidden clinical manifestations, DILI is not easily detected or diagnosed. Serum ALT and AST activities are generally used for DILI diagnosis, but they suffer from a lack of liver specificity and sensitivity. Thus, to find new sensitive and specific biomarkers for DILI become urgent, which will be helpful for its diagnosis and treatment. Toosendanin (TSN) is the main active compound in Toosendan Fructus with good insecticidal activity and promising anti-tumor capacity (Wu et al., 2010; Zhang et al., 2005). However, its hepatotoxicity has severely limited the clinical application of TSN and Toosendan Fructus. In this study, the results of serum ALT/AST activities and liver histological evaluation showed that TSN induced obvious liver injury in mice, and this result is consistent with those previous reported studies (Qi et al., 2008; Zhang et al., 2008; Lu et al., 2016; Jin et al., 2019). After integrative analysis of altered miRNAs from the results of miRNA array and further Real-time PCR validation, the expression of total 22 miRNAs was found to be changed in serum from mice treated with TSN for both 6 h and 12 h. However, the results of serum ALT/AST activities and liver histological evaluation did not show any obvious liver damages in mice treated with TSN for 6 h. These results imply that these above 22 miRNAs may be candidate biomarkers for reflecting TSN-induced liver injury. Acetaminophen is a commonly used antipyretic and analgesic drug, but the hepatotoxicity due to its overdose is classic DILI (Bunchorntavakul and Reddy, 2018). DB is the main hepatotoxic compound isolated from Airpotato yam, a traditionally used herbal medicine in China, which is also reported to induce serious liver injury both in clinic and in experimental studies (Wang et al., 2010, 2011; Ma et al., 2014). MCT is abundant in Crotalaria genus, which is also a traditionally used herbal medicine in China (Tu et al., 2013). MCT is generally used to induce experimental hepatic sinusoidal obstruction syndrome (HSOS) (DeLeve et al., 1999; Nakamura et al., 2012). To find a specific miRNA biomarker for reflecting the hepatotoxicity induced by TSN, we further analyzed whether these above 22 miRNAs were also changed in liver injuries induced by other hepatotoxicants including APAP, DB and MCT, or just specifically changed in liver injury induced by TSN. 7
Phytomedicine 58 (2019) 152867
F. Yang, et al.
induced by TSN or other hepatotoxicants, which will be helpful for improving the safety and medicinal value of Toosendan Fructus or other drugs including TCMs in clinic.
of microRNA and mRNA expression profiles highlights the complex and dynamic behavior of toosendanin-induced liver injury in mice. Sci. Rep. 6 (1), 34225. Ma, J., Li, D., Kong, F.F., Yang, D., Yang, H., Ma, X.X., 2018. miR-302a-5p/367-3pHMGA2 axis regulates malignant processes during endometrial cancer development. J. Exp. Clin. Cancer Res. 37 (1), 19. Ma, J.G., Li, X.Y., 2017. MicroRNAs are involved in the toxicity of microcystins. Toxin Rev. 36 (2), 165–175. Ma, Y.B., Niu, C.W., Wang, J.M., Ji, L.L., Wang, Z.T., 2014. Diosbulbin B-induced liver injury in mice and its mechanism. Hum. Exp. Toxicol. 33 (7), 729–736. Medina-Caliz, I., Garcia-Cortes, M., Gonzalez-Jimenez, A., Cabello, M.R., Robles-Diaz, M., Sanabria-Cabrera, J., Sanjuan-Jimenez, R., Ortega-Alonso, A., Garcia-Munoz, B., Moreno, I., Jimenez-Perez, M., Fernandez, M.C., Gines, P., Prieto, M., Conde, I., Hallal, H., Soriano, G., Roman, E., Castiella, A., Blanco-Reina, E., Montes, M.R., Quiros-Cano, M., Martin-Reyes, F., Lucena, M.I., Andrade, R.J., Spanish DILI Registry, 2018. Herbal and dietary supplement-induced liver injuries in the Spanish DILI registry. Clin. Gastroenterol. Hepatol. 16 (9), 1495–1502. Murray, M.J., Huddart, R.A., Coleman, N., 2016. The present and future of serum diagnostic tests for testicular germ cell tumours. Nat. Rev. Urol. 13 (12), 715–725. Nakamura, K., Hatano, E., Narita, M., Miyaqawa-Hayashino, A., Koyama, Y., Naqata, H., 2012. Sorafenib attenuates monocrotaline-induced sinusoidal obstruction syndrome in rats through suppression of JNK and MMP-9. J. Hepatol. 57 (5), 1037–1043. Nathwani, R.A., Pais, S., Reynolds, T.B., Kaplowitz, N., 2005. Serum alanine aminotransferase in skeletal muscle diseases. Hepatology 41 (5), 380–382. Qi, S.Y., Jin, R.M., Liu, H.J., Huang, Y.W., 2008. Mechanism studies on hepatotoxicity of rats induced by Fructus Toosendan. Zhongguo Zhong Yao Za Zhi 33, 2045–2047. Regev, A., 2014. Drug-induced liver injury and drug development: industry perspective. Semin. Liver. Dis. 34 (02), 227–239. Shen, J., Zhang, J., Wen, J., Ming, Q., Zhang, J., Xu, Y., 2015. Correlation of serum alanine aminotransferase and aspartate aminotransferase with coronary heart disease. Int. J. Clin. Exp. Med. 8, 4399–4404. Starkey, L., Philip, J., Dear, J., Platt, V., Simpson, K.J., Craig, D.N., Antoine, D.J., Park, B.K., 2011. Circulating microRNAs as potential markers of human drug-induced liver injury. Hepatology 54 (5), 1767–1776. Syring, I., Bartels, J., Holdenrieder, S., Kristiansen, G., Müller, S.C., Ellinger, J., 2015. Circulating serum miRNA (miR-367-3p, miR-371a-3p, miR-372-3p and miR-373-3p) as biomarkers in patients with testicular germ cell cancer. J. Urol. 193 (1), 331–337. Tu, M.J., Sun, S.Y., Wang, K., Peng, X.Y., Wang, R.H., Li, L.P., Zeng, S., Zhou, H., Jiang, H.D., 2013. Organic cation transporter 1 mediates the uptake of monocrotaline and plays an important role in its hepatotoxicity. Toxicology 311 (3), 225–230. Vion, A.C., Rautou, P.E., Durand, F., Boulanger, C.M., Valla, D.C., 2015. Interplay of inflammation and endothelial dysfunction in bone marrow transplantation: focus on hepatic veno-occlusive disease. Semin. Thromb. Hemost. 41 (06), 629–643. Wang, J.M., Ji, L.L., Liu, H., Wang, Z.T., 2010. Study of the hepatotoxicity induced by Dioscorea bulbifera L. rhizome in mice. Biosci. Trends 4, 79–85. Wang, J.M., Liang, Q.N., Ji, L.L., Liu, H., Wang, C.H., Wang, Z.T., 2011. Gender-related difference in liver injury induced by Dioscorea bulbifera L. rhizome in mice. Hum. Exp. Toxicol 30 (9), 1333–1341. Wang, R., Qi, X.S., Yoshida, E.M., Méndez-Sánchez, N., Teschke, R., Sun, M., Liu, X., Su, C., Deng, J., Deng, H., Hou, F., Guo, X., 2018. Clinical characteristics and outcomes of traditional Chinese medicine-induced liver injury: a systematic review. Expert Rev. Gastroenterol. Hepatol. 12 (4), 425–434. Wang, Y., Chen, T., Tong, W., 2014. miRNAs and their application in drug-induced liver injury. Biomark. Med. 8 (2), 161–172. Wu, S.B., Su, J.J., Sun, L.H., Wang, W.X., Zhao, Y., Li, H., Hu, J.F., 2010. Triterpenoids and steroids from the fruits of Melia toosendan and their cytotoxic effects on two human cancer cell lines. J. Nat. Prod. 73 (11), 1898–1906. Xu, H., Zhang, J.L., 2011. Natural products-based insecticidal agents 9. Design, semisynthesis and insecticidal activity of 28-acyloxy derivatives of toosendanin against Mythimna separata Walker in vivo. Bioorg. Med. Chem. Lett. 21 (7), 1974–1977. Xu, J., Lin, H., Li, G., Sun, Y., Chen, J., Shi, L., Cai, X., Chang, C., 2016. The miR-367-3p increases sorafenib chemotherapy efficacy to suppress hepatocellular carcinoma metastasis through altering the androgen receptor signals. EBioMedicine 12, 55–67. Zhang, B., Wang, Z.F., Tang, M.i., Shi, Y.L., 2005. Growth inhibition and apoptosis-induced effect on human cancer cells of toosendanin, a triterpenoid derivative from chinese traditional medicine. Invest. New Drugs 23 (6), 547–553. Zhang, P., Ye, Y.G., Yang, X.Z., Jiao, Y.T., 2016. Systematic review on Chinese herbal medicine induced liver injury. Evid. Based Complement. Altern. Med. 2016, 3560812. Zhang, S., Cao, L., Wang, Z.R., Li, Z., Ma, J., 2018. Anti-cancer effect of toosendanin and its underlying mechanisms. J. Asian Nat. Prod. Res. 1–13. https://doi.org/10.1080/ 10286020.2018.1451516. Zhang, T., Li, J., Yin, F., Lin, B., Wang, Z., Xu, J., Wang, H., Zuo, D., Wang, G., Hua, Y., Cai, Z., 2017. Toosendanin demonstrates promising antitumor efficacy in osteosarcoma by targeting STAT3. Oncogene 36 (47), 6627–6639. Zhang, Y.H., Qi, X.M., Gong, L.K., Li, Y., Liu, L.L., Xue, X., Xiao, Y., Wu, X., Ren, J., 2008. Roles of reactive oxygen species and MAP kinases in the primary rat hepatocytes death induced by toosendanin. Toxicology 249 (1), 62–68.
Acknowledgments The authors would like to thank KangChen Bio-tech Inc. (Shanghai) for the kind assistant in miRNA array analysis. This work was financially supported by State major science and technology special projects during the 12th five year plan (2015ZX09501004-002-002), the leadership in Science and Technology innovation of the third batch of national “Ten Thousand People Plan” for Lili Ji and the National Key Research and Development Program of China (2018YFC1707302). Conflict of interest We wish to confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome. References Bartel, D.P., 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281–297. Bunchorntavakul, C., Reddy, K.R., 2018. Acetaminophen (APAP or N-Acetyl-pAminophenol) and acute liver failure. Clin. Liver Dis. 22 (2), 325–346. Chinese Pharmacopoeia Commission, 2015. Pharmacopeia of Thepeople's Republic of China (2015) Version. The Medicine Science and Technology Press of China, Beijing, pp. 42. Chen, M.J., Suzuki, A., Borlak, J., Andrade, R.J., Lucena, M.I., 2015. Drug-induced liver injury: interactions between drug properties and host factors. J. Hepatol. 63 (2), 503–514. DeLeve, L.D., McCuskey, R.S., Wang, X.D., Hu, L.P., McCuskey, M.K., Epstein, R.B., Kanel, C.C., 1999. Characterization of a reproducible rat model of hepatic veno-occlusive disease. Hepatology 29 (6), 1779–1991. Girard, M., Jacquemin, E., Munnich, A., Lyonnet, S., Henrion-Caude, A., 2008. miR-122, a paradigm for the role of microRNAs in the liver. J. Hepatol. 48 (4), 648–656. Hayashi, P.H., Rockey, D.C., Fontana, R.J., Tillmann, H.L., Kaplowitz, N., Barnhart, H.X., 2017. Death and liver transplantation within 2 years of onset of drug-induced liver injury. Hepatology 66 (4), 1275–1285. Howell, L.S., Ireland, L., Park, B.K., Goldring, C.E., 2018. MiR-122 and other microRNAs as potential circulating biomarkers of drug-induced liver injury. Expert Rev. Mol. Diagn. 18 (1), 47–54. Hunt, C.M., Papay, J.I., Stanulovic, V., Regev, A., 2017. Drug rechallenge following druginduced liver injury. Hepatology 66 (2), 646–654. Jin, Y., Huang, Z.L., Li, L., Yang, Y., Wang, C.H., Wang, Z.T., Ji, L.L., 2019. Quercetin attenuates toosendanin-induced hepatotoxicity through inducing the Nrf2/GCL/GSH antioxidant signaling pathway. Acta Pharmacol. Sin. 40 (1), 75–85. Kurt, F., Raj, V., Romil, S., 2015. Drug-induced liver injury. Arch. Pathol. Lab. Med. 7, 876–887. Lagos-Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel, W., Tuschl, T., 2002. Identification of tissue-specific microRNAs from mouse. Curr. Biol. 12 (9), 735–739. Leão, R., Agthoven, T., Figueiredo, A., Jewett, M., Fadaak, K., Sweet, J., Ahmad, A.E., Anson-Cartwright, L., Chung, P., Hansen, A., Warde, P., Castelo-Branco, P., O'Malley, M., Bedard, P.L., Looijenga, L., Hamilton, R.J., 2018. Serum miRNA predicts viable disease after chemotherapy in patients with testicular nonseminoma germ cell tumor. J. Urol. 200 (1), 126–135. Lee, E.K., Jeong, H.O., Bang, E.J., Kim, C.H., Mun, J.Y., Noh, S., Gim, J.A., Kim, D.H., Chung, K.W., Yu, B.P., Chung, H.Y., 2018. The involvement of serum exosomal miR500-3p and miR-770-3p in aging: modulation by calorie restriction. Oncotarget 9 (5), 5578–5587. Li, X., You, M., Liu, Y.J., Ma, L., Jin, P.P., Zhou, R., Zhang, Z.X., Hua, B., Ji, X.J., Cheng, X.Y., Yin, F., Chen, Y., Yin, W., 2017. Reversal of the apoptotic resistance of nonsmall-cell lung carcinoma towards TRAIL by natural product toosendanin. Sci. Rep. 7 (1), 42748. Lin, H.X., Ewing, L.E., Koturbash, I., Gurley, B.J., Miousse, I.R., 2017. MicroRNAs as biomarkers for liver injury: current knowledge, challenges and future prospects. Food Chem. Toxicol. 110, 229–239. Liu, X., Zheng, J., Xue, Y., Yu, H., Gong, W., Wang, P., Li, Z., Liu, Y., 2018. PIWIL3/OIP5AS1/miR-367-3p/CEBPA feedback loop regulates the biological behavior of glioma cells. Theranostics 8, 1084–1105. Lu, X.Y., Ji, C., Tong, W., Lian, X.P., Wu, Y., Fan, X.H., Gao, Y., 2016. Integrated analysis
8