Identification of the N and NSs proteins coded by the ambisense S RNA of punta toro phlebovirus using monospecific antisera raised to baculovirus expressed N and NSs proteins

VIROLOGY

157,

338-350

(1987)

Identification of the N and NSs Proteins Coded by the Ambisense S RNA of Punta Toro Phlebovirus Using Monospecific Antisera Raised to Baculovirus Expressed N and NSs Proteins HIIARY NERC

A. OVERTON, Institute

of Virology,

Received

August

TAKESHI Mansfield 25,

IHARA, Road,

AND

Oxford,

1986; accepted

DAVID H. L. BISHOP’ OX1 3SR, United

November

Kingdom

24, 1986

An essentially complete DNA copy of the ambisense S RNA species of Punta Toro (PT) phlebovirus (T. Ihara, l-l. Akashi, and D. H. L. Bishop, 1994, Virology 136, 293-306) has been inserted in either orientation into Autographs californica nuclear polyhedrosis baculovirus (AcNPV) in lieu of the 5’ coding region of the AcNPV polyhedrin gene (G. E. Smith, M. D. Summers, and M. J. Fraser, 1963, Mol. Cell. Biol. 3, 2156-2165). The two types of recombinant viruses were used to infect Spodopfera frugiperda cells and the expressed PT viral proteins characterized. Recombinant AcNPV having the S DNA in one orientation expressed PT virus N protein in amounts estimated to represent some 50% of the infected cell extracts, whereas recombinants with the S DNA in the other orientation expressed the putative PT virus NSs protein in lower quantities. Antisera that were monospecific with respect to each of the two PT proteins virus were raised in mice using the corresponding S. frugiperda infected cell extracts and were employed to identify N and NSs proteins in PT virus-infected Vero cells. o 1987 Academic press. inc.

INTRODUCTION

identified in virions or in extracts of infected cells. Northern analyses, undertaken using single-strand probes representing the individual coding regions of the S DNA, have demonstrated the existence of two subgenomic S RNA species in extracts of PT virusinfected cells (Ihara et a/., 1985). One was shown to have a viral-complementary sequence (N gene), the other was found to have a viral-sense sequence (putative NSs gene). In vitro translation of infected cell RNA confirmed the existence of a subgenomic N mRNA by the synthesis of a polypeptide having the serological specificity of the viral N protein. However, no NSs protein was identified by these procedures, presumably due to the low abundance of the mRNA in the infected cell extracts (Ihara et a/., 1985). The synthesis of the subgenomic N RNA species, but not that of the NSs RNA, was also demonstrated when PT virus was grown in the presence of inhibitors of protein synthesis, indicating that the N mRNA represents a primary transcription product (Ihara eta/., 1985) in agreement with the hypothesis that viral RNA replication is required before the putative NSs mRNA species can be made. In order to identify PTvirus NSs protein, an essentially complete DNA copy of the viral S RNA segment has been inserted in either orientation into the genome of AcNPV in lieu of the 5’ coding region of the AcNPV polyhedrin gene (Smith et a/., 1983; Possee, 1986). Expression of the PT virus N and NSs polypeptides by the AcNPV recombinant viruses in Spodoptera frugiperda ceils is described. Monospecific antisera, with

Viruses of the family Bunyaviridae are characterized by having enveloped particles containing a tripartite, single-strand RNA genome of negative sense. Four genera of viruses, Bunyavirus, Phlebovirus, Uukuvirus, and Nairovirus, have been recognized on the basis of serology and molecular properties (Bishop et a/., 1980). A fifth genus, Hantavirus, has been proposed (McCormick eta/., 1982; Schmaljohn and Dalrymple, 1983; White et al., 1982). Sequence analyses of the smallest (S) RNA of members of the Bunyavirus genus have shown that it codes for two polypeptides, the nucleocapsid protein (N) and a nonstructural protein (NSs, Bishop eta/., 1982; Akashi and Bishop, 1983; Fuller eta/., 1983). The two proteins are translated from overlapping reading frames in a mRNA species representing the S viral-complementary sequence and have been identified in extracts of virus infected cells (Fuller et al., 1983). By contrast, the S RNA of PT virus has an ambisense coding strategy: the 26.9 X lo3 Da PT N protein is coded by a viralcomplementary sequence corresponding to the 3’ half of the viral RNA, and a second protein (29.1 X 1O3 Da), designated NSs, is coded in a viral-sense sequence corresponding to the 5’ half of the viral RNA (Ihara et a/., 1984). The viral N protein is a structural component of nucleocapsids; the putative NSs protein has not been ’ To whom 0042-6822187

requests

for reprints

$3.00

Copynght 8 1997 by Academic Press, Inc. All rights of reproduction I” any fan reserved.

should

be addressed. 338

PUNTA

TORO

N AND

respect to the two PT S gene products, were prepared using the appropriate S. frugiperda cell extracts and were employed to identify the N and NSs proteins in PT virus-infected Vero cells. MATERIALS Viruses

AND

METHODS

and cells

AcNPV and recombinant virus stocks were grown and assayed in S. frugiperda cell monolayers as described by Brown and Faulkner (1977). PT virus was grown and titrated in Vero cells (Robeson et al., 1979). Purification

of PT virions

and nucleocapsids

Vero cells in 80-cm2 tissue culture flasks were inoculated with virus at a multiplicity of 0.1 PFU/cell and incubated in Dulbecco’s medium + 59/o FCS at 37” for 40 hr. The medium was then replaced with methioninedeficient Eagle’s minimum essential medium (EMEM) and the cells were incubated for a further 50 min. After this period, the cells were labelled for 5 hr using 200 &i[35S]methionine in 2 ml of methionine-deficient EMEM per flask. The media from the labelling period and the initial 40-hr incubation period were pooled, centrifuged at 5000 g for 10 min to remove cellular debris, and the virus was pelleted by centrifugation at 75,000 g for 1 hr. The virions were resuspended in TNE buffer (0.05 MTris-HCI, pH 7.9,0.15 M NaCI; 0.1 mM EDTA), layered on linear gradients of 15-55% (w/ v) sucrose in TNE, and centrifuged for 1 hr at 250,000 g. The gradients were fractionated, the virus band was located by scintillation counting, and virus containing fractions was pooled. In order to prepare nucleocapsids from the purified virions, 0.25 ml of the pooled material from the sucrose gradients was diluted to 2 ml in TE buffer, loaded on a preformed caesium chloride gradient (1 O-50% (w/w) CsCl in TE), and centrifuged for 12 hr at 100,000 g and 25”. The gradient was fractionated and the band of nucleocapsids was identified by scintillation counting. The purified virions and nucleocapsids were diluted in TE buffer, pelleted for 1 hr at 250,000 g, and resuspended in RIPA buffer. Aliquots were heated at 100” for 5 min in dissociation buffer and their protein components were analysed by electrophoresis in a 10% polyacrylamide Laemmli gel and fluorography. Synthesis

of a cDNA

copy of the S RNA of PT virus

A synthetic oligodeoxyribonucleotide to 3’ residues 9-27 of PT S RNA (Sl a/., 1984) was used to prime cDNA purified PT viral RNA as the template transcriptase reaction (Maniatis et a/.,

complementary primer; lhara et synthesis using for the reverse 1982). The DNA

NSs

339

PROTEINS

transcripts were tailed with dCTP and back-copied using an oligo-dG primer. The resulting DNA molecules were then tailed with dCTP, and cloned into a Pstl cut, dGTP tailed pBr322 vector (Maniatis et a/., 1982). After colony hybridisation using the appropriate DNA probes (Grunstein and Hogness, 1975; lhara et al., 1984) a clone containing an almost full-length copy of the S RNA segment was identified by Hinfl restriction enzyme analysis (Ihara et al., 1984). Sequence analysis of the ends of the insert demonstrated that the clone contained residues 9-l 895 of the 1903-nucleotide-long PT S segment, including, therefore, the complete N and NSs coding regions (Ihara et a/., 1984). Construction of AcNPV transfer vectors

recombinant

Before ligation into the transfer vectors, it was necessary to remove the terminal G-C base pairs from both ends of the PT S DNA clone. The viral insert, which contained two internal Pstl sites (but no internal Seal, HindIll, or BarnHI sites; lhara et a/., 1984) was recovered from the original, pBR322-derived plasmid by partial Pstl digestion then ligated into the Pstl site of the plasmid pUC8. After recloning and confirmation of the identity of the insert, the viral DNA was excised from the pUC8 vector by digestion with HindIll and BarnHI and purified by agarose gel electrophoresis and electroelution. The viral DNA was then digested briefly with Bal31 exonuclease, repaired with Klenow enzyme, and ligated into the unique Smal site of an AcNPV transfer vector designated pAcRP5-S. This vector was derived from the pAcRP5 plasmid described by Possee (1986) by modifying its unique BarnHI site with a BarnHI-Smal adaptor. Two clones were obtained with the S DNA in opposite orientations. Sequence analyses demonstrated that they both lacked the homopolymeric G-C tracts but retained the translation initiation sites of the N and NSs genes. While these experiments were in progress it was demonstrated that recombinant viruses derived from the pAcRP5 vector were not as efficient in the expression of foreign genes as those derived from the vector pAcRP6 (Matsuura et a/., 1986; Possee, 1986) or pAc373 (Smith et a/., 1983; Y. Matsuura, unpublished data). The PT S viral inserts were therefore removed from their respective plasmids by BarnHI digestion and ligated into the BarnHI site of the transfer vectors pAcRP6 (Possee, 1986) and pAc373 (Smith et a/., 1983). Like the pAcRP5 vector, both transfervectors contain the AcNPV polyhedrin gene from which the AUG codon has been deleted, together with the eight preceding and 175 succeeding nucleotides, and replaced with a BarnHI linker (Smith et a/., 1983). In addition, pAc373 has an extra eight nucleotides (vide infra) of unknown origins (Kuroda et a/., 1986; Matsuura et

340

OVERTON, IHARA, AND BISHOP

al., 1986). The derived recombinant

transfer vectors, pAc373.PT N and pAc373.PT NSs, containing the PT S DNA in opposite orientations (Fig. 1; likewise pAcRPG.PT N, pAcRPG.PT NSs) were selected by colony hybridisation and characterised by Hinfl mapping. The sequences at the insertion sites were verified (Fig. 2; Maxam and Gilbert, 1980). Recombinant

virus construction

S. frugiperda cells were transfected with mixtures of infectious AcNPV DNA and plasmid DNA representing the individual recombinant transfer vectors using a procedure similar to that of Smith and associates (1983). One microgram of viral DNA was mixed with 25-l 00 pg of plasmid DNA and precipitated with (final concentrations) 0.125 n/l calcium chloride in the presence of 20 rnM HEPES buffer, pH 7.5, 1 mM disodium hydrogen orthophosphate, 5 mM potassium chloride, 140 mlLl sodium chloride, and 10 mM glucose (total volume, 1 ml). The DNA suspension was inoculated onto a monolayer of 10” S. frugiperda cells in a 35-mm tissue culture dish, allowed to adsorb to the cells for 1 hr at room temperature, then replaced with 1.5 ml of medium. After incubation at 28” for 2 days the supernatant fluids were harvested and used to produce plaques in S. frugiperda cell monolayers. Plaques containing recombinant virus were identified by their lack of polyhedra when examined by light microscopy. Virus from such plaques was recovered and after further plaque purification was used to produce polyhedrinnegative virus stocks containing 5 X 10’ to lo8 PFU/ml. AcNPV viral DNA purification S. frugiperda cells in 175-cm2 tissue culture flasks were infected with virus at a multiplicity of 1 PFU/cell and incubated at 28” for 3 to 4 days until all the cells exhibited cytopathic effects. The supernatant medium was harvested, centrifuged at 5000 g for 10 min to remove cell debris, and the virus was pelleted at 75,000 g for 1 hr. The pellets were resuspended in TE buffer (10 mMTris-HCI, 1 mM EDTA, pH 7.5) and loaded on top of sucrose consisting of 5 ml of 50% (w/v) sucrose overlaid with 5 ml of 10% (w/v) sucrose (both prepared in TE buffer). The samples were centrifuged for 1 hr at 100,000 g after which the virus particles were recovered from the interface of the two sucrose solutions, diluted with 4 vol of TE buffer, and pelleted at 75,000 g for 1 hr. The pellets were resuspended in TE buffer and virions disrupted by the addition of one-fifth volume of 10% sodium N-lauroyl sarcosinate, 10 mM EDTA, pH 7.5. After incubation at 60” for 20 min the products were layered on 7.5 ml of caesium chloride solution

(54% (w/v) in TE buffer) containing 100 pg/ml of ethidium bromide, and centrifuged to equilibrium at 100,000 g and 20” for 17 hr. The lower band of closed circular DNA was recovered, the ethidium bromide removed by butanol extraction, and the DNA dialysed against TE buffer. When DNA was required for Southern analyses rather than for transfections, the caesium chloride gradient step was omitted, and nucleic acids were recovered from disrupted virions by SDS-phenol extraction and ethanol precipitation. Preparation

of infected-cell

RNA

S. frugiperda cells were infected at a multiplicity of 10 PFU/cell and incubated at 28” for 48 hr. The cells were recovered and rinsed in phosphate-buffered saline (PBS). RNA was extracted by the guanidinium-hot phenol method of Feramisco et a/. (1982). Polyadenylated RNA species were purified from nonpolyadenylated RNA by chromatography on oligodeoxythymidylic acid-cellulose columns (Maniatis eta/., 1982). Cellular RNA was extracted from PT virus-infected Vero cells as described by lhara et al. (1985). Southern

analyses of DNA

DNA samples were digested to completion with BarnHI and the products were resolved by electrophoresis in 0.8% agarose and transferred by blotting to Genescreen membranes (New England Nuclear Corp., Boston, MA). The filters were dried, baked at 80” for 2 hr, and hybridised (Southern, 1975) to nick-translated PT S DNA excised from pAc373.PT N by BarnHI digestion and purified by electrophoresis in 0.8% agarose. After hybridisation, the membranes were washed and autoradiographed. Northern

analyses of infected cell RNA

RNA preparations were treated with 10 mM methyl mercury (II) hydroxide (Bailey and Davidson, 1976) electrophoresed in gels of 1% agarose containing 10 mM methyl mercury and blotted onto Genescreen membrane. The membrane was dried, baked at 80” for 2 hr, and hybridised to nick-translated PT S DNA as described by Denhardt (1966). Labelling

and analysis of infected-cell

polypeptides

Monolayers of S. frugiperda cells in 35-mm tissue culture dishes were infected with AcNPV or recombinant viruses at a multiplicity of 10 PFU/cell and incubated at 28“ for 48 hr. The cells were incubated for 1.5 hr in methionine-free medium, then labelled for 1 hrwith 25 &i of [35S]methionine (NEN, >800 Ci/mmol) in 0.2 ml of methionine-free medium per dish. The cells

PUNTA

TORO

N AND

were rinsed three times with PBS and lysed in 150 PII dish of RIPA buffer (1% Triton X-100, 1% sodium deoxycholate, 0.15 M NaCI, 0.01 M Tris-HCI, 0.01 M EDTA, 0.1% SDS, pH 8.0). For time-course analyses, S. frugiperda cells were infected as described above and harvested at 1, 2, 3 or 4 days postinfection without labelling. Labelled PT virus polypeptides were obtained by infecting monolayers of Vero cells at a multiplicity of 20 PFU/cell. After incubation at 37” for 18 hr, the cells were starved for 1 hr using either methionine- or leucine-free EMEM then labelled in similar media containing either [35S]methionine as described above or 15 &i/dish of [3H]leucine (NEN, 60 Ci/mmol). Aliquots (10 ~1) of the cell lysates were mixed with 10 ~1 of dissociation buffer (10% P-mercaptoethanol, 10% SDS, 25% glycerol, 10 mM Tris-HCI, pH 6.9, 0.02% bromphenol blue), heated at 100” for 10 min, and electrophoresed in 10 or 12% polyacrylamide slab gels prepared as described by Laemmli (1970). After electro-

NSs

341

PROTEINS

phoresis at 150 V for 2.5 to 3 hr, gels containing labelled polypeptides were impregnated with 2,5-diphenyloxazole (Laskey and Mills, 1975) dried, and used to expose X-ray film at -70”. Nonradioactive gels were stained in 0.25% Kenacid Blue (BDH Chemicals, Poole, UK) in 10% (v/v) aqueous acetic acid containing 459’0 methanol. lmmunoprecipitation

of polypeptides

Aliquots (10 ~1) of cell lysates in RIPA buffer were mixed with 10 ~1 of ascitic fluid diluted in PBS and left at 4’ overnight. To these samples 25 ~1 of protein ASepharose CL4B beads (Sigma, Poole, UK) preswollen in RIPA buffer (100 mg/ml) were added and the mixtures incubated at 37” for 1 hr. The beads were recovered by centrifugation, washed three times in 200 ~1of RIPA buffer, and heated at 100” for 5 min in dissociation buffer to disrupt the immune complexes. The supernatant fluids were recovered and analysed by electro-

AcNPV

AoNPV

PTY-S

FIG. 1. Diagrammatic representation of transfer vectors. The coding region representing the PT virus S DNA was inserted in either orientation into the transfer vectors pAc373 (Smith et al., 1983) and pAcRP6 (Possee, 1986; Matsuura et a/., 1986) as described under Materials and Methods. The diagrams show the following features: the pUc8 plasmid sequence (single line) modified to remove a BamHl restriction site; the 7.1 -kb fcoRI I fragment of AcNPV (narrow boxes) modified by removing the polyhedrin AUG codon and flanking nucleotides (residues -8 to +175, Hooft van lddekinge et al., 1983) and replacing them with a BarnHI linker; the PT virus S DNA inserted sequence (wide boxes; the speckled region representing the S intergenic, noncoding sequence, lhara et al., 1984); the AcNPV transcription initiation site and the remaining polyhedrin coding sequence (cross-hatched boxes). Arrows indicate the direction of transcription from the polyhedrin promoter for each of the vectors.

342

OVERTON,

phoresis on 10% Laemmli described above.

gels and fluorography

IHARA,

as

lmmunofluorescence S. frugiperda cells in 35-mm tissue culture dishes were infected at a multiplicity of 10 PFWcell and incubated at 28” for 48 hr. The cells were harvested by centrifugation, washed three times in PBS, and aliquots containing approximately 1 O4 cells were spotted onto glass microscope slides (Multispot, C. A. Hendley, Loughton, UK). After drying, the cells were fixed in acetone at 4” for 10 min, rinsed in water, and dried. A 5~1 aliquot of mouse ascitic fluid, appropriately diluted in PBS, was applied to each spot. The slides were incubated at 37’ for 1 hr, washed with PBS, stained with fluorescein-conjugated swine anti-mouse IgG antibody for 1 hr at 37”, rinsed again, and examined under UV illumination.

Production

of antibodies

in mice

Extracts of S. frugiperda cells infected with recombinant baculoviruses were prepared as detailed under Results and were used to raise antibodies in mice. Each mouse received one intraperitoneal injection of antigen in Freund’s complete adjuvant on Day 0, followed by three successive injections of antigen in Freund’s in-

AND

complete adjuvant (Days 7, 14, and 21) and one intraperitoneal injection of 2 X lo6 Ehrlich’s ascites cells on Day 18. Ascitic fluid was removed at intervals from Day 25 to Day 35. The amounts of N and NSs in the injected cell extracts were estimated by PAGE by comparison with known quantities of bovine serum albumin. Each cellular extract was injected at two different dilutions, so that each mouse received either 25-30 or 5-6 pg of the PT viral antigen per injection.

RESULTS Construction

of recombinant

baculoviruses

An essentially complete DNA copy of the S RNA segment of PT virus was inserted in either orientation into the transfer vectors pAcRP6 and pAc373 as described under Materials and Methods. For each type of transfer vector two recombinants were obtained (pAcRPG.PT N, pAcRPG.PT NSs, pAc373.PT N, pAc373.PT NSs) in which the N and NSs genes were placed under the control of the AcNPV polyhedrin promoter (Fig. 1). The sequences at both ends of each insert were analyzed as summarized in Fig. 2. The AUG codons of the PT virus N and NSs genes were determined to be 2 1 and 15 bases (respectively) downstream of the linker region for each vector.

AcNPV

-70 -60 -80 -50 TGGAGATAATTAAAATGATACCATCTCGCAAATAAATAATA

pAcRP6/PT-NSS

TGGAGATAATTAAAATGATACCATCTCGCAAATAAATAACC

pAcRP6/PT-N

TGGAGATAATTAAAATGATACCATCTCGCAAATAAATAACC

pAc373/PT-NSS

TGGAGATAATTAAAATGATAACCATCTCGCAAATAAATAACC

pAc373/PT-N

TGGAGATAATTAAAATGATACCATCTCGCAAATAAATAACC

-30

-40

-20

-10

+30 +40 +1 +10 +20 ATGCCGGATTATTCATACCGTCCCACCATCGGGCGTACCTAC -RPDYSYRPTIGRTY

AcNPV (cant)

pAcRP6/PT-NSS

BISHOP

(cant)

30 ~~~~~~~~~~~GAATZTTTCGTCA+T;C+CA;Z 40

pAcRP6/PT-N

(cant)

CCGGATCCC~TGAAAi~TTATTTAA%AA+GT~

20 pAc373/PT-NSS pAc373/PT-N

(cod) (cant)

~CTG~ATTTTTTCGTCA$T;C~CA;Z ~~TC~XTGAAAZTTATTTAA%AAAAAT~

FIG. 2. Insertion sequences of PT N and NSs transfer vectors compared to AcNPV. The AcNPV linker sequences are boxed. Note that the pAc373 derived vectors have additional linker sequences The coding sequences of the genes are identified.

sequence is shown of unknown origins

in the upper lines. The (Matsuura eta/., 1986).

PUNTA

TORO

N AND

343

NSB PROTEINS

migrated with an estimated size of 27 X lo3 Da, i.e., similar to that of the PT virus N protein (Ihara et a/., 1984). The serological identity of the product to PT N uninf. VNO

PT hf. VNO

Ac373.

Ac373.

pi N pi NS

AcNPV

S.f.

AC373. PT NSS

AcRPS. PT NSS

pAc37

FIG. 3. Southern blot analysis of Ac373.PT N and Ac373.PT NSs recombinant virus DNA. Purified viral DNA was digested to completion with BarnHI, resolved by electrophoresis in a gel of 0.8% agarose (left-hand panel), blotted onto Genescreen membrane and hybridized to a PT virus S specific radioactive DNA probe (right-hand panel) as described under Materials and Methods. DNAfrom wild-type AcNPV and pAc373.PT N transfer vector DNA were included in the analysis as negative and positive controls, respectively.

S. frugiperda cells were transfected with mixtures of AcNPV DNA and each of the transfer vectors, as described under Materials and Methods. Plaques produced by the progeny viruses from each transfection were screened for recombinants exhibiting a polyhedrin-negative phenotype. After replaquing three times, viral DNA representing each putative recombinant was obtained. The viral DNA preparations were digested with BarnHI and hybridized to PT viral DNA (Fig. 3). By these means recombinant baculoviruses were identified and designated Ac373.PT N, Ac373.PT NSs, AcRPG.PT N, and AcRPG.PT NSs according to the 5’ location of the PT gene (see Fig. 1). Expression of PT virus in S. frugiperda cells

N and NSs polypeptides

Confluent monolayers of S. frugiperda cells were infected at high multiplicity with AcNPV or the recombinant baculovirusesand pulse-labelled with [35S]methionine as described under Materials and Methods. An analysis of the products by PAGE is shown in Fig. 4. By comparison with the 33 X 1 O3 Da polyhedrin protein induced by AcNPV (Hooft van lddekinge et a/., 1983; Vlak et a/., 1981) the Ac373.PT N and AcRPG.PT N recombinants synthesised a major protein species that

bN 3 NSS

S.f.

AC373. PT N

AcRPS. PT N

sf.

N,

FIG. 4. Expression of N and NSs gene products by recombinant baculoviruses. Uninfected S. frugiperda cells (S. f), or cells infected with the recombinant baculovirus Ac373.PT N, orAc373.PT NSs, or AcRPG.PT N, orAcRPG.PT NSs, or with wild-type AcNPV, were pulselabelled after 48 hr with [36S]methionine. as described under Materials and Methods. Uninfected or PT virus-infected Vero cells were labelled with [3H]leucine. Lysates of the infected or uninfected cells were electrophoresed in a 10% polyacrylamide Laemmli gel and the labelled polypeptides were identified by fluorography. The positions of the AcNPV polyhedrin protein (P) and the PT N and NSs gene products are indicated (see text). The upper panel compares proteins in S. frugiperda cells infected with Ac373.PT N, Ac373.PT NSs, or AcNPV, and in PT virus-infected Vero cells. The lower panel compares the levels of expression of N and NSs recombinants by viruses construtted using the two transfer vectors pAc373 and pAcRP6.

344

OVERTON,

IHARA,

AND

BISHOP

protein was shown by immunoprecipitation studies (Fig. 5) using a monoclonal antibody kindly provided by Dr. J. Smith (USAMRIID, Frederick, MD). The antibody was also used for the identification of N protein by immunofluorescence analyses of Ac373.PT N infected S. frugiperda cells as shown in Fig. 6. Based on the incorporation of [35S]methionine (Fig. 4) but without taking into account the relative numbers of methionine residues in the two proteins (primary gene products: PT N, 1 1 residues, AcNPV polyhedrin, 6 residues), the amount of the PT N protein synthesized by the Ac373.PT N and AcRPG.PT N recombinants appeared to approach that of polyhedrin protein synthesised in cells infected with wild-type AcNPV. The reported size of the PT NSs gene product is 29 x 1O3 Da (Ihara et al., 1984); however, no new protein of that size was identified in the AcRPG.PT NSs or Ac373.PT NSs recombinant virus-infected cell extracts

PTV-inf.

Vero

Ac373.PT N inf. S. frug

FIG. 6. lmmunofluorescence of S. frugiperde cells infected with recombinant or wild-type AcNPV. Ceils were treated with a monoclonal antibody specific for PT virus N protein and stained for fluorescence microscopy as described under Materials and Methods. (a) Cells infected with the recombinantAc373.PT N. (b) Cells infected with wild-type AcNPV. (c) Cells infected with the recombinant Ac373.PT NSs.

FIG. 5. lmmunoprecipitation of recombinant baculovirus expressed PT virus N protein. S. frugiperda cells infected with the recombinant baculovirus Ac373.PT N and Vero cells infected with PT virus were pulse-labelled with [%3]methionine. Cell lysates were prepared and immunoprecipitated with a PT virus N protein monoclonal antibody as described under Materials and Methods. As a control for nonspecific precipitation, samples of the lysates were similarly subjected to the immunoprecipitation protocol using nonimmune ascitic fluid. The position of PT virus N protein is indicated.

(see Fig. 4). For both recombinant% a major new protein species with an estimated size of 26 X lo3 Da was observed in the infected cell extracts (Fig. 4). Since the PT NSs protein has not been previously identified in PT virus-infected Vero cells and no NSs monoclonal antibodies were available, it was not possible to directly prove that the 26 X lo3 Da protein represented the NSs gene product. However, a minor protein equivalent to the 26 x 1O3 Da polypeptide was identified in extracts

PUNTA

TORO

N AND

of PTvirus-infected Vero cells (Fig. 4, track 2). As shown later, evidence has been obtained that the 26 x lo3 Da polypeptide in fact represents the NSs protein. Even though the NSs primary gene product has only nine methionine residues (Ihara et al., 1984) based on the incorporation of [35S]methionine, the level of NSs expression appeared to be lower than that of N protein made by the PT N recombinant viruses. In the case of the N (or N&J protein, the levels of expression were essentially the same, regardless of whether the recombinant virus had been constructed using the pAc373 or the pAcRP6 transfer vector (Fig. 4, lower panel). In order to analyse the time course of synthesis of proteins by the recombinant baculoviruses, S. frugiperda cells were infected with AcNPV or the Ac373 recombinants and unlabelled extracts of the cells harvested at 1, 2, 3, and 4 days postinfection were analysed by PAGE and Kenacid Blue staining (Fig. 7). Although the polyhedrin protein (AcNPV infection), PT N (Ac373.PT N), and PT NSs (Ac373.PT N&J proteins were evident by 1 day postinfection, they represented major components of the infected cells by 2-4 days postinfection. Based on the stained protein patterns, the amounts of PT N and NSs in the cells were estimated from optical scans of the gel using a densitometer to be of the order of 50% (N, Day 3) and 10% (NSs, Day 4) of the infected cell extracts.

NSs

PROTEINS

Expression of PT virus N and NSs polypeptides in Trichoplusia ni larvae The Ac373.PT N and Ac373.PT NSs recombinant viruses were used to infect third instar T. nicaterpillars and the larvae harvested at 3-5 days postinfection. Extracts of the insects were resolved by polyacrylamide gel electrophoresis and the gels were stained in order to characterise the predominant protein species. As shown in Fig. 8, a major protein band corresponding in size to the PT N protein was identified in extracts of the insects infected with Ac373.PT N by 4 days postinfection. By comparison with known amounts of bovine serum albumin run alongside the larval extracts, it was estimated that each infected larva contained 0.5-l mg of PT N protein. In the case of larvae infected with Ac373.PT NSs, a protein with the mobility characteristic of PT NSs could be seen, but in much smaller amounts than N. This observation reflects the difference in level of expression seen in S. frugiperda cells infected with the recombinant viruses. Interestingly, a major protein component of uninfected larvae (Fig. 8, track U) with an estimated size of approximately 100 X 1O3 Da appeared to be present in substantially reduced quantities in the Ac373.PT N virus-infected larvae by 5 days postinfection. Similar observations have been made for AcNPV infections under conditions where the polyhedrin protein is a predominant species in the infected

RECOMBINANTS

S. frug. Ac373.PT 12341234123

N

345

AcNPV Ac373.PT

NSS 4

FIG. 7. Time course of the synthesis of baculovirus-expressed N and NSs proteins. S. frugiperda cells were infected with the recombinant baculovirus Ac373.PT N, or Ac373.PT NSs, or with wild-type AcNPV and were harvested at 1, 2, 3, or 4 days postinfection as indicated. Lysates were analysed by electrophoresis in a 12% polyacrylamide Laemmli gel and stained with Kenacid Blue. The positions of the polyhedrin protein (P) in the AcNPV lysates and the PT N and NSs gene products are indicated. A sample of uninfected cell lysate (S. frug.) was included for comparison.

346

OVERTON, Ac373.PT s. frug.

N

3

4

Ac373.PT

U

larvae

larva 4

5

IHARA,

4

4

5

BISHOP

(0.95 and 1 .O kb; lhara et a/., 1985). For both recombinant baculoviruses, the major PT mRNA species migrated with a mobility substantially lower than that of the 1.9-kb, full-length, PT viral S RNA, implying that transcription from the polyhedrin promoter encompassed the entire PT DNA and probably terminated at the downstream polyhedrin termination signal, resulting in mRNA that is approximately 3 kb in length. Although no internal controls were employed, it appeared that the amount of PT mRNA species was lower in the cells infected with the Ac373.PT NSs recombinant than in cells infected with the Ac373.PT N recombinant. This observation may account for the lower level of protein expression by the NSs recombinant (Figs. 4, 7).

NSS

larvae 3

AND

5

Production of antibodies N and NSs proteins ND : NSS

FIG. 8. Analysis of the proteins recovered from T. ni larvae infected with the recombinant baculoviruses Ac373.PT N or Ac373.PT NSs. Third instar T. ni larvae were infected with recombinant baculoviruses by the oral route and harvested at 3, 4, or 5 days postinfection as indicated. The majority of the larvae died on Day 5. Individual larvae were homogenised with 1 ml of PBS containing 0.02% sodium diethyldithiocarbamate. Aiiquots of the homogenates were heated at 100” for 10 min in protein-dissociation buffer, electrophoresed in a 12% polyacrylamide Laemmli gel and stained with Kenacid Blue. Samples of Ac373.PT N virus-infected S. frugiperda cell lysate and of a homogenate from an uninfected larva (U) were included for comparison. Mobilities of the N and NSs polypeptides are indicated.

larvae (data not shown). For the Ac373.PT NSs virusinfected species the high-molecular-weight protein remained as a substantial component of the larval extracts (Fig. 8). Whether the high level of expression of the PT N (or polyhedrin protein for AcNPV) is commensurate with the mobilisation of this large caterpillar protein is not known. Northern analyses of the RNA species present in infected S. frugiperda cells Transcription of the PTviral genes in the baculovirus expression system was analysed by Northern blotting of polyadenylated RNA recovered from S. frugiperda cells infected with the two recombinant viruses, as described under Materials and Methods (Fig. 9). Total RNA from PT virus-infected Vero cells was included as a size marker, giving bands representing full-length viral and viral-complementary S RNA (1.9 kb) and the two (unresolved) subgenomic messenger RNA species

to baculovirus-expressed

S. frugiperda cells were infected with the Ac373.PT N or Ac373.PT NSs recombinants at a multiplicity of 10 PFU/cell. After 48 hr incubation at 28’, the cells were harvested, rinsed three times in PBS, and resuspended in PBS at a concentration of approximately 2.5 x lo7 cells/ml. Cells were disrupted either by the ad-

v/vc

RNA mRNA

FIG. 9. Northern analysis of PT virus specific RNA recovered from recombinant baculovirus-infected cells. Polyadenylated RNA isolated from S. frugiperda cells infected with the recombinant Ac373.PT N or Ac373.PT NSs was electrophoresed in 1% agarose containing 10 mM methyl mercury, blotted onto Genescreen membrane and hybridized to a radioactive DNA probe consisting of the PT virus S DNA recovered from the pAc373.PT N transfer vector. As size markers, PT viral S RNA and subgenomic S mRNA species isolated from PT virus-infected Vero cells were included in the analysis (see text for details).

PUNTA

TORO

N AND

dition of Triton X-100 to a concentration of 1% or by three cycles of freezing in a solid COJethanol bath followed by immediate thawing at 37”. In both cases,

Ac373.PT total

freeze/thaw SUP.

U

PT

VIRUS

Inf.

Anti-N

PROTEINS

Ac373.PT

SUP.

total pellet

INFECTED C

347

cellular debris was spun down at 5000 g for 10 min and resuspended in a volume of PBS equal to that of the supernate. The distribution of N and NSs proteins

N Triton

pellet

NSs

NSS Triton

freeze/thaw SUP.

VERO

pellet

sup.

pellet

CELLS Inf.

Anti-N%

C

N NSS

FIG. 10. Production of antibodies to the N and NSs gene products recovered from recombinant baculovirus-infected S. frugiperda cells. Top panel: Analyses of S. frugiperda cell lysates. S. frugiperda cells infected with the recombinant Ac373.PT N or Ac373.PT NSs, were disrupted by freeze-thawing, or by Triton X-l 00 treatment and centrifuged as described in the text. Proteins in the pellet and supernatant (sup) fractions from the disrupted cells were analysed by electrophoresis in a 10% polyacrylamide Laemmli gel and the proteins were stained with Kenacid Blue. Lower two panels: Identification of PTvirus N and NSs gene products. A lysate of PT virus infected Vero cells labelled with [?S]methionine (Inf.) was immunoprecipitated with ascitic fluids raised against S. frugiperda cells infected with Ac373.PT N (Anti-N) or Ac373.PT NSs (AntiNSs) or with nonimmune ascitic fluid (C). A sample of lysate from uninfected, labelled Vero cells (U) was included for comparison,

348

OVERTON,

IHARA,

between the pellet and supernate was determined by PAGE analysis of an aliquot of each preparation (Fig. 10, upper panel). The N polypeptide was identified in both fractions, although somewhat more in the supernate than in the pellet: by contrast the NSs protein was principally associated with the cellular debris. Supernatant fractions containing the N protein, and pellet fractions containing NSs species were used to raise antibodies in mice by the protocol described under Materials and Methods. Samples of the resulting ascitic fluids were employed to immunoprecipitate extracts of PT virus-infected Vero cells. PT virus N protein was precipitated by antibodies raised against the S. frugiper& extracts recovered from cells infected with the PT N recombinant (Fig. 10, lower panel). The antiserum raised to the S. frugiperda extracts recovered from cells infected with the NSs recombinants precipitated the 26 X 1O3 Da protein (Fig. 10). Both the control ascitic fluids and those obtained from mice that received the extracts derived from the NSs recombinant precipitated only small amounts of N protein, presumably representing a nonspecific effect. Based on these results it is concluded that the 26 X lo3 Da protein identified in PT virus-infected Vero cells represents the NSs protein.

Association of NSs protein and nucleocapsids

with virions

[35S]Methionine-labelled PT virions were obtained and purified as described under Materials and Methods. The virions, when subjected to caesium chloride gradient centrifugation, were found to dissociate to yield a band of nucleocapsids (see Materials and Methods). Proteins from the virions and nucleocapsids were analysed by PAGE (Fig. 1 1) alongside a lysate of PT-infected Vero cells. For both the virions and nucleocapsids, a minor protein constituent was seen to migrate slightly ahead of N protein. This minor component was concluded to be the NSs protein, by virtue of the fact that its mobility corresponded precisely with that of NSs protein in the PT-infected Vero cell lysate. However, confirmation of this conclusion by immunoprecipitation was found to be impracticable due to the relatively low level of radioactivity in the virion and nucleocapsid preparations. The virion and nucleocapsid preparations show no evidence of contamination with host-cell material, and the relative proportions of N and NSs in cells, virions, and nucleocapsids are similar, suggesting a specific association of NSs protein with the nucleocapsid structure.

DISCUSSION Recombinant baculoviruses containing the PT virus S cDNA in either orientation have been used to express

AND

BISHOP Vero uninf.

virions PT-inf.

nucleocapsids

4Gl 462

4N 4NSs FIG. 11. Analysis of polypeptides in PT virions and in nucleocapsids isolated from virions. [36S]Methionine-labelled virions and nucleocapsids were purified as described under Materials and Methods, disrupted by boiling in dissociation buffer, and electrophoresed in a 10% polyacrylamide Laemmli gel. Samples of lysates of [35S]methionine-labelled Vero cells, either uninfected or PT infected, were included for comparison. The positions of N, NSs, and the two viral glycoprotein species (Gl and G2) are identified.

the PT virus N and NSs proteins in S. frugiperda tissue culture cells and in T. ni larvae. For this purpose, two transfer vectors were employed, one of which contains an extra eight bases in the linker region between the polyhedrin promoter and the PT virus coding sequence (Fig. 2). For these two genes the vector difference appeared to have no effect on the level of expression of the PT virus polypeptides, in contrast to the situation with the nucleocapsid (N) protein of lymphocytic choriomeningitis arenavirus (LCMV), where expression was at least threefold lower when the recombinant virus was constructed using the pAcRP6 transfer vector rather than pAc373 (Y. Matsuura, personal communication). The results reported in this paper show that pAc373 and pAcRP6 derived recombinants have the potential to express the PT S genes to equivalent levels. The reason for the difference between these results and those observed for the LCMV N protein is under investigation. Expression of the PT virus N protein in S. frugiperda cells reached a level approaching that of the polyhedrin protein in cells infected at an equivalent multiplicity with wild-type AcNPV, whereas the expression of PT virus

PUNTA

TORO

N AND

NSs protein was approximately fivefold lower. This result was irrespective of what multiplicity of infection was used (unpublished observations) or which particular recombinant virus clone was employed. The kinetics of synthesis for both PT viral polypeptides in the infected S. frugiperda cells paralleled that of the polyhedrin protein synthesized by AcNPV. The difference in the levels of N and NSs polypeptides produced in the recombinant virus-infected cells may be partly related to lower amounts of PT virus specific mRNA in S. frugiperda cells expressing the NSs protein than in those expressing N. However, unless some of the difference is explained by differences in DNA probe specificities, this may not be a complete explanation since the difference in the levels of mRNA for N and NSs appeared to be considerably greater than the difference in protein expression. The reason why there should be different levels of mRNA transcription from the two recombinant viruses is not known. The recombinant baculovirus-expressed PT N protein has been demonstrated to share the serological specificity of the N protein synthesized by PT virus in two ways: first by its ability to react with monoclonal antibodies raised against PT virus N protein, and second by the fact that antibodies raised against the baculovirus-expressed polypeptide-immunoprecipitated N protein from lysates of PT virus-infected Vero cells. In the case of the NSs protein, which hitherto had not been identified in PT virus-infected cells, monoclonal antibody was not available to identify the gene product in the recombinant baculovirus-infected cell extracts. Although antibodies to peptides representing the known sequence of NSs could have been made, we chose to produce antibodies to the baculovirus expressed NSs protein. Such antibodies immunoprecipitated a polypeptide from PT virus-infected Vero cells equivalent in size to that identified for the recombinant baculovirus. We conclude therefore that the 26 X 1O3 Da protein is the PT NSs gene product. The size of this polypeptide is lower than the 29 X lo3 Da estimated from the gene sequence (Ihara et al., 1984). Whether this discrepancy results from processing of the NSs polypeptide, or which of the amino proximal methionine codons are used to initiate translation, or is merely an artefact of the electrophoretic process is not known. In order to investigate this question it will be necessary to sequence the protein. Having identified the PT NSs protein in extracts of virus-infected Vero cells, the intracellular location of the protein is now under investigation. Analysis of purified PT virions and nucleocapsids has revealed that NSs protein is specifically associated with these structures. Whether the NSs protein has a transcriptase-replicase function for Punta Toro virus has yet to be investigated.

349

NSB PROTEINS

The ability of recombinant baculoviruses to express milligram quantities of a foreign gene in T. ni caterpillars has been demonstrated. However, based on the data obtained for the PT N and NSs genes, and the lower amounts reported previously for LCMV genes using the same transfer vectors (Matsuura et al., 1986), the level of expression of foreign gene by such recombinant baculoviruses appears to be too unpredictable.

ACKNOWLEDGMENT This work was supported by Contract DAMDl7-84-G-4035 the U.S. Army Medical Research and Development Command.

from

REFERENCES AKASHI, H., and BISHOP, D. H. L. (1983). Comparison of the sequences and coding of La Crosse and snowshoe hare bunyavirus S RNA species. J. Viral. 45, 1155-l 158. BAILEY, J. M., and DAVIDSON, N. (1976). Methylmercuryas a reversible denaturing agent for agarose gel electrophoresis. Anal. Biochem. 70,75-85. BISHOP, D. H. L., CALISHER, C. H., CASALS, J., CHUMAKOV, M. P., GAIDAMOVICH, S. YA., HANNOUN, C., Lvov, D. K., MARSHALL, I. D., OKERBLOM, N., PIERSON, R. F.. PORTERFIELD, J. S., RUSSELL, P. K., SHOPE, R. E., and WESTAWAY, E. G. (1980). Bunyaviridae. lntervirology 14, 125-143. BISHOP, D. H. L., GOULD, K. G., AKASHI, H., and CLERX-VAN HAASTER, C. M. (1982). The complete sequence and coding content of snowshoe hare bunyavirus small (S) viral RNA species. Nucleic Acids Res. 10, 3703-37 13. BROWN, M., and FAULKNER, P. (1977). A plaque assay for nuclear polyhedrosis viruses using a solid overlay. J. Gen. Viral. 36, 361364. DENHARDT, D. (1966). A membrane filter technique for the detection of complementary DNA. Biochem. Biophys. Res. Commun. 23, 641-652. FERAMISCO, J. R., HELFMAN, D. M., SMART, J. E., BURRIDGE, K., and THOMAS, G. R. (1982). Co-existence of vinculin-like protein of higher molecular weight in smooth muscle. J. Biol. Chem. 257, 11,02411,031. FULLER, F., BHOWN, A. S., and BISHOP, D. H. L. (1983). Bunyavirus nucleoprotein, N, and a non-structural protein, NSs, are coded by overlapping reading frames in the S RNA. J. Gen. Viral. 64, 17051714. GRUNSTEIN, J. M., and HOGNESS, D. S. (1975). Colony hybridization: A method for the isolation of cloned DNAs that contain a specific gene. Proc. Nat/. Acad. Sci. USA 72, 3961-3965. HOOFT VAN IDDENKINGE, B. J. L., SMITH, G. E., and SUMMERS, M. D. (1983). Nucleotide sequence of the polyhedrin gene of Autographa californica nuclear polyhedrosis virus. Virology 131, 56 l-565. IHARA, T., AKASHI, H., and BISHOP, D. H. L. (1984). Novel coding strategy (ambisense genomic RNA) revealed by sequence analyses of Punta Toro phlebovirus S RNA. Virology 136, 293-306. IHARA, T., MATSUURA, Y., and BISHOP, D. H. L. (1985). Analyses of the mRNA transcription processes of Punta Toro phlebovirus (Bunyaviridae). Virology 147, 317-325. KURODA, K.. HAUSER, C., Roar, R., KLENK. H.-D., and DOERFLER, W. (1986). Expression of the influenza virus haemagglutinin in insect cells by a baculovirus vector. EMBO J. 5, 1359-l 365. L~EMMLI, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227, 680-685.

350

OVERTON,

IHARA,

R. A., and MILLS, A. D. (1975). Quantitative film detection of 3H and 14C in polyactylamide gels by fluorography. Eur. J. Biochem. 46,83-88. MANIAS, T., FRITSCH, E. F., and SAMBROOK, J. (1982). “Molecular Cloning: A Laboratory Manual.” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. MATSUURA, Y., POSSEE, R. D., and BISHOP, D. H. L. (1986). Expression of the S coded genes of lymphocytic choriomeningitis arenavirus using a baculovirus vector. J. Gen. Viral. 67, 1515-l 529. MAXAM, A. M., and GILBERT, W. (1980). Sequencing end-labelled DNA with base-specific chemical cleavages. In “Methods in Enzymology” (L. Grossman and K. Moldave, Eds.), Vol. 65, pp. 499-560. Academic Press, Orlando, FL. MCCORMICK, 1. G., PALMER, E. L., SASSO, D. R., and KILEY, M. P. (1982). Morphological identification of the agent of Korean hemorrhagic fever (Hantaan virus) as a member of the Bunyaviridae. Lancer 1, 765-768. POSSEE, R. D. (1986). Cell-surface expression of influenza virus haemagglutinin in insect cells using a baculovirus vector. Virus Res. 5, 43-59. LASKEY,

AND

BISHOP

ROBESON, G.. EL SAID, L. H., BRANDT, W., D. H. L. (1979). Biochemical studies group viruses (Bunyaviridae family). 1. SCHMALIOHN, C. S., and DALRYMPLE, J. M. virus RNA: Evidence for a new genus 131,482-491.

DALRYMPLE, J., and BISHOP, on the Phlebotomus Fever Viral. 30, 339-350. (1983). Analysis of Hantaan of Bunyaviridae. Virology

SMITH, G. E., SUMMERS, M. D., and FRASER, M. J. (1983). Production of human beta interferon in insect ceils infected with a baculovirus expression vector. Mol. Cell. Biol. 3. 2 156-2165. SOUTHERN, E. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503518. UK, J. M., SMITH, G. E., and SUMMERS, M. D. (1981). Hybridization selection and in vitro translation of Autographa califomica nuclear polyhedrosis virus mRNA. J. Virol. 40, 762-77 1. WHITE, J. D.. SHIREY, F. G., FRENCH, G. R., HUGGINS, J. W.. and BRAND, 0. M. (1982). Hantaan virus, aetiological agent of Korean haemorrhagic fever, has Bunyaviridae-like morphology. Lancer 1, 768771.