Identification of the wedge clam Donax trunculus by a simple PCR technique

Food Control 23 (2012) 268e270

Contents lists available at ScienceDirect

Food Control journal homepage: www.elsevier.com/locate/foodcont

Short communication

Identification of the wedge clam Donax trunculus by a simple PCR technique A.M. Pereira a, *, J. Fernández-Tajes b, M.B. Gaspar a, J. Méndez b a b

Instituto Nacional de Recursos Biológicos, I.P./L-IPIMAR, Avenida 5 de Outubro s/n, 8700-305 Olhão, Portugal Universidade da Coruña, Facultade de Ciencias, Departamento de Bioloxía Celular e Molecular, Grupo Xenomar, Campus Da Zapateira, 15071 A Coruña, Spain

a r t i c l e i n f o

a b s t r a c t

Article history: Received 26 October 2010 Received in revised form 13 May 2011 Accepted 24 May 2011

The wedge clam Donax trunculus is an important bivalve commercial species in Portugal which can be easily mistaken with other three morphologically similar species (Donax semistriatus, Donax vittatus and Donax variegatus) that have a lower market price. This may lead fish sellers to make false claims about the authenticity of their products in order to get higher profits. To overcome this problem it is important to develop analytical techniques that can be used to test the authenticity of the species that is being sold. In this study we present two DNA extraction methodologies and a simple PCR method for the accurate identification of D. trunculus based on the amplification of the nuclear marker 5S rDNA. The PCR amplification results showed that this method is reliable to differentiate D. trunculus and D. variegatus from the remaining Donax species, since fragments of D. trunculus were about 275e300bp while D. variegatus were about w450 bp a little lower molecular weight than DNA fragments of the other two species (w500 bp). Ó 2011 Published by Elsevier Ltd.

Keywords: Donax trunculus PCR Chelex DNA extraction Species identification

1. Introduction The demand of bivalves in the Algarve (southern Portugal) highly increases during the summer, mainly due to tourism and the large quantities of shellfish festivals held during this season. This high demand of bivalve products sometimes offered to the consumer shelled may lead to mislabeling, either intentionally or not. In the Algarve region the wedge clam Donax trunculus is one of the most economically important bivalve species. In Portugal this species occurs along the south and southwest Portuguese coast in very shallow waters of sandy beaches at a depth ranging from 0 to 6 m (Gaspar, Ferreira, & Monteiro, 1999) where is subject to an intensive fishery carried out by both dredger boats and handdredgers. Concurrently with D. trunculus, other Donax species such as Donax semistriatus, Donax vittatus and Donax variegatus can also be caught in the same fishing grounds. Although Donax species can be distinguished by their morphological traits, this is not a straightforward task for the consumer since the shell of these species but D. variegatus are very similar in size, shape and color. Therefore, it is likely to find in the fish market other Donax species being sold as D. trunculus. In order to protect the consumer, European Union introduced the Council Regulation EC 104/2000. This regulation state at

* Corresponding author. Tel.: þ351 289700541; fax: þ351 289 700535. E-mail address: [email protected] (A.M. Pereira). 0956-7135/$ e see front matter Ó 2011 Published by Elsevier Ltd. doi:10.1016/j.foodcont.2011.05.020

Chapter 2, Article 4, that fishery product may not be offered for retail sale to the final consumer unless appropriate marking and labeling indicates commercial designation of the species, the production method and the catch area. Moreover this regulation enforced all member states to publish a list reporting the scientific name and the corresponding commercial name(s) for each commercial species. Despite this regulation, when only edible parts of bivalves are available to retail, the uncertainty that the product correspond to the species claimed in the label may arise, since it is impossible to the consumer to differentiate between species. It is therefore important the setting up of fast, reliable, reproducible and low cost techniques to be applied to test the authenticity of the bivalve species that are being used as raw material in order to avoid economic fraud. To achieve this goal, several techniques based on protein analysis (electrophoretic, chromatographic and immunological methods) have been developed for fish species identification (Carrera et al., 1997; Mackie et al., 2000). However according to Lockley and Bardsley (2000) those methodologies have some limitations especially in processed products, where processing techniques may easily result in protein denaturation. Contrary to immunologic techniques, the DNA-based techniques have proven to be reliable, sensitive and fast for fish species authentication (Asensio, González, Rojas, Gárcia, & Martín, 2009). Actually, DNA molecule offers several advantages over proteins, especially when extracted from processed products, since it is present in all tissues, contains more information than proteins and is more stable toward processing procedures (Lin & Hwang, 2008). DNA techniques have been used by several authors to assess their

A.M. Pereira et al. / Food Control 23 (2012) 268e270

effectiveness in the certification of species present in commercial food, in detection of food mislabeling and in detection of fraudulent species substitution (Machado-Schiaffino, Martinez, & GarciaVazquez, 2008; Russel et al., 2000; Sánchez, Quinteiro, ReyMendez, Pérez-Martin, & Sotelo, 2009) Most of the DNA-based methods used to verify fish and bivalve species identity are based on polymerase chain reaction amplification of polymorphic portion of genomic DNA due to its simplicity, specificity and sensitivity (Asensio et al., 2009). Some examples of PCR based techniques are: sequencing of PCR products based on DNA, restriction digestion of PCR products, species-specific PCR primers, single strand conformational polymorphism analysis and random amplified polymorphic DNA (RAPD) analysis. A more detailed description of these and other techniques can be found elsewhere (e.g. Asensio, 2007; Lockley & Bardsley, 2000). Both nuclear and mitochondrial DNA are available in cells. Mitochondrial DNA has several advantages over nuclear DNA, mainly due to its higher abundance, mutation rate and number of copies inside the cell (Mackie et al., 1999). Nevertheless Ferguson et al. (1995) stated that nuclear markers may be useful for species discrimination because of the existence of introns of different sizes which allow the amplification of species-specific DNA fragments. The 5S rDNA forms a multigene family of tandem arrays with a highly conserved region of 120 bp and a non-transcribed spacer (NTS) that evolves more rapidly, this makes it an interesting and widely used marker to discriminate several commercial fish/shellfish species (Fernández-Tajes & Méndez, 2007). The present article deals with a reliable and fast protocol based on the comparison of two DNA extraction methodologies, and a simple PCR amplification method in order to properly detect or confirm the identity of D. trunculus in raw products. Actually the setting up of reproducible, fast, reliable and low cost techniques to identify shellfish species used both as raw and processed matter in industry is an important goal for food safety and consumer rights protection. 2. Material and methods

269

isopropanol removal, 1 ml of 70% ETOH was added and the suspension was centrifuged at 13,000g for 7 min. After ETOH removal, the content of tubes was dried at room temperature and resuspended. 2.2.2. Method 2 e Chelex 100Ô (Bio-Rad- Barcelona - Spain) resin based method To each sample (2 mm3 of adductor muscle), 100 ml of a previous prepared Chelex 100Ô solution (1g Chelex 100Ô for 10 ml milliq water) was added, followed by a vigorous stirring, after which the sample was placed into a thermalcycler for 20 min at 100  C. After being centrifuged for 1 min, the supernatant was transferred to an autoclaved tube. 2.3. Primer design and PCR amplification In this study a set of primers designed by Fernández-Tajes and Méndez (2007) for amplifying the 5S rDNA gene was used. These primers were successfully used by the same authors in differentiating Ensis species. The forward primer was the 5SF (50 CGTCCGATCACCGAAGTTAA 30 ) whilst the reverse was the 5SR (50 ACCGGTGTTTTCAACGTCAT 30 ). Primers specificity for DNA samples obtained by the two methodologies described above was assessed. PCR amplification was carried out in a final volume of 25 ml containing 15 ng of genomic DNA, 0.24 mM of each dNTP, 2 mM of MgCl2þ, 1 mM of each primer, 0.625 U of Taq polymerase (Roche Applied Science, Barcelona, Spain) and the buffer recommended by the polymerase suppliers. The amplification process was performed using a Gene Cycler thermal cycler (BIO-RAD e Barcelona - Spain) and consisted in an initial denaturation step of 2 min at 95  C, 35 cycles with a denaturation step at 95 c for 30 s, an annealing step at 55  C for 30 s and an extension step for 1 min at 72  C, and a final extension step at 72  C for 5 min. The length of fragments was determined by comparison with Step Ladder 50e750 bp marker from RocheÔ after electrophoresis in a 3% agarose gel. Gel were stained by immersion in 0.5 mg/ml ethidium bromide solution for 30 min, visualized and recorded on a transilluminator (Gel Doc XR Systems, Bio-Rad, Barcelona, Spain).

2.1. Bivalve sampling 3. Results The adult specimens (20 individuals of each species) were captured off Lota beach (N37 90 57.9200 , W7 300 36.7900 ) South Portuguese coast, with a manual dredge in the case of D. trunculus and by a bivalve dredge mounted onboard the research vessel NI Diplodus in the case of D. semistriatus, D. variegatus and D. vittatus. All specimens were taken alive to the laboratory and were identified by their morphological characteristics according to Macedo, Macedo, and Borges (1999, p. 516) and Tebble (1966, p. 212). For each species, the foot and adductor muscle were removed and preserved in 95% ethanol for posterior DNA extraction. 2.2. DNA extraction Two DNA extraction methodologies were used on non processed tissue in order to compare extraction times, costs and feasibility and to establish the most appropriate method to use. 2.2.1. Method 1 - bivalve specific extraction method A piece of adductor muscle of each sample (20 mg) was incubated with 400 ml of lysis buffer (Fernández-Tajes & Méndez, 2007) and 2 ml of proteinase K at 65  C for 2 h. Then 100 ml of precipitation buffer were added and the suspension was vortexed vigorously for 30 s and centrifuged at 13,000g for 7 min. Supernatant was dropped in an autoclaved 1.5 ml tube and 500 ml of isopropanol were added and centrifuged once more at 13,000g for 7 min. After

Extraction of DNA from the tissue samples was successfully achieved with both methodologies. In the case of the bivalve specific extraction method, six reagents and five major steps were used. This method took about two and a half hours to obtain DNA from the tissue (without the overnight resuspension step). The method based on Chelex 100Ô resin used two reagents and consists of three major intermediary steps. With this method the extraction process was concluded in only half an hour and the samples were ready for PCR amplification. Even though we kept the DNA extractions in the second method at 4  C, it was observed that after a month, successful PCR amplifications became more difficult or even impossible to obtain. The amplification of the 5S rDNA was successfully obtained with both DNA extraction techniques and for the four Donax species (Fig. 1). Length was about 275e300 bp for D. trunculus fragments, about 450bp for D. variegatus and around 500 bp for fragments obtained from the other two Donax species. 4. Discussion Designing a proper method that could be easily implemented by state or private entities that deal with food safety and consumer rights are fundamental to dispel or confirm suspicions about mislabeled food and to ensure that consumers do not incur economic

270

A.M. Pereira et al. / Food Control 23 (2012) 268e270

rates of DNA extracted from boiled or baked ones. Moreover these authors stated that amplification rates were not compromised for amplicons higher than 150 bp. Nevertheless, in the case of bivalves, this is not a problematic issue since they are usually sold alive or frozen. Acknowledgments The authors would like to thank the valuable comments of two anonymous referees. This work was supported by the grant SFRH/ BD/40430/2007 financed by Fundação para a Ciência e Tecnologia. References

Fig. 1. Image of 3% agarose gel electrophoresis of amplicons from different Donax species after staining with 0.5 mg/ml ethidium bromide. XIII e step ladder 50e750 bp.

fraud. In the present study, two methodologies were used to extract DNA to be used to discriminate D. trunculus from other three Donax species (with lower commercial value) and both proved to be effective. However, differences were observed in the time needed to perform the extraction. Indeed, the method based on Chelex 100Ô resin is much faster than the bivalve specific extraction method in obtaining proper DNA to be used in an amplification process. This resin has been used successfully for DNA extraction in the pacific oyster (Aranishi & Okimoto, 2006; Launey & Hedgecock, 2001), arkshells and in pen shells (Steiner & Müller, 1996). Furthermore, this method requires less reagents and intermediary steps making it also cheaper and easy to apply. This makes the difference when a large number of samples has to be analyzed rapidly and at a lower cost. The oligonucleotides used were designed from 5S rDNA region because this ribosomal gene has two main advantages for species identification: a highly conserved region (even among different taxa) and a more variable spacer that allows species-specific differentiation (Freire, Insua, & Méndez, 2005). Although primers 5SF and 5SR, which annealed in the coding region, are not specific to genus Donax these oligonucleotides are mollusc-specific and were previously used with success in the differentiation of species of the genus Ensis (Fernández-Tajes & Méndez, 2007). In the case of the genus Donax, despite successfully identifying D. trunculus and D. variegatus, this set of oligonucleotides were unsuitable for discriminating the other two Donax species, and therefore a set of specific oligonucleotides should be developed for this genus. Indeed, it was observed that 5S rDNA of D. vittatus, D. semistriatus presented a similar molecular weight (w500 bp) which hinders the authentication of these species. One of the main drawbacks using 5S rDNA for species identification is the organization of ribosomal genes in multiple tandem arrays. The intraspecific variation that could exist in the different repeats at individual level could give rise to possible variations in array size. Nevertheless, concerned evolution, the main force that rules the evolution of tandem repeat arrays, tends to homogenize the repeat units present inside and among individuals of the species (Dover, Coen, & Strachan, 1982). Problems in using the above methodologies may arise if processed food is analyzed since heat and pressure processing may lead to DNA fragmentation reducing the sensitivity of the analysis. Hird et al. (2006) subjected several samples of turkey meat to different processing conditions (baking, boiling, autoclaving and canning) and concluded that in general, when compared to DNA from raw samples, there was no differences in the amplification

Aranishi, F., & Okimoto, T. (2006). A simple and reliable method for DNA extraction from bivalve mantle. Journal of Applied Genetics, 47(3), 251e254. Asensio, L. (2007). PCR-based methods for fish and fishery products authentication. Trends in Food Science & Technology, 18, 558e566. Asensio, L., González, I., Rojas, M., García, T., & Martín, R. (2009). PCR-based methodology for the authentication of grouper (Epinephelus marginatus) in commercial fish fillets. Food Control, 20, 618e622. Carrera, S., García, T., Céspedes, A., González, I., Sanz, B., Hernandez, P., et al. (1997). Immunostick colorimetric ELISA assay for the identification of smoked salmon, trout and bream. Journal of the Science of Food and Agriculture, 74, 547e550. Dover, G., Coen, E., & Strachan, T. (1982). The dynamics of sequence turnover and concerted evolution of families of rDNA, histone genes and non-coding DNA of Drosophila. Heredity, 49, 141. European Council Regulation (EC) No 104/2000 of 17 December 1999 on the common organization of the markets in fishery and aquaculture products. Official Journal of the European Communities n L, 17 of 21 December 2000, 22e52. Ferguson, A., Taggart, J. B., Prodöhl, P. A., McMeel, O., Thompson, C., Stone, C., et al. (1995). The application of molecular markers to the study and conservation of fish populations, with special reference to Salmo. Journal of Fish Biology, 47(Suppl. A), 103e126. Fernández-Tajes, & Méndez, J. (2007). Identification of the razor clam species Ensis arcuatus, E. siliqua, E. directus, E. macha and Solen marginatus using PCR-RFLP analysis of the 5S rDNA region. Journal of Agricultural and Food Chemistry, 55(18), 7278e7282. Freire, R., Insua, A., & Méndez, J. (2005). Cerastoderma glaucum 5S ribosomal DNA: characterization of the repeat unit, divergence with respect to Cerastoderma edule, and PCR-RFLPs for the identification of both cockles. Genome, 48, 427e442. Gaspar, M. B., Ferreira, R. S., & Monteiro, C. C. (1999). Growth and reproductive cycle of Donax trunculus Linnaeus off Faro, southern Portugal. Fisheries Research, 41, 309e316. Hird, H., Chisholm, J., Sanchez, A., Hernandez, M., Goodier, R., Schneede, K., et al. (2006). Effect of heat and pressure processing on DNA fragmentation and implications for the detection of meat using a real-time polymerase chain reaction. Food Additives and Contaminants, 23(7), 645e650. Launey, S., & Hedgecock, D. (2001). High genetic load in the pacific oyster Crassostrea gigas. Genetics, 159, 255e265. Lin, W. F., & Hwang, D. F. (2008). A multiplex PCR assay for species identification of raw and cooked bonito. Food Control, 19, 879e885. Lockley, A. K., & Bardsley, R. G. (2000). DNA-based methods for food authentication. Trends in Food Science & Technology, 11, 67e77. Macedo, M. C., Macedo, M. I., & Borges, J. P. (1999). Conchas marinhas de Portugal. Lisboa, Portugal: Editorial Verbo. Machado-Schiaffino, G., Martinez, J. L., & Garcia-Vazquez, E. (2008). Detection of mislabeling in hake seafood employing mtSNPs-based methodology with identification of eleven hake species of the genus Merluccius. Journal of Agricultural and Food Chemistry, 56, 5091e5095. Mackie, I. M., Pryde, S. E., Gonzales-Sotelo, C., Medina, I., Pérez-Martín, R., Quinteiro, J., et al. (1999). Challenges in the identification of species of canned fish. Trends in Food Science & Technology, 10(1), 9e14. Mackie, I., Craig, A., Etienne, M., Jérôme, M., Fleurence, J., Jessen, F., et al. (2000). Species identification of smoked and gravid fish products by sodium dodecylsulphate and native isoelectric focusing: a collaborative study. Food Chemistry, 71, 1e7. Russel, V. J., Hold, G., Pryde, S. E., Rehbein, H., Quinteiro, J., Rey-Méndez, M., et al. (2000). Restriction fragment length polymorphism to distinguish between salmon species. Journal of Agricultural and Food Chemistry, 48, 2184e2188. Sánchez, A., Quinteiro, J., Rey-Mendez, M., Perez-Martin, R. I., & Sotelo, C. G. (2009). Identification of european hake species (Merluccius merluccius) using real-time PCR. Journal of Agricultural and Food Chemistry, 57, 3397e3403. Steiner, G., & Müller, M. (1996). What can 18S rDNA do for bivalve phylogeny? Journal of Molecular Evolution, 43, 58e70. Tebble, N. (1966). British bivalve seashells, a handbook for identification. London, England: Trustees of the British Museum (Natural History).