- Email: [email protected]
Identification of two mariner-like elements in the genome of the mosquito Ochlerotatus atropalpus
Insect Biochemistry and Molecular Biology 34 (2004) 377–386 www.elsevier.com/locate/ibmb
Identification of two mariner-like elements in the genome of the mosquito Ochlerotatus atropalpus Stanislav O. Zakharkin a, Rebecca L. Willis b, Oksana V. Litvinova c, Umesh K. Jinwal c, Violetta V. Headley d, Helen Benesˇ c, a
c
Section on Statistical Genetics, Department of Biostatistics, University of Alabama at Birmingham, Birmingham, AL 35294, USA b Chemistry Program, Southern Arkansas University, Magnolia, AR 71754, USA Department of Neurobiology and Developmental Sciences, University of Arkansas for Medical Sciences, Slot 510, 4301 West Markham Street, Little Rock, AR 72205, USA d Department of Pediatrics, University of California at Los Angeles, Los Angeles, CA 90095, USA Received 17 June 2003; accepted 7 January 2004
Abstract Two distinct mariner-like elements, Atmar-1 and Atmar-2, were isolated from the genome of the mosquito Ochlerotatus atropalpus. Full-sized Atmar-1 elements, obtained by screening a genomic library, have a 1293-bp consensus sequence with 27-bp inverted terminal repeats and a 1047-bp open reading frame (ORF) encoding the transposase. The Atmar-2 elements were amplified by polymerase chain reaction from genomic DNA and contain the central part of the transposase ORF. Individual clones of both mariner elements contain deletions, frameshifts, and stop codons. The Atmar-1 elements are present in 370–1200 copies, while the Atmar-2 elements are present in approximately 100–300 copies per haploid genome. One of the Atmar-1 elements, Atmar-1.33, could be mobilized, suggesting the presence of functional Atmar-1 elements elsewhere in the genome. Phylogenetic analysis demonstrated that Atmar-1 elements belong to the irritans subfamily and Atmar-2 elements to the cecropia subfamily of mariner elements. # 2004 Elsevier Ltd. All rights reserved. Keywords: Mosquito; Ochlerotatus atropalpus; mariner; Transposable elements; Phylogeny
1. Introduction Transposable elements constitute a significant part of the eukaryotic genome (Hull and Will, 1989). Marinerlike elements are a diverse and taxonomically widespread group of Class II transposable elements (Robertson, 1993). Typically, they have inverted terminal repeats (ITRs) and encode a transposase distinguished by a characteristic ‘‘D,D(34)D’’ motif in the catalytic domain (reviewed in Hartl et al., 1997). TransAbbreviations: AatHex-1.2, hexamerin-1.2 gene of Aedes atropalpus; bp, base pair; ORF, open reading frame; PCR, polymerase chain reaction; ITRs, inverted terminal repeats; RT, room temperature. Corresponding author. Tel.: +1-501-686-5782; fax: +1-501-6866382. E-mail address: [email protected] (H. Benesˇ). 0965-1748/$ - see front matter # 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2004.01.002
position of these elements takes place via a conservative ‘‘cut-and-paste’’ mechanism (van Luenen et al., 1994). The majority of identified mariner elements are non-functional pseudogenes (Robertson and Lampe, 1995). To date, only two functional mariners are known: Mos1, originally discovered in the fruit fly Drosophila mauritiana (Medhora et al., 1991), and Himar1, constructed as a consensus sequence of elements found in the horn fly, Haematobia irritans (Lampe et al., 1996). The number of mariner-like elements per genome varies tremendously from species to species (Hartl et al., 1997). These elements can be grouped into five major and several minor subfamilies (Robertson and MacLeod, 1993). Mariners of different subfamilies can coexist within the same genome (Robertson, 1993; Robertson and MacLeod, 1993). The characteristic feature of mariner-like elements is that their distribution is incon-
378
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
sistent with the phylogeny of their hosts, suggesting the possibility of horizontal transfer (Robertson, 1993; Lohe et al., 1995; Kidwell, 1992). Here, we report the identification of two distinct mariner elements in the genome of the mosquito, Ochlerotatus atropalpus, an aedine species not previously known to harbor such elements.
2. Materials and methods 2.1. Mosquitoes An autogenous colony of O. atropalpus (Bass Rock strain), previously known as Aedes atropalpus, was reared as described (Zakharkin et al., 2001). 2.2. Screening of an Ochlerotatus atropalpus genomic library A genomic library of O. atropalpus provided by Dr. Jun Isoe (University of Arizona) was screened to obtain extended portions of the 50 -flanking region of the female-specific hexamerin gene, AatHex-1.2 (Zakharkin et al., 2001). A positive clone contained a full-length mariner element, which we termed Atmar1.33. A 0.3-kb fragment from its central portion was amplified by polymerase chain reaction (PCR) with the forward ATR-4 (CGTTCAAAGTGACGCCACTT) and the reverse ATR-8 (GGTGTGAATGATGGATCCA) primers. The fragment was 32P-labelled and used to screen the same library for additional mariner sequences. Approximately 20,000 phage plaques were screened and several positive clones were identified. Two of them, Atmar-1.2 and Atmar-1.10, contained full-length mariner elements. 2.3. PCR, cloning, and sequencing The forward MAR-F (TGGGTNCCNCAYGARYT) and the reverse MAR-R (GGNGCNARRTCNGGNSWRTA) degenerate primers designed for amplifying the conserved regions of the mariner transposase gene (Robertson, 1993) were used to isolate additional mariner elements from O. atropalpus genomic DNA. Genomic DNA was isolated from young pupae as previously described (Zakharkin et al., 1997). Genomic DNA samples were subjected to 40 amplification cycles under the v v following conditions: 30 s at 95 C, 45 s at 52 C, and 60 s v at 72 C. A 20-ll reaction included ~1 unit of Biolase Taq polymerase (Bioline), 1.5 mM MgCl2, 0.2 mM dNTPs, and 0.5 lM of each primer. PCR products were subjected to gel electrophoresis in 0.9% agarose, purified using a GeneClean kit (Bio 101), and cloned directly into the pGEM-T vector (Promega). Four plasmids, Atmar-2.1, Atmar-2.3, Atmar-2.4, and Atmar-2.5, were isolated. To
analyze mariner excision in the 50 -flanking region of the AatHex-1.2 gene, the ATR-32F (CCGCTTCCTCTTAGTCTTTATC) and the SP-C (TCCTTTCCAACGCTAGAC) primers were used to amplify a 1.5-kb product from the genomic DNA of O. atropalpus. Samples were subjected to 40 cycles of amplification under the followv v ing conditions: 30 s at 95 C, 45 s at 56 C, and 2 min at v 72 C. A PCR product was cloned directly into the pGEM-T vector. Sequencing of genomic and PCR clones was done by the DNA Sequencing Core Facility at the University of Arkansas for Medical Sciences with either SP6, T3, or T7 primers or sequence-specific synthetic primers using an automated sequencer (Model 377, ABI). 2.4. Estimation of the number of mariner copies in the O. atropalpus genome Genomic DNA of O. atropalpus and fragments of both Atmar-1 and Atmar-2 elements were serially diluted and blotted onto a Zeta-probe membrane (BioRad) using a vacuum manifold (Gibco-BRL). A 0.5-kb fragment corresponding to the central part of the transposon was used as a probe to estimate abundance of the Atmar-1 element. This fragment was obtained by PCR using ATR-4 and ATR-8 primers and the Atmar1 plasmid as a template under the following conditions: v v v 30 s at 95 C, 45 s at 52 C, and 60 s at 72 C for 35 cycles. A 0.5-kb PCR fragment used as a probe for estimation of the Atmar-2 copy number was amplified using SP6 and T7 primers and the Atmar-2.5 plasmid as a template under the same conditions as for amplification of Atmar-1 probe. PCR fragments were purified from the gel using Qiaquick Gel Extraction Kit (Qiagen) and 32P-labelled with Prime-IT II Random Primer Labeling kit (Stratagene). Three slot-blots for each element were prepared. Twenty-microliter samples were denatured by adding 20 ll of 0.4 N NaOH, 0.6 M NaCl for 10 min at room temperature (RT), neutralized by adding 200 ll of 0.5 M Tris–HCl, pH 7.0, 1.5 M NaCl and then loaded onto the membrane. Slotblots were crosslinked by UV light and probed with either Atmar-1 or Atmar-2 32P-labelled probes. The same fragments were used for serial dilutions and for probing. Hybridization was done as previously described (Zakharkin et al., 1997). Slot-blots were exposed in a PhosphoImager System (Molecular Dynamics). Intensities of the individual bands were measured with ImageQuant software (Molecular Dynamics). For each band, the intensity (in relative units) was normalized to the amount of DNA loaded (in ng). Southern blot analysis of O. atropalpus genomic DNA was performed as previously described (Zakharkin et al., 1997). Specifically, the following samples were blotted for analysis of each of the Atmar1 and Atmar-2 elements: 8 lg of genomic DNA diges-
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
ted with EcoRI or HindIII enzymes, 1 lg of uncut genomic DNA and 0.2 ng of corresponding probe as a hybridization control. The same probes were used as for slot-blot analysis. 2.5. Sequence and phylogenetic analyses Searches for matches in the non-redundant GenBank database were done with the BLAST software (Altschul et al., 1997). Pairwise comparisons were done with the GAP program of the GCG package (Genetics Computer Group, Madison, WI). Multiple sequence alignments were done with Clustal W (Thompson et al., 1994). Consensus sequences were generated using the BioEdit 5.06 program (Tom Hall, Department of Microbiology, North Carolina State University). Phylogenetic analysis was performed using the programs provided with the PHYLIP 3.5c package (Felsenstein, 1989). Phylogenetic trees were created with the programs implementing either maximum likelihood (DNAML), unrooted parsimony (DNAPARS), or neighbor-joining method and UPGMA clustering (NEIGHBOR). The non-default options (global rearrangement and a random input order) were used. Reliability of the trees was tested by bootstrap analysis with 100 replications obtained with SEQBOOT. A majority-rule consensus tree was constructed with the CONSENSUS program.
3. Results 3.1. Isolation of two mariner elements While screening a genomic library for the extended portions of the 50 -flanking region of the female-specific hexamerin gene AatHex-1.2 of the mosquito O. atropalpus (Zakharkin et al., 2001), we isolated the clone, Atmar-1.33, which contains a full-length mariner element located at positions 2012 to 943 relative to the transcription start site of the AatHex-1.2 gene. To obtain additional mariner sequences, the genomic library of O. atropalpus was re-screened and two additional clones, Atmar-1.2 and Atmar-1.10, containing highly similar mariner elements, were isolated and sequenced. Alignment of these three clones, the consensus sequence and the predicted translation of the transposase open reading frame (ORF) are presented in Fig. 1. The consensus sequence is 1293 bp in length and has a structure typical of a mariner-like element: 27-bp ITRs and a 1047-bp ORF encoding a 349-aa transposase, an enzyme that can mobilize an element via a ‘‘cut-and-paste’’ mechanism. All three elements contain deletions of different lengths; Atmar-1.2 and Atmar-1.10 clones also contain frameshifts and stop codons in the ORFs. All three elements contain distinc-
379
tive aspartic acid residues corresponding to the characteristic ‘‘D,D(34)D’’ motif, similar to other mariner-like elements. The Atmar-2 clones examined contain only a part of the transposase ORF and thus have only one of the corresponding aspartic acid residues. To obtain additional mariner sequences, we performed PCR, using previously designed degenerate primers (Robertson, 1993) to amplify the conserved regions of the mariner transposase gene, and we isolated four additional clones (Fig. 2). Sequence analysis revealed that they are clearly different from the previously isolated mariner-like transposons; thus we called them Atmar-2 elements. Four clones, each ~500 bp in length, represent the central part of a typical mariner ORF. All clones contain multiple small deletions, frameshift mutations, and stop codons. Atmar-1 clones have 96–97% identical residues amongst themselves, while Atmar-2 clones are more divergent, having 84–89% identical nucleotides. Pairwise comparison of individual Atmar-1 clones with Atmar-2 clones indicated that they have from 41% to 52% identical residues (Table 1). 3.2. The insertion sites and mobility of the Atmar-1 element Analysis of the genomic regions adjacent to the Atmar-1 insertion sites did not reveal significant sequence similarity (Fig. 3A). We observed a TA dinucleotide immediately flanking the ITRs, as is typical for mariner insertion events (Hartl et al., 1997). This finding suggests that Atmar-1 elements have a transposition mechanism similar to other mariners, with no target DNA specificity other than a TA dinucleotide. Recently, we discovered that the Atmar-1.33 element is absent from the 50 -flanking region of the AatHex-1.2 gene in a different population of O. atropalpus mosquitoes. By DNA sequence analysis, we found a TA dinucleotide duplication flanking the cytosine nucleotide, suggesting that a mariner excision had occurred (Fig. 3B). Most probably, the Atmar-1.33 element was mobilized by a trans-acting functional transposase produced by another Atmar-1 element present elsewhere in the O. atropalpus genome. 3.3. Mariner copy number Mariner elements may be present in only a few to several thousands of copies per genome (Capy et al., 1991; Lidholm et al., 1991; Lohe et al., 1995; Robertson and Lampe, 1995). We estimated the abundance of both Atmar-1 and Atmar-2 elements in the O. atropalpus genome using a slot-blot technique as described in Section 2. Typical autoradiograms of the slot-blots are presented in Fig. 4. On each slot-blot, there were serial dilutions of genomic DNA and the mariner frag-
380
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
Fig. 1. Alignment of Atmar-1 clones. Nucleotides identical to the consensus sequence are represented as dots, differences as corresponding letters, gaps as dashes. The transposase ORF is in uppercase letters, the inverted terminal repeats are in bold and italics. Protein translation of the consensus ORF is shown below the DNA. The amino acids corresponding to the ‘‘D,D(34)D’’ motif of the postulated catalytic domain are in bold and underlined.
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
381
Fig. 1 (continued )
ment. For each dilution, a ratio of the normalized intensity of the mariner fragment to the corresponding normalized intensity of the genomic DNA was calculated. Three slot-blots for each of Atmar-1 and Atmar2 elements were used and the mean ratio and standard deviation for each element were determined. We estimate that Atmar-1 comprises approximately 8:1 104 1:7 104 parts of the O. atropalpus genome, while the Atmar-2 element represents approximately 2:1 104 0:6 104 parts. The genome size
of O. atropalpus is not known. However, we assume that it is most likely similar to those of related mosquitoes, ranging from 5:9 108 bp per haploid genome in Aedes pseudoscutellaris to 1:9 109 bp in Aedes zoosophus (Rao and Rai, 1987). Thus, given the size of a typical mariner element of ~1300 bp, we estimate that Atmar-1 could be present in approximately from 370 to 1200 copies per genome, and Atmar-2 elements from 100 to 300 copies. These numbers may be overestimated since short fragments are less well retained
382
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
Fig. 2. Alignment of Atmar-2 clones. Nucleotides identical to the consensus sequence are represented as dots, differences as corresponding letters, gaps as dashes. Protein translation of the consensus ORF is shown below the DNA sequence. Frameshifts required for this conceptual translation are indicated by a # above the nucleotide sequence. The aspartic acid residue corresponding to the ‘‘D,D(34)D’’ motif of the postulated catalytic domain is bold and underlined.
on a membrane than longer genomic DNA. Nevertheless, this estimate is supported by genomic Southern blot analysis. We observed a smeared hybridization
pattern, suggesting the presence of multiple copies of Atmar-1 and Atmar-2 in the genome of O. atropalpus (Fig. 5).
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
383
Table 1 Similarities between Atmar-1 and Atmar-2 clones
Atmar-1 consensus Atmar-1.2 Atmar-1.10 Atmar-1.33 Atmar-2 consensus Atmar-2.1 Atmar-2.3 Atmar-2.4
Atmar-1.2
Atmar-1.10
Atmar-1.33
Atmar-2 consensus
Atmar-2.1
Atmar-2.3
Atmar-2.4
Atmar-2.5
98.44
98.33 96.98
98.32 97.48 96.38
49.90 46.34 50.10 50.10
50.33 43.76 50.55 51.64 95.43
52.24 46.06 50.71 50.81 93.17 89.38
50.73 41.82 50.73 48.97 92.80 88.06 88.68
49.39 42.09 49.39 49.18 91.13 84.51 88.08 86.34
DNA sequences were aligned pairwise and similarities (in percentages) were calculated using the GAP program (GCG) with a gap creation penalty of 50 and a gap extension penalty of 3.
Fig. 3. Insertion and excision sites of Atmar-1 elements. Mariner sequences are shown in uppercase, and the flanking genomic DNA sequences in lowercase. TA dinucleotide duplications are shown in bold and underlined. (A) Insertion sites of Atmar-1 elements. (B) Imprecise excision of the Atmar-1.33 element.
Fig. 4. Estimation of transposon copy number. Slot-blots of O. atropalpus genomic DNA were used for estimation of the number of Atmar-1 and Atmar-2 copies. Typical autoradiograms, prepared as described in Section 2, are shown. (A) Atmar-1 elements. (B) Atmar-2 elements.
384
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
Fig. 5. Relative abundance of mariner elements. Abundance of Atmar-1 and Atmar-2 elements in the O. atropalpus genome was shown by Southern blot analysis as explained in Section 2. Lane 1, mariner probe (0.2 ng) as described; lane 2, uncut genomic DNA (1 lg); lane 3, genomic DNA (8 lg) digested with EcoRI; lane 4, genomic DNA (8 lg) digested with HindIII. (A) Atmar-1 element. (B) Atmar-2 element.
3.4. Phylogenetic analysis Sequences of the Atmar-1 and Atmar-2 clones were aligned with representative sequences of the five major mariner subfamilies and a phylogenetic analysis was performed as described in Section 2. The results clearly show that Atmar-1 and Atmar-2 belong to different subfamilies, to the irritans and cecropia subfamilies, respectively (Fig. 6). The placement is supported by strong bootstrap values (100%) for each family clade. Only the consensus of the trees obtained with the DNAPARS program is shown. We obtained trees with similar topology and compatible bootstrap values using either NEIGHBOR or DNAML programs of the PHYLIP package (not shown).
4. Discussion Mariner-like elements are widespread in nature. They were found in a wide variety of insects and other arthropods, planaria, nematodes, fungi, fish, plants, and mammals including humans (Robertson, 1993;
Sedensky et al., 1994; Auge-Gouillou et al., 1995; Garcia-Fernandez et al., 1995; Robertson and Lampe, 1995; Robertson et al., 1997; Feschotte and Wessler, 2002). Typically, these elements contain short ITRs and an ORF encoding a transposase, an enzyme that mediates their transfer via a ‘‘cut-and-paste’’ mechanism. Virtually all mariner-like elements found in natural populations are non-functional pseudogenes, containing stop signals, deletions, frameshifts, or missense mutations that either disrupt the ORF or produce an inactive transposase (Robertson, 1993). We have isolated two different mariner-like elements, Atmar-1 and Atmar-2, from the mosquito O. atropalpus. We found that in certain populations of O. atropalpus mosquitoes of the Bass Rock strain, the Atmar-1.33 element was absent from the 50 -flanking region of the female-specific AatHex-1.2 gene, in which it was originally discovered. Comparison of genomic sequences flanking the Atmar-1.33 insert isolated by library screening and later by PCR from another population of mosquitoes revealed a pair of TA dinucleotides flanking a cytosine nucleotide, suggesting an imprecise excision event. The Atmar-1.33 element has intact ITRs and an ORF without frameshifts and stop codons. However, it has deletions in the region corresponding to the DNA-binding domain and thus is probably non-autonomous. But the fact that it can be mobilized implies the presence of a functional Atmar-1 transposase elsewhere in the genome. Copy number differs dramatically from species to species, ranging from two copies in the fruit fly Drosophila sechellia (Capy et al., 1991) to approximately 17,000 copies in the horn fly Haematobia irritans, accounting for ~1% of its genome (Robertson and Lampe, 1995). We determined that Atmar-1 and Atmar-2 elements are present in several hundreds of copies in the O. atropalpus genome. Mariner-like elements can be grouped into at least five major and several minor subfamilies, based on their clustering in phylogenetic analysis, certain diagnostic amino acids in each subfamily, and shared deletion/insertions. The major subfamilies are designated mauritiana, cecropia, mellifera, irritans, and capitata, after the species in which the subfamily was originally identified (Robertson and MacLeod, 1993). Members of one subfamily are from 40% to almost 100% identical at the amino acid level, while members of different subfamilies have from 25% to 49% amino acid identity. It has been reported that elements from several subfamilies can coexist within the same species: the fruit fly Ceratitis capitata contains representatives of four major subfamilies (Robertson et al., 1997). Among closely related species a particular type of mariner may be found in some species, but not in others, as was demonstrated for the Drosophilidae family (Bryan et al., 1990; Capy et al., 1991; Brunet et al., 1994; Lohe
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
385
Fig. 6. Phylogenetic analysis. A consensus tree showing relationships of Atmar-1 and Atmar-2 clones to representative sequences from five major mariner subfamilies was calculated as described in Section 2. Numbers indicate bootstrap values. The Bmmar-1 sequence from Bombyx mori, representing the basal mariner lineage (Robertson and Asplund, 1996), was used as an outgroup.
et al., 1995; Auge-Gouillou, 2000). In another study, nine of 23 anopheline mosquitoes screened by PCR revealed elements from the irritans, mauritiana, and mellifera subfamilies. Some species contain representatives of more than one subfamily (Imwong et al., 2000). In this paper, we demonstrate that the mosquito O. atropalpus contains two distinct elements, Atmar-1 and Atmar-2, which belong to different subfamilies, irritans and cecropia, respectively. It is possible that yet other
mariner elements may be present in the O. atropalpus genome. Recently, more distantly related mariner-like elements were found in this species (Shao and Tu, 2001). Atmar-1 was probably inherited vertically, since closely related elements were discovered in a number of other mosquitoes (Imwong et al., 2000). Alternatively, it could be an independent transfer event. Interestingly, to the best of our knowledge, Atmar-2 is the first member of the cecropia subfamily discovered in mosquitoes.
386
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
It is quite possible that members of this subfamily have not yet been identified in other Diptera. Examining other species closely related to O. atropalpus should reveal when each of the Atmar-1 and Atmar-2 elements appeared in the genome of this mosquito genus. Acknowledgements This work was supported in part by an NIH grant (AI 46738) to HB and by a grant from the Committee for Allocation of Graduate Student Resources at the University of Arkansas for Medical Sciences to SZ. We thank two anonymous reviewers for valuable comments and Dr. Shmookler R. Reis for critical reading of the manuscript. References Altschul, S.F., Madden, T.L., Scha¨ffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSIBLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Auge-Gouillou, C., Bigot, Y., Pollet, N., Hamelin, M.H., MeunierRotival, M., Periquet, G., 1995. Human and other mammalian genomes contain transposons of the mariner family. FEBS Lett. 368, 541–546. Auge-Gouillou, C., Notareschi-Leroy, H., Abad, P., Periquet, G., Bigot, Y., 2000. Phylogenetic analysis of the functional domains of mariner-like element (MLE) transposases. Mol. Gen. Genet. 264, 506–513. Brunet, F., Godin, F., David, J.R., Capy, P., 1994. The mariner transposable element in the Drosophilidae family. Heredity 73, 377–385. Bryan, G., Garza, D., Hartl, D.L., 1990. Insertion and excision of the transposable element mariner in Drosophila. Genetics 125, 103– 114. Capy, P., Maruyama, K., David, J.R., Hartl, D.L., 1991. Insertion sites of the transposable element mariner are fixed in the genome of Drosophila sechellia. J. Mol. Evol. 33, 450–456. Felsenstein, J., 1989. PHYLIP—Phylogeny Inference Package (version 3.2). Cladistics 5, 164–166. Feschotte, C., Wessler, S.R., 2002. Mariner-like transposases are widespread and diverse in flowering plants. Proc. Natl. Acad. Sci. USA 99, 280–285. Garcia-Fernandez, J., Bayascas-Ramirez, J.R., Marfany, G., MunozMarmol, A.M., Casali, A., Baguna, J., Salo, E., 1995. High copy number of highly similar mariner-like transposons in Planarian (Platyhelminthe): evidence for a trans-phyla horizontal transfer. Mol. Biol. Evol. 12, 421–431. Hull, R., Will, H., 1989. Molecular biology of viral and nonviral retroelements. Trends Genet. 5, 357–359. Hartl, D.L., Lohe, A.R., Lozovskaya, E.R., 1997. Modern thoughts on an ancyent marinere: function, evolution, regulation. Ann. Rev. Genet. 31, 337–358.
Imwong, M., Sharpe, R.G., Kittayapong, P., Baimai, V., 2000. Distribution of the transposable element mariner in anopheline mosquitoes. Heredity 85, 271–276. Kidwell, M.G., 1992. Horizontal transfer. Curr. Opin. Genet. Dev. 2, 868–873. Lampe, D.J., Churchill, M.E., Robertson, H.M., 1996. A purified mariner transposase is sufficient to mediate transposition in vitro. EMBO J. 15, 5470–5479. Lidholm, D.-A., Gudmundsson, G.H., Boman, H.G., 1991. A highly repetitive, mariner-like element in the genome of Hyalophora cecropia. J. Biol. Chem. 266, 11518–11521. Lohe, A.R., Moriyama, E.H., Lindholm, D.-A., Hartl, D.L., 1995. Horizontal transmission, vertical inactivation, and stochastic loss of mariner-like transposable elements. Mol. Biol. Evol. 12, 62–72. Medhora, M., Maruyama, K., Hartl, D.L., 1991. Molecular and functional analysis of the mariner mutator element Mos1 in Drosophila. Genetics 128, 311–318. Rao, P.N., Rai, K., 1987. Inter and intraspecific variation in nuclear DNA content in Aedes mosquitoes. Heredity 59 (Pt 2), 253–258. Robertson, H.M., 1993. The mariner transposable element is widespread in insects. Nature 362, 241–245. Robertson, H.M., Asplund, M.L., 1996. Bmmar1: a basal lineage of the mariner family of transposable elements in the silkworm moth, Bombyx mori. Insect Biochem. Mol. Biol. 26, 945–954. Robertson, H.M., Lampe, D.J., 1995. Distribution of transposable elements in arthropods. Annu. Rev. Entomol. 40, 333–357. Robertson, H.M., MacLeod, E.G., 1993. Five major subfamilies of mariner transposable elements in insects, including the Mediterranean fruit fly, and related arthropods. Insect Mol. Biol. 2, 125– 139. Robertson, H.M., Soto-Adames, E.N., Walden, K.K., Lampe, D.J., 1997. The mariner transposons of animals: horizontally jumping genes. In: Syvanen, M. (Ed.), Horizontal Gene Transfer: Implications and Consequences. Chapman & Hall, London, pp. 268–284. Sedensky, M.M., Hudson, S.J., Everson, B., Morgan, P.G., 1994. Identification of a mariner-like repetitive sequence in C. elegans. Nucleic Acids Res. 22, 1719–1723. Shao, H., Tu, Z., 2001. Expanding the diversity of the IS630-Tc1mariner superfamily: discovery of a unique DD37E transposon and reclassification of the DD37D and DD39D transposons. Genetics 159, 1103–1115. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. van Luenen, H.G.A.M., Colloms, S.D., Plasterk, R.H.A., 1994. The mechanism of transposition of Tc3 in C. elegans. Cell 79, 293– 301. Zakharkin, S.O., Gordadze, A.V., Korochkina, S.E., Mathiopoulos, K.D., della Torre, A., Benesˇ, H., 1997. Molecular cloning and expression of an hexamerin gene from the malaria mosquito, Anopheles gambiae. Eur. J. Biochem. 246, 719–726. Zakharkin, S.O., Headley, V.V., Kumar, N.K., Buck, N.A., Wheeler, D.E., Benesˇ, H., 2001. Female-specific expression of a hexamerin gene in larvae of an autogenous mosquito. Eur. J. Biochem. 268, 5713–5722.
Identification of two mariner-like elements in the genome of the mosquito Ochlerotatus atropalpus Stanislav O. Zakharkin a, Rebecca L. Willis b, Oksana V. Litvinova c, Umesh K. Jinwal c, Violetta V. Headley d, Helen Benesˇ c, a
c
Section on Statistical Genetics, Department of Biostatistics, University of Alabama at Birmingham, Birmingham, AL 35294, USA b Chemistry Program, Southern Arkansas University, Magnolia, AR 71754, USA Department of Neurobiology and Developmental Sciences, University of Arkansas for Medical Sciences, Slot 510, 4301 West Markham Street, Little Rock, AR 72205, USA d Department of Pediatrics, University of California at Los Angeles, Los Angeles, CA 90095, USA Received 17 June 2003; accepted 7 January 2004
Abstract Two distinct mariner-like elements, Atmar-1 and Atmar-2, were isolated from the genome of the mosquito Ochlerotatus atropalpus. Full-sized Atmar-1 elements, obtained by screening a genomic library, have a 1293-bp consensus sequence with 27-bp inverted terminal repeats and a 1047-bp open reading frame (ORF) encoding the transposase. The Atmar-2 elements were amplified by polymerase chain reaction from genomic DNA and contain the central part of the transposase ORF. Individual clones of both mariner elements contain deletions, frameshifts, and stop codons. The Atmar-1 elements are present in 370–1200 copies, while the Atmar-2 elements are present in approximately 100–300 copies per haploid genome. One of the Atmar-1 elements, Atmar-1.33, could be mobilized, suggesting the presence of functional Atmar-1 elements elsewhere in the genome. Phylogenetic analysis demonstrated that Atmar-1 elements belong to the irritans subfamily and Atmar-2 elements to the cecropia subfamily of mariner elements. # 2004 Elsevier Ltd. All rights reserved. Keywords: Mosquito; Ochlerotatus atropalpus; mariner; Transposable elements; Phylogeny
1. Introduction Transposable elements constitute a significant part of the eukaryotic genome (Hull and Will, 1989). Marinerlike elements are a diverse and taxonomically widespread group of Class II transposable elements (Robertson, 1993). Typically, they have inverted terminal repeats (ITRs) and encode a transposase distinguished by a characteristic ‘‘D,D(34)D’’ motif in the catalytic domain (reviewed in Hartl et al., 1997). TransAbbreviations: AatHex-1.2, hexamerin-1.2 gene of Aedes atropalpus; bp, base pair; ORF, open reading frame; PCR, polymerase chain reaction; ITRs, inverted terminal repeats; RT, room temperature. Corresponding author. Tel.: +1-501-686-5782; fax: +1-501-6866382. E-mail address: [email protected] (H. Benesˇ). 0965-1748/$ - see front matter # 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2004.01.002
position of these elements takes place via a conservative ‘‘cut-and-paste’’ mechanism (van Luenen et al., 1994). The majority of identified mariner elements are non-functional pseudogenes (Robertson and Lampe, 1995). To date, only two functional mariners are known: Mos1, originally discovered in the fruit fly Drosophila mauritiana (Medhora et al., 1991), and Himar1, constructed as a consensus sequence of elements found in the horn fly, Haematobia irritans (Lampe et al., 1996). The number of mariner-like elements per genome varies tremendously from species to species (Hartl et al., 1997). These elements can be grouped into five major and several minor subfamilies (Robertson and MacLeod, 1993). Mariners of different subfamilies can coexist within the same genome (Robertson, 1993; Robertson and MacLeod, 1993). The characteristic feature of mariner-like elements is that their distribution is incon-
378
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
sistent with the phylogeny of their hosts, suggesting the possibility of horizontal transfer (Robertson, 1993; Lohe et al., 1995; Kidwell, 1992). Here, we report the identification of two distinct mariner elements in the genome of the mosquito, Ochlerotatus atropalpus, an aedine species not previously known to harbor such elements.
2. Materials and methods 2.1. Mosquitoes An autogenous colony of O. atropalpus (Bass Rock strain), previously known as Aedes atropalpus, was reared as described (Zakharkin et al., 2001). 2.2. Screening of an Ochlerotatus atropalpus genomic library A genomic library of O. atropalpus provided by Dr. Jun Isoe (University of Arizona) was screened to obtain extended portions of the 50 -flanking region of the female-specific hexamerin gene, AatHex-1.2 (Zakharkin et al., 2001). A positive clone contained a full-length mariner element, which we termed Atmar1.33. A 0.3-kb fragment from its central portion was amplified by polymerase chain reaction (PCR) with the forward ATR-4 (CGTTCAAAGTGACGCCACTT) and the reverse ATR-8 (GGTGTGAATGATGGATCCA) primers. The fragment was 32P-labelled and used to screen the same library for additional mariner sequences. Approximately 20,000 phage plaques were screened and several positive clones were identified. Two of them, Atmar-1.2 and Atmar-1.10, contained full-length mariner elements. 2.3. PCR, cloning, and sequencing The forward MAR-F (TGGGTNCCNCAYGARYT) and the reverse MAR-R (GGNGCNARRTCNGGNSWRTA) degenerate primers designed for amplifying the conserved regions of the mariner transposase gene (Robertson, 1993) were used to isolate additional mariner elements from O. atropalpus genomic DNA. Genomic DNA was isolated from young pupae as previously described (Zakharkin et al., 1997). Genomic DNA samples were subjected to 40 amplification cycles under the v v following conditions: 30 s at 95 C, 45 s at 52 C, and 60 s v at 72 C. A 20-ll reaction included ~1 unit of Biolase Taq polymerase (Bioline), 1.5 mM MgCl2, 0.2 mM dNTPs, and 0.5 lM of each primer. PCR products were subjected to gel electrophoresis in 0.9% agarose, purified using a GeneClean kit (Bio 101), and cloned directly into the pGEM-T vector (Promega). Four plasmids, Atmar-2.1, Atmar-2.3, Atmar-2.4, and Atmar-2.5, were isolated. To
analyze mariner excision in the 50 -flanking region of the AatHex-1.2 gene, the ATR-32F (CCGCTTCCTCTTAGTCTTTATC) and the SP-C (TCCTTTCCAACGCTAGAC) primers were used to amplify a 1.5-kb product from the genomic DNA of O. atropalpus. Samples were subjected to 40 cycles of amplification under the followv v ing conditions: 30 s at 95 C, 45 s at 56 C, and 2 min at v 72 C. A PCR product was cloned directly into the pGEM-T vector. Sequencing of genomic and PCR clones was done by the DNA Sequencing Core Facility at the University of Arkansas for Medical Sciences with either SP6, T3, or T7 primers or sequence-specific synthetic primers using an automated sequencer (Model 377, ABI). 2.4. Estimation of the number of mariner copies in the O. atropalpus genome Genomic DNA of O. atropalpus and fragments of both Atmar-1 and Atmar-2 elements were serially diluted and blotted onto a Zeta-probe membrane (BioRad) using a vacuum manifold (Gibco-BRL). A 0.5-kb fragment corresponding to the central part of the transposon was used as a probe to estimate abundance of the Atmar-1 element. This fragment was obtained by PCR using ATR-4 and ATR-8 primers and the Atmar1 plasmid as a template under the following conditions: v v v 30 s at 95 C, 45 s at 52 C, and 60 s at 72 C for 35 cycles. A 0.5-kb PCR fragment used as a probe for estimation of the Atmar-2 copy number was amplified using SP6 and T7 primers and the Atmar-2.5 plasmid as a template under the same conditions as for amplification of Atmar-1 probe. PCR fragments were purified from the gel using Qiaquick Gel Extraction Kit (Qiagen) and 32P-labelled with Prime-IT II Random Primer Labeling kit (Stratagene). Three slot-blots for each element were prepared. Twenty-microliter samples were denatured by adding 20 ll of 0.4 N NaOH, 0.6 M NaCl for 10 min at room temperature (RT), neutralized by adding 200 ll of 0.5 M Tris–HCl, pH 7.0, 1.5 M NaCl and then loaded onto the membrane. Slotblots were crosslinked by UV light and probed with either Atmar-1 or Atmar-2 32P-labelled probes. The same fragments were used for serial dilutions and for probing. Hybridization was done as previously described (Zakharkin et al., 1997). Slot-blots were exposed in a PhosphoImager System (Molecular Dynamics). Intensities of the individual bands were measured with ImageQuant software (Molecular Dynamics). For each band, the intensity (in relative units) was normalized to the amount of DNA loaded (in ng). Southern blot analysis of O. atropalpus genomic DNA was performed as previously described (Zakharkin et al., 1997). Specifically, the following samples were blotted for analysis of each of the Atmar1 and Atmar-2 elements: 8 lg of genomic DNA diges-
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
ted with EcoRI or HindIII enzymes, 1 lg of uncut genomic DNA and 0.2 ng of corresponding probe as a hybridization control. The same probes were used as for slot-blot analysis. 2.5. Sequence and phylogenetic analyses Searches for matches in the non-redundant GenBank database were done with the BLAST software (Altschul et al., 1997). Pairwise comparisons were done with the GAP program of the GCG package (Genetics Computer Group, Madison, WI). Multiple sequence alignments were done with Clustal W (Thompson et al., 1994). Consensus sequences were generated using the BioEdit 5.06 program (Tom Hall, Department of Microbiology, North Carolina State University). Phylogenetic analysis was performed using the programs provided with the PHYLIP 3.5c package (Felsenstein, 1989). Phylogenetic trees were created with the programs implementing either maximum likelihood (DNAML), unrooted parsimony (DNAPARS), or neighbor-joining method and UPGMA clustering (NEIGHBOR). The non-default options (global rearrangement and a random input order) were used. Reliability of the trees was tested by bootstrap analysis with 100 replications obtained with SEQBOOT. A majority-rule consensus tree was constructed with the CONSENSUS program.
3. Results 3.1. Isolation of two mariner elements While screening a genomic library for the extended portions of the 50 -flanking region of the female-specific hexamerin gene AatHex-1.2 of the mosquito O. atropalpus (Zakharkin et al., 2001), we isolated the clone, Atmar-1.33, which contains a full-length mariner element located at positions 2012 to 943 relative to the transcription start site of the AatHex-1.2 gene. To obtain additional mariner sequences, the genomic library of O. atropalpus was re-screened and two additional clones, Atmar-1.2 and Atmar-1.10, containing highly similar mariner elements, were isolated and sequenced. Alignment of these three clones, the consensus sequence and the predicted translation of the transposase open reading frame (ORF) are presented in Fig. 1. The consensus sequence is 1293 bp in length and has a structure typical of a mariner-like element: 27-bp ITRs and a 1047-bp ORF encoding a 349-aa transposase, an enzyme that can mobilize an element via a ‘‘cut-and-paste’’ mechanism. All three elements contain deletions of different lengths; Atmar-1.2 and Atmar-1.10 clones also contain frameshifts and stop codons in the ORFs. All three elements contain distinc-
379
tive aspartic acid residues corresponding to the characteristic ‘‘D,D(34)D’’ motif, similar to other mariner-like elements. The Atmar-2 clones examined contain only a part of the transposase ORF and thus have only one of the corresponding aspartic acid residues. To obtain additional mariner sequences, we performed PCR, using previously designed degenerate primers (Robertson, 1993) to amplify the conserved regions of the mariner transposase gene, and we isolated four additional clones (Fig. 2). Sequence analysis revealed that they are clearly different from the previously isolated mariner-like transposons; thus we called them Atmar-2 elements. Four clones, each ~500 bp in length, represent the central part of a typical mariner ORF. All clones contain multiple small deletions, frameshift mutations, and stop codons. Atmar-1 clones have 96–97% identical residues amongst themselves, while Atmar-2 clones are more divergent, having 84–89% identical nucleotides. Pairwise comparison of individual Atmar-1 clones with Atmar-2 clones indicated that they have from 41% to 52% identical residues (Table 1). 3.2. The insertion sites and mobility of the Atmar-1 element Analysis of the genomic regions adjacent to the Atmar-1 insertion sites did not reveal significant sequence similarity (Fig. 3A). We observed a TA dinucleotide immediately flanking the ITRs, as is typical for mariner insertion events (Hartl et al., 1997). This finding suggests that Atmar-1 elements have a transposition mechanism similar to other mariners, with no target DNA specificity other than a TA dinucleotide. Recently, we discovered that the Atmar-1.33 element is absent from the 50 -flanking region of the AatHex-1.2 gene in a different population of O. atropalpus mosquitoes. By DNA sequence analysis, we found a TA dinucleotide duplication flanking the cytosine nucleotide, suggesting that a mariner excision had occurred (Fig. 3B). Most probably, the Atmar-1.33 element was mobilized by a trans-acting functional transposase produced by another Atmar-1 element present elsewhere in the O. atropalpus genome. 3.3. Mariner copy number Mariner elements may be present in only a few to several thousands of copies per genome (Capy et al., 1991; Lidholm et al., 1991; Lohe et al., 1995; Robertson and Lampe, 1995). We estimated the abundance of both Atmar-1 and Atmar-2 elements in the O. atropalpus genome using a slot-blot technique as described in Section 2. Typical autoradiograms of the slot-blots are presented in Fig. 4. On each slot-blot, there were serial dilutions of genomic DNA and the mariner frag-
380
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
Fig. 1. Alignment of Atmar-1 clones. Nucleotides identical to the consensus sequence are represented as dots, differences as corresponding letters, gaps as dashes. The transposase ORF is in uppercase letters, the inverted terminal repeats are in bold and italics. Protein translation of the consensus ORF is shown below the DNA. The amino acids corresponding to the ‘‘D,D(34)D’’ motif of the postulated catalytic domain are in bold and underlined.
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
381
Fig. 1 (continued )
ment. For each dilution, a ratio of the normalized intensity of the mariner fragment to the corresponding normalized intensity of the genomic DNA was calculated. Three slot-blots for each of Atmar-1 and Atmar2 elements were used and the mean ratio and standard deviation for each element were determined. We estimate that Atmar-1 comprises approximately 8:1 104 1:7 104 parts of the O. atropalpus genome, while the Atmar-2 element represents approximately 2:1 104 0:6 104 parts. The genome size
of O. atropalpus is not known. However, we assume that it is most likely similar to those of related mosquitoes, ranging from 5:9 108 bp per haploid genome in Aedes pseudoscutellaris to 1:9 109 bp in Aedes zoosophus (Rao and Rai, 1987). Thus, given the size of a typical mariner element of ~1300 bp, we estimate that Atmar-1 could be present in approximately from 370 to 1200 copies per genome, and Atmar-2 elements from 100 to 300 copies. These numbers may be overestimated since short fragments are less well retained
382
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
Fig. 2. Alignment of Atmar-2 clones. Nucleotides identical to the consensus sequence are represented as dots, differences as corresponding letters, gaps as dashes. Protein translation of the consensus ORF is shown below the DNA sequence. Frameshifts required for this conceptual translation are indicated by a # above the nucleotide sequence. The aspartic acid residue corresponding to the ‘‘D,D(34)D’’ motif of the postulated catalytic domain is bold and underlined.
on a membrane than longer genomic DNA. Nevertheless, this estimate is supported by genomic Southern blot analysis. We observed a smeared hybridization
pattern, suggesting the presence of multiple copies of Atmar-1 and Atmar-2 in the genome of O. atropalpus (Fig. 5).
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
383
Table 1 Similarities between Atmar-1 and Atmar-2 clones
Atmar-1 consensus Atmar-1.2 Atmar-1.10 Atmar-1.33 Atmar-2 consensus Atmar-2.1 Atmar-2.3 Atmar-2.4
Atmar-1.2
Atmar-1.10
Atmar-1.33
Atmar-2 consensus
Atmar-2.1
Atmar-2.3
Atmar-2.4
Atmar-2.5
98.44
98.33 96.98
98.32 97.48 96.38
49.90 46.34 50.10 50.10
50.33 43.76 50.55 51.64 95.43
52.24 46.06 50.71 50.81 93.17 89.38
50.73 41.82 50.73 48.97 92.80 88.06 88.68
49.39 42.09 49.39 49.18 91.13 84.51 88.08 86.34
DNA sequences were aligned pairwise and similarities (in percentages) were calculated using the GAP program (GCG) with a gap creation penalty of 50 and a gap extension penalty of 3.
Fig. 3. Insertion and excision sites of Atmar-1 elements. Mariner sequences are shown in uppercase, and the flanking genomic DNA sequences in lowercase. TA dinucleotide duplications are shown in bold and underlined. (A) Insertion sites of Atmar-1 elements. (B) Imprecise excision of the Atmar-1.33 element.
Fig. 4. Estimation of transposon copy number. Slot-blots of O. atropalpus genomic DNA were used for estimation of the number of Atmar-1 and Atmar-2 copies. Typical autoradiograms, prepared as described in Section 2, are shown. (A) Atmar-1 elements. (B) Atmar-2 elements.
384
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
Fig. 5. Relative abundance of mariner elements. Abundance of Atmar-1 and Atmar-2 elements in the O. atropalpus genome was shown by Southern blot analysis as explained in Section 2. Lane 1, mariner probe (0.2 ng) as described; lane 2, uncut genomic DNA (1 lg); lane 3, genomic DNA (8 lg) digested with EcoRI; lane 4, genomic DNA (8 lg) digested with HindIII. (A) Atmar-1 element. (B) Atmar-2 element.
3.4. Phylogenetic analysis Sequences of the Atmar-1 and Atmar-2 clones were aligned with representative sequences of the five major mariner subfamilies and a phylogenetic analysis was performed as described in Section 2. The results clearly show that Atmar-1 and Atmar-2 belong to different subfamilies, to the irritans and cecropia subfamilies, respectively (Fig. 6). The placement is supported by strong bootstrap values (100%) for each family clade. Only the consensus of the trees obtained with the DNAPARS program is shown. We obtained trees with similar topology and compatible bootstrap values using either NEIGHBOR or DNAML programs of the PHYLIP package (not shown).
4. Discussion Mariner-like elements are widespread in nature. They were found in a wide variety of insects and other arthropods, planaria, nematodes, fungi, fish, plants, and mammals including humans (Robertson, 1993;
Sedensky et al., 1994; Auge-Gouillou et al., 1995; Garcia-Fernandez et al., 1995; Robertson and Lampe, 1995; Robertson et al., 1997; Feschotte and Wessler, 2002). Typically, these elements contain short ITRs and an ORF encoding a transposase, an enzyme that mediates their transfer via a ‘‘cut-and-paste’’ mechanism. Virtually all mariner-like elements found in natural populations are non-functional pseudogenes, containing stop signals, deletions, frameshifts, or missense mutations that either disrupt the ORF or produce an inactive transposase (Robertson, 1993). We have isolated two different mariner-like elements, Atmar-1 and Atmar-2, from the mosquito O. atropalpus. We found that in certain populations of O. atropalpus mosquitoes of the Bass Rock strain, the Atmar-1.33 element was absent from the 50 -flanking region of the female-specific AatHex-1.2 gene, in which it was originally discovered. Comparison of genomic sequences flanking the Atmar-1.33 insert isolated by library screening and later by PCR from another population of mosquitoes revealed a pair of TA dinucleotides flanking a cytosine nucleotide, suggesting an imprecise excision event. The Atmar-1.33 element has intact ITRs and an ORF without frameshifts and stop codons. However, it has deletions in the region corresponding to the DNA-binding domain and thus is probably non-autonomous. But the fact that it can be mobilized implies the presence of a functional Atmar-1 transposase elsewhere in the genome. Copy number differs dramatically from species to species, ranging from two copies in the fruit fly Drosophila sechellia (Capy et al., 1991) to approximately 17,000 copies in the horn fly Haematobia irritans, accounting for ~1% of its genome (Robertson and Lampe, 1995). We determined that Atmar-1 and Atmar-2 elements are present in several hundreds of copies in the O. atropalpus genome. Mariner-like elements can be grouped into at least five major and several minor subfamilies, based on their clustering in phylogenetic analysis, certain diagnostic amino acids in each subfamily, and shared deletion/insertions. The major subfamilies are designated mauritiana, cecropia, mellifera, irritans, and capitata, after the species in which the subfamily was originally identified (Robertson and MacLeod, 1993). Members of one subfamily are from 40% to almost 100% identical at the amino acid level, while members of different subfamilies have from 25% to 49% amino acid identity. It has been reported that elements from several subfamilies can coexist within the same species: the fruit fly Ceratitis capitata contains representatives of four major subfamilies (Robertson et al., 1997). Among closely related species a particular type of mariner may be found in some species, but not in others, as was demonstrated for the Drosophilidae family (Bryan et al., 1990; Capy et al., 1991; Brunet et al., 1994; Lohe
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
385
Fig. 6. Phylogenetic analysis. A consensus tree showing relationships of Atmar-1 and Atmar-2 clones to representative sequences from five major mariner subfamilies was calculated as described in Section 2. Numbers indicate bootstrap values. The Bmmar-1 sequence from Bombyx mori, representing the basal mariner lineage (Robertson and Asplund, 1996), was used as an outgroup.
et al., 1995; Auge-Gouillou, 2000). In another study, nine of 23 anopheline mosquitoes screened by PCR revealed elements from the irritans, mauritiana, and mellifera subfamilies. Some species contain representatives of more than one subfamily (Imwong et al., 2000). In this paper, we demonstrate that the mosquito O. atropalpus contains two distinct elements, Atmar-1 and Atmar-2, which belong to different subfamilies, irritans and cecropia, respectively. It is possible that yet other
mariner elements may be present in the O. atropalpus genome. Recently, more distantly related mariner-like elements were found in this species (Shao and Tu, 2001). Atmar-1 was probably inherited vertically, since closely related elements were discovered in a number of other mosquitoes (Imwong et al., 2000). Alternatively, it could be an independent transfer event. Interestingly, to the best of our knowledge, Atmar-2 is the first member of the cecropia subfamily discovered in mosquitoes.
386
S.O. Zakharkin et al. / Insect Biochemistry and Molecular Biology 34 (2004) 377–386
It is quite possible that members of this subfamily have not yet been identified in other Diptera. Examining other species closely related to O. atropalpus should reveal when each of the Atmar-1 and Atmar-2 elements appeared in the genome of this mosquito genus. Acknowledgements This work was supported in part by an NIH grant (AI 46738) to HB and by a grant from the Committee for Allocation of Graduate Student Resources at the University of Arkansas for Medical Sciences to SZ. We thank two anonymous reviewers for valuable comments and Dr. Shmookler R. Reis for critical reading of the manuscript. References Altschul, S.F., Madden, T.L., Scha¨ffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSIBLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Auge-Gouillou, C., Bigot, Y., Pollet, N., Hamelin, M.H., MeunierRotival, M., Periquet, G., 1995. Human and other mammalian genomes contain transposons of the mariner family. FEBS Lett. 368, 541–546. Auge-Gouillou, C., Notareschi-Leroy, H., Abad, P., Periquet, G., Bigot, Y., 2000. Phylogenetic analysis of the functional domains of mariner-like element (MLE) transposases. Mol. Gen. Genet. 264, 506–513. Brunet, F., Godin, F., David, J.R., Capy, P., 1994. The mariner transposable element in the Drosophilidae family. Heredity 73, 377–385. Bryan, G., Garza, D., Hartl, D.L., 1990. Insertion and excision of the transposable element mariner in Drosophila. Genetics 125, 103– 114. Capy, P., Maruyama, K., David, J.R., Hartl, D.L., 1991. Insertion sites of the transposable element mariner are fixed in the genome of Drosophila sechellia. J. Mol. Evol. 33, 450–456. Felsenstein, J., 1989. PHYLIP—Phylogeny Inference Package (version 3.2). Cladistics 5, 164–166. Feschotte, C., Wessler, S.R., 2002. Mariner-like transposases are widespread and diverse in flowering plants. Proc. Natl. Acad. Sci. USA 99, 280–285. Garcia-Fernandez, J., Bayascas-Ramirez, J.R., Marfany, G., MunozMarmol, A.M., Casali, A., Baguna, J., Salo, E., 1995. High copy number of highly similar mariner-like transposons in Planarian (Platyhelminthe): evidence for a trans-phyla horizontal transfer. Mol. Biol. Evol. 12, 421–431. Hull, R., Will, H., 1989. Molecular biology of viral and nonviral retroelements. Trends Genet. 5, 357–359. Hartl, D.L., Lohe, A.R., Lozovskaya, E.R., 1997. Modern thoughts on an ancyent marinere: function, evolution, regulation. Ann. Rev. Genet. 31, 337–358.
Imwong, M., Sharpe, R.G., Kittayapong, P., Baimai, V., 2000. Distribution of the transposable element mariner in anopheline mosquitoes. Heredity 85, 271–276. Kidwell, M.G., 1992. Horizontal transfer. Curr. Opin. Genet. Dev. 2, 868–873. Lampe, D.J., Churchill, M.E., Robertson, H.M., 1996. A purified mariner transposase is sufficient to mediate transposition in vitro. EMBO J. 15, 5470–5479. Lidholm, D.-A., Gudmundsson, G.H., Boman, H.G., 1991. A highly repetitive, mariner-like element in the genome of Hyalophora cecropia. J. Biol. Chem. 266, 11518–11521. Lohe, A.R., Moriyama, E.H., Lindholm, D.-A., Hartl, D.L., 1995. Horizontal transmission, vertical inactivation, and stochastic loss of mariner-like transposable elements. Mol. Biol. Evol. 12, 62–72. Medhora, M., Maruyama, K., Hartl, D.L., 1991. Molecular and functional analysis of the mariner mutator element Mos1 in Drosophila. Genetics 128, 311–318. Rao, P.N., Rai, K., 1987. Inter and intraspecific variation in nuclear DNA content in Aedes mosquitoes. Heredity 59 (Pt 2), 253–258. Robertson, H.M., 1993. The mariner transposable element is widespread in insects. Nature 362, 241–245. Robertson, H.M., Asplund, M.L., 1996. Bmmar1: a basal lineage of the mariner family of transposable elements in the silkworm moth, Bombyx mori. Insect Biochem. Mol. Biol. 26, 945–954. Robertson, H.M., Lampe, D.J., 1995. Distribution of transposable elements in arthropods. Annu. Rev. Entomol. 40, 333–357. Robertson, H.M., MacLeod, E.G., 1993. Five major subfamilies of mariner transposable elements in insects, including the Mediterranean fruit fly, and related arthropods. Insect Mol. Biol. 2, 125– 139. Robertson, H.M., Soto-Adames, E.N., Walden, K.K., Lampe, D.J., 1997. The mariner transposons of animals: horizontally jumping genes. In: Syvanen, M. (Ed.), Horizontal Gene Transfer: Implications and Consequences. Chapman & Hall, London, pp. 268–284. Sedensky, M.M., Hudson, S.J., Everson, B., Morgan, P.G., 1994. Identification of a mariner-like repetitive sequence in C. elegans. Nucleic Acids Res. 22, 1719–1723. Shao, H., Tu, Z., 2001. Expanding the diversity of the IS630-Tc1mariner superfamily: discovery of a unique DD37E transposon and reclassification of the DD37D and DD39D transposons. Genetics 159, 1103–1115. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. van Luenen, H.G.A.M., Colloms, S.D., Plasterk, R.H.A., 1994. The mechanism of transposition of Tc3 in C. elegans. Cell 79, 293– 301. Zakharkin, S.O., Gordadze, A.V., Korochkina, S.E., Mathiopoulos, K.D., della Torre, A., Benesˇ, H., 1997. Molecular cloning and expression of an hexamerin gene from the malaria mosquito, Anopheles gambiae. Eur. J. Biochem. 246, 719–726. Zakharkin, S.O., Headley, V.V., Kumar, N.K., Buck, N.A., Wheeler, D.E., Benesˇ, H., 2001. Female-specific expression of a hexamerin gene in larvae of an autogenous mosquito. Eur. J. Biochem. 268, 5713–5722.