Impact of nitrite exposure on plasma biochemical parameters and immune-related responses in Takifugu rubripes

Aquatic Toxicology 218 (2020) 105362

Contents lists available at ScienceDirect

Aquatic Toxicology journal homepage: www.elsevier.com/locate/aqtox

Impact of nitrite exposure on plasma biochemical parameters and immunerelated responses in Takifugu rubripes

T

Xiao-Qiang Gaoa, Fan Feia,c, Huan Huan Huod, Bin Huanga, Xue Song Menge, Tao Zhange, Bao-Liang Liua,b,* a

Key Laboratory for Sustainable Development of Marine Fisheries, Ministry of Agriculture, Qingdao Key Laboratory for Marine Fish Breeding and Biotechnology, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, People’s Republic of China b Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266071, People’s Republic of China c Key Laboratory of Environment Controlled Aquaculture, Ministry of Education, Dalian Ocean University, Dalian, People’s Republic of China d College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang 330045, People’s Republic of China e Dalian Tianzheng Industrial Co. Ltd., Dalian 116000, People’s Republic of China

ARTICLE INFO

ABSTRACT

Keywords: Nitrite Immune response Inflammatory cytokines Takifugu rubripes

Nitrite is a major environmental pollutant in aquatic environments that negatively affects aquatic species. In this study, we investigated the impact of nitrite exposure on plasma biochemical parameters and immune responses in Takifugu rubripes. Fish were exposed to various concentrations of nitrite (0, 0.5, 1, 3, and 6 mM) for 96 h. After 0, 12, 24, 48, and 96 h of exposure, fish blood samples were collected to assay the levels of total protein (TP), albumin (Alb), glutamic-oxaloacetic transaminase (GOT), glutamic-pyruvic transaminase (ALT), complement C3 (C3), complement C4 (C4), immunoglobulin (IgM), and lysozyme activity (LZM). The gills were sampled to analyze the mRNA levels of heat shock protein 70 (hsp70), heat shock protein 90 (hsp90), tumor necrosis factor α (tnf-α), B-cell activating factor (baff), interleukin-6 (il-6), and interleukin-12 (il-12). Levels of GOT, ALT, C3, and C4 were significantly enhanced in the high nitrite concentration group (3 and 6 mM), whereas those of TP, Alb, LZM, and IgM decreased significantly with the same treatments. Nitrite significantly upregulated hsp70, hsp90, tnf-α, il-6, il-12, and baff mRNA levels after 96 h of exposure. These results indicated that nitrite exposure altered the blood physiological status and immune system response, resulting in dysfunction and immunotoxicity in T. rubripes. Furthermore, our results reveal the possible mechanism of aquatic-nitrite-induced toxicity in fish.

1. Introduction Nitrite is a critical pollutant that is formed from ammonia associated with the nitrification process in aerobic bacteria. This process may cause elevated nitrite concentrations as a result of an imbalance in nitrifying bacterial activity in recirculation aquaculture systems. If, however, ammonia oxidation is incomplete, larger quantities of nitrite may accumulate in this system and reach over 50 mg/L NO2 (Wuertz et al., 2013). An elevated nitrite level is a potential factor that triggers stress responses and may even pose a significant threat to the survival of aquatic organisms (Otfda et al., 2004). High nitrite concentration exposure can cause considerable stress in fish and cause physiological changes and tissue damage (Das et al., 2004a). The enzymatic plasma components glutamic-oxaloacetic

transaminase (GOT) and glutamic-pyruvic transaminase (ALT) are widely used as indicators of liver damage caused by exposure to toxic substances, including nitrite (Ozmen et al., 2006; Sun et al., 2014). Some studies have reported that plasma GOT and ALT concentrations are significantly elevated following nitrite exposure (Kim et al., 2018; Huang and Chen, 2002). The fish immune system is physiologically similar to that of higher vertebrates and is composed of specific and non-specific immune systems. Non-specific immunity in fish is the first line of defense against stressful encounters and plays a key role in resistance to stress. There are many immune-related factors, such as lysozyme, complement components, and IgM that participate in protection against potentially harmful conditions (Tort et al., 2003). Several studies have shown that high levels of nitrite suppress immune function and alter immune-related enzymatic activity (Ciji et al., 2015; Jia et al.,

⁎ Corresponding author at: Key Laboratory for Sustainable Development of Marine Fisheries, Ministry of Agriculture, Qingdao Key Laboratory for Marine Fish Breeding and Biotechnology, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, People’s Republic of China. E-mail address: [email protected] (B.-L. Liu).

https://doi.org/10.1016/j.aquatox.2019.105362 Received 17 August 2019; Received in revised form 12 November 2019; Accepted 17 November 2019 Available online 18 November 2019 0166-445X/ © 2019 Elsevier B.V. All rights reserved.

Aquatic Toxicology 218 (2020) 105362

X.-Q. Gao, et al.

2016; Miao et al., 2018). Heat shock proteins (HSPs) are stress-related proteins induced by various stressors and serve as reliable stress indicators in fish exposed to nitrite (Deane and Woo, 2007). HSPs are highly conserved and have elevated expression levels in tissues of fish exposed to different stress conditions (Sørensen et al., 2003). Many studies have suggested that nitrite toxicity increases the production of reactive oxygen species and causes oxidative stress (Guo et al., 2013a,b). However, oxidative stress may be associated with the activation of the inflammatory response. Inflammation is an important part of the immune response and is mediated by cytokines (Magnadóttir, 2006). Elevated levels of proinflammatory cytokines in response to nitrite may reflect the capability of sodium nitrite to potentiate cell peroxidative damage (Alyoussef and Al-Gayyar, 2016). Acute nitrite toxicity has been frequently investigated in a wide range of commercially important fish species (Handy and Poxton, 1993; Martinez and Souza, 2002; Das et al., 2004a,b; Lefevre et al., 2011; Monsees et al., 2017). Similar to pollutant bioaccumulation, nitrite accumulates not only in plasma, but also in brain, gill, spleen, liver, and muscle tissues (Margiocco et al., 1983). As previously reported, saltwater fish take up nitrite primarily through the intestine and gills (Jensen, 2003). The gills of teleost fish are a multipurpose organ that, in addition to enabling aquatic gas exchange, play dominant roles in osmotic and ionic regulation, acid-base regulation, and waste excretion (Evans et al., 2005). The gills are a major organ for the uptake and depuration of many toxicants, including nitrite. Many studies have reported that nitrite exposure induces osmoregulatory dysfunction and histopathological changes such as hyperplasia, hypertrophy, and epithelial cell necrosis in gills (Gaino et al., 1984; Romano and Zeng, 2009; Saoud et al., 2014; Lin et al., 2018). The large surface area of the gills facilitates greater environmental interaction (Romano and Zeng, 2009; Jiang et al., 2014). Thus, gills are more vulnerable to toxicants than other organs. However, the detoxification system of the gills is not as robust as that of the liver and hepatopancreas, which makes it highly susceptible to toxic chemicals (Jiang et al., 2014). Therefore, we selected the gill as the target tissue. Recently, recirculating aquaculture systems have developed rapidly and have shown potential for the development of sustainable aquaculture systems in China. However, in circulating aquaculture, nitrite is one of the main influencing factors that restrict the growth of fish, and the greater the breeding density, the more obvious the effect. Takifugu rubripes (pufferfish) is one of the most important aquaculture species in China. This species is mainly produced in land-based farms that use recirculation and flow-through systems. The intensification of pufferfish aquaculture has led to excessive use of proteinaceous feed and higher stocking densities in these systems, thereby increasing the load of nitrogenous and other toxic metabolites (Jia et al., 2015). In addition, the species is a scaleless marine fish that may be more susceptible to the effects of toxic chemicals than fish with scales. At present, the acute toxicity effects of nitrite at the molecular and physiological levels have not been investigated in scaleless fishes in recirculation systems. To evaluate the possible mechanisms underlying the responses to this toxin, we evaluated the effects of nitrite exposure on plasma biochemical parameters, humoral immune parameters, and the expression of genes related to the innate immune system in juvenile T. rubripes. In this study, we aimed to discover the impact of different concentrations of nitrite exposure on plasma biochemical parameters and immune responses in T. rubripes to reveal the mechanism of aquaticnitrate-induced toxicity in these important aquaculture fish.

Table 2 Primer sequences for the tested genes. Genes

Primer sequence (5′–3′)

References

hsp70

F:GCAGAAGCCTACCTCGGAAAGAC R:CGCCAAGATCAAAAATCAACACG F:TTTGGTGTGGGATTTTACTCAGCCTAC R:TTGTCCGTCCTGACTGTAAATGAACCT F:TCGTGGTGGTCCTCTGTTGC R:CTTGGCTTTGCTGCTGATGC F:CCTTCCTCTCAGCAGTGTCC R:CCGCCTCAAAGACAGAAAAG F:GCTGGAAAACAAGGTGAGGG R:TGTGGAAGGTGTCGGGGTAGT F:AGACGGACGGGAGCAGTGGC R:GGTCTGGCTGTGGCAGGTGT F:AGACAAATCGCTCCACCAAC R:GACTCAACACGGGAAACCTC F:CAGGGAGAAGATGACCCAGA R:CATCACCAGAGTCCATGACG

Cheng et al., 2015

hsp90 tnf-α baff il-6 il-12 18s β-actin

Cheng et al., 2015 Cheng et al., 2015 Cheng et al., 2015 Cheng et al., 2015 Cheng et al., 2015 Jia et al., 2018 Jia et al., 2018

2. Materials and methods 2.1. Animals T. rubripes juveniles (250.26 ± 5.22 g, approximately 450 fish) were obtained from Dalian Tianzheng Industrial Corporation Limited (Liaoning, China) and acclimated for a minimum of 2 weeks in a 500 L fiberglass cylinder filled with continuously circulating aerated water (temperature 20–22 °C, salinity 28–31 ppt, dissolved oxygen 6–8 mg/L, pH 7.5–8.0, total ammonia < 0.05 mg/L, and nitrite < 0.001 mM). During the acclimation period, fish were fed a commercial diet (crude protein ≥ 48%, crude fat ≥ 9%, water ≤ 10%, crude fiber ≤ 2%, crude ash ≤ 17%, lysine ≥ 2.5%, and total phosphorus 1.5–3.0%; HaiTong Group Foods, Fujian, China) at 1.5% of their body weight twice a day. All experiments were performed in accordance with the national and institutional guidelines for the protection of human and animal welfare in China. 2.2. Design of exposure experiments The nitrite concentrations selected for use in this study were as previously described, with minor modifications (Wang et al., 2013). During a preliminary experiment, the 96 h LC50 for T. rubripes juveniles was 11.94 mM in the same experimental conditions. Based on this LC50, we intentionally selected a high concentration of nitrite (50% LC50 for 96 h) as the maximum concentration to assess the effect of acute nitrite exposure on T. rubripes. Therefore, four nitrite (0.5, 1, 3, and 6 mM) groups and one control group were used. NaNO2 was purchased from Lianshuo Biotechnology Co., LTD (purity ≥ 99.0%, Shanghai, China). A nitrite test solution was formulated by dissolving NaNO2 in 5 L distilled water to produce a 5 M stock solution, which was diluted with seawater to the desired concentrations. The fish were then exposed to five nitrite treatment groups: 0 (control), 0.5, 1, 3, and 6 mM. The stocking density was set as 12.5 kg/m3 in each group. Each treatment group contained 75 juveniles, which were tested in triplicate. The actual nitrite concentrations (Table 1) in the test solution were confirmed spectrophotometrically using the Griess method (Ricart-Jané et al., 2002) and adjusted to the required value by adding stock solutions of NaNO2 every 12 h. During the period of experiment, the fish were not fed to minimize

Table 1 Nominal and actual nitrite concentrations in the exposure experiment. Nominal (mM)

0

0.5

1

3

6

Nominal (mg L−1 nitrite-N) Real ± SD (mg L−1 nitrite-N)

0 0.02 ± 0.01

7 6.94 ± 0.21

14 14.11 ± 0.35

42 41.62 ± 1.59

84 85.78 ± 1.47

2

Aquatic Toxicology 218 (2020) 105362

X.-Q. Gao, et al.

Fig. 1. Plasma biochemical parameter changes in T. rubripes exposed to different concentrations of nitrite over 96 h. The values are expressed as the mean ± S.D (n = 12). Data with different letters differ significantly (p < 0.05) among groups. The 0 mM nitrite group is the control. ※p < 0.05.

total protein in serum was measured by the Bradford method. A reaction mixture that contained 3.0 mL of Coomassie bright blue reagent (including 0.01% G-250, 4.70% ethyl alcohol, and 8.50% phosphoric acid) and 50 μL of sample was incubated for 10 min at 37 °C. The absorbance of the solution was measured at 595 nm. Plasma Alb was measured using 10 mM of bromocresol green stock solution (pH 4.2) as the substrate. A reaction mixture containing 2.5 mL of stock solution and 10 μL of sample was incubated for 10 min at 37 °C. The absorbance of the solution was measured at 630 nm. ALT was assayed using the matrix buffer (including 0.2 M alanine and 2 mM α-ketoglutaric acid) as the substrate, in a reaction mixture that contained 0.5 mL of matrix buffer and 0.1 mL of sample, which was incubated for 30 min at 37 ℃. The reaction was stopped by adding 0.5 mL of 2, 4-dinitrobenzene hydrazine solution, followed by 5.0 mL of sodium hydroxide for color development. The absorbance was monitored at 505 nm. GOT was determined using the matrix buffer (including 0.2 M DL-aspartate and 2 mM α-ketoglutarate) as the substrate. The reaction mixture consisted of 0.5 mL of matrix buffer and 0.1 mL of sample. The mixture was incubated at 37 ℃ for 60 min. The reaction was terminated with the addition of 0.5 mL of 2, 4-dinitrobenzene hydrazine solution and 0.4 M sodium hydroxide was added to produce a chromogenic reaction. The absorbance of the solution was measured at 505 nm. Complement C3, complement C4, and IgM were measured using the antibody-antigen-enzyme-antibody complex (commercially available ELISA kits, Mlbio, Shanghai, China). Lysozyme activity (LZM) analysis was measured following the method by Ellis (1990). Hemolymph with hen egg-white lysozyme as standard was placed on a plate and a suspension of Micrococcus luteus (Sigma, USA) was added. The absorbance values were read spectrophotometrically at 450 nm. One unit of lysozyme activity was determined as a reduction in absorbance of 0.001 per min.

nitrogen excretion and maintain water quality. The experiment was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals from the Chinese Academy of Fishery Sciences. Briefly, the interests of animals should be fully considered, animals should be treated well, stress, pain and injury of animals should be prevented or reduced, animal life should be respected, barbaric ACTS against animals should be stopped, and the least painful methods should be adopted to treat animals; Experimental animal projects shall ensure the safety of practitioners; The procedures conform to the guidelines produced by the Ethical Review of the Welfare of Experimental Animals in China (GB/T 35892-2018). After 0, 12, 24, 48, and 96 h of exposure, 4 fish were randomly sampled from each fiberglass at each time point and anesthetized with sodium bicarbonate-buffered MS-222 (45 mg/mL, Sigma Diagnostics INS, St. Louis, MO, USA) and 12 fish were tested in each treatment. Blood samples were obtained from each sampled fish from the caudal vessels using a 2 mL syringe. Approximately 2 mL of blood was obtained and centrifuged for 5 min at 12,000 × g. The resulting serum (0.80–1.10 mL) was stored at −80 °C for further biochemical analyses. All fish sera were tested separately and only used once. From each individual, the second gill arch on the right-hand side was removed and immediately stored at −80 ℃ for expression level analyses of immunerelated genes. All fish gills were tested separately and only used once. 2.3. Plasma biochemical index determination The concentrations of TP, Alb, GOT, and ALT were determined using an autobiochemical analyzer (PUZS-300, Shanghai, China) and commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The 3

Aquatic Toxicology 218 (2020) 105362

X.-Q. Gao, et al.

Fig. 2. Humoral immune parameter changes in T. rubripes exposed to different concentrations of nitrite over 96 h. Values are expressed as the mean ± S.D (n = 12). Data with different letters differ significantly (p < 0.05) among groups. The 0 mM nitrite group is the control. ※p < 0.05.

2.4. Gene expression analysis

interactive effects of exposure time and nitrite treatments were analyzed using a two-way ANOVA. When significant differences were observed, Tukey’s test was used to determine the significance of differences between means. Significant (p < 0.05) differences are denoted by differing letters. All statistical analyses were performed using SPSS version 18.0 software.

Total RNA was extracted from the gills using TRIzol reagent (Thermo Scientific) according to the manufacturer’s protocol. The extracted RNA was treated by DNase I (Takara Bio, China) for genomic DNA removal. The isolated RNA samples were suspended in diethyl pyrocarbonatetreated water. The purity of each sample was quantified using a spectrophotometer (NanoVue™, GE Healthcare) at A260 and A280. The RNA quality was assessed by electrophoresis on 1% agarose gels. The firststrand cDNA was synthesized from 2 μg of total RNA using an Evo MMLV RT Kit with gDNA Clean for qPCR (Accurate Biotechnology Co., Ltd. Hunan China) following the manufacturer’s instructions. The cDNA templates were then stored at −80 °C for later analysis. The primer sequences for β-actin, 18 s, HSP 70, HSP 90, tumor necrosis factor (TNF)-α, interleukin (IL)-6, IL-12, and B-cell activating factor (BAFF) were designed following previously published sequences and are listed in Table 2. The 20 μL amplification reaction volume contained 2 μL of cDNA sample, 10 μL of SYBR Premix Ex TaqTM (Accurate Biotechnology Co., Ltd. Hunan China), and 0.8 μL of each primer (10 mM). Ultra-pure water was added to reach the final total reaction volume. Initial denaturation was conducted at 94 °C for 10 s, followed by 40 cycles at 95 °C for 5 s, then one final cycle at 60 °C for 30 s. After that, the threshold cycle (Ct) values were obtained from each sample. Relative gene expression levels were evaluated using the 2−ΔΔCT method (Livak and Schmittgen, 2001). All samples were amplified in triplicate.

3. Results 3.1. Effect of nitrite exposure on plasma biochemical parameters in T. rubripes TP and Alb content decreased significantly upon exposure to 3 and 6 mM of nitrite for 24, 48, and 96 h compared to that of the control group (p < 0.05; Fig. 1A and B). GOT activity was significantly higher in the groups treated with 1, 3, and 6 mM nitrite after 24 h than that in the control group (p < 0.05; Fig. 1C). Similar significant increases were observed in ALT following nitrite exposure (p < 0.05; Fig. 1D). 3.2. Effect of nitrite exposure on humoral immune parameters in T. rubripes Compared to that of the control group, the LZM level decreased considerably following exposure to 6 mM of nitrite for 24, 48, and 96 h (p < 0.05; Fig. 2A). A similar change in the LZM level was observed following 3 mM of nitrite treatment for 48 h (p < 0.05). IgM levels also showed a marked decline following exposure to 3 and 6 mM for 48 and 96 h (p < 0.05; Fig. 2B). In contrast, the C4 and C3 levels were elevated following exposure to 3 and 6 mM of nitrite for 24, 48, and 96 h compared to those in the control group (p < 0.05; Fig. 2C and D). The C4 and C3 levels also increased significantly in fish exposed to 1 mM of

2.5. Statistical analyses Data were presented as the mean ± S.D. After the assumptions of normality and homogeneity of variances had been satisfied, the 4

Aquatic Toxicology 218 (2020) 105362

X.-Q. Gao, et al.

immune response in T. rubripes. In this study, marked elevations in serum GOT and ALT activity were observed in groups treated with 1, 3, and 6 mM of nitrite after exposure for 96 h. These results are consistent with previous observations and are considered general indicators of tissue damage (Michael et al., 1987; Zikic et al., 2001; Das et al., 2004a). The increase in serum transaminase activities that we observed might be attributed to the increased synthesis of aminotransferases in the liver and subsequent leakage into circulation due to the induced tissue damage caused by disturbance of nitrogen metabolism. Many studies have reported that GOT and ALT are involved in gluconeogenesis and that their elevated activity during stressful conditions increases amino acid substrate availability for gluconeogenesis to meet the higher energy demand required to cope up with stress (Masola et al., 2008; Tejpal et al., 2009). Proteins are the most important compounds in the serum and their concentrations are used as basic indicators for the health status of fish. Previous studies discovered that nitrite exposure results in serum protein leakage into peripheral fluids, along with serum protein proteolysis during stress conditions. These factors cause a significant reduction in serum protein (Ellis et al., 1981; Das et al., 2004b; Ciji et al., 2015). Abidi (1990) also demonstrated that higher nitrite concentration exposure causes kidney damage in fingerlings, which results in additional blood protein loss via renal excretion. In this study, the reduction in TP and Alb levels occurred in nitrite exposed groups after longer-term exposure, which was concomitant with increasing nitrite concentration and might have been a result of proteolysis or renal excretion caused by kidney damage. The innate immune system of fish is the first line of defense against a broad spectrum of pathogens and is important for homeostasis. The lysozyme, a key defense molecule in the innate immune system, plays a vital role in mediating protection against microbial invasion (Saurabh and Sahoo, 2008). Nitrite exposure in fish significantly reduces lysozyme activity (Ciji et al., 2014, 2015). Additionally, other studies have observed that nitrite exposure reduces the mRNA expression level of lysozymes and that this level exhibits a negative correlation with nitrite concentration (Jia et al., 2016; Zheng et al., 2016). As in previous studies, we observed that the level of LZM considerably decreased in fish exposed to higher concentrations of nitrite (3 and 6 mM) for 48 and 96 h compared to that in the control. The change in lysozyme levels suggested that a high level of nitrite negatively affected tolerance to bacterial diseases. Immunoglobulins are important molecules in mediating humoral immune responses. IgM is the main immunoglobulin in fish (Bengten et al., 2002). A variety of environmental contaminants, such as pentachlorophenol, heavy metals, ammonia, and pyrethroid pesticides has been reported to suppress the IgM protein and its mRNA expression, thereby impacting the immune parameters of teleost fishes (Bengten et al., 2002; Chen et al., 2004; Martins et al., 2015; Cheng et al., 2015; Ben Hamed et al., 2017). Similarly, in this study, a marked reduction in plasma IgM occurred in fish exposed to 3 and 6 mM of nitrite for 48 and 96 h compared to that in the control. This indicated that nitrite exposure suppressed the IgM level to a certain extent, causing depressed immunity in T. rubripes. Previous studies have shown that nitrite exposure in fish causes upregulated C3 and C4 genes and proteins (Jia et al., 2016; Miao et al., 2018). Our research identified elevated C4 and C3 levels in fish exposed to 3 and 6 mM of nitrite for 24, 48, and 96 h compared to those in the control, which revealed that the complement system was activated by nitrite exposure. These results indicate that nitrite exposure altered the immune response and caused immunotoxicity and inhibition of the innate immune response in T. rubripes. HSPs constitute a large family of proteins devoted to protecting newly synthesized proteins and ensuring proper protein folding (Lanneau et al., 2008). Hsp70 and hsp90 are the most highly conserved of all HSP families that play an important role in protecting cells against oxidative stress (Jiang et al., 2012). Enhanced levels of hsp70 and hsp90 in fish may reflect a protective response against many types of stress, including heat, crowding, and chemical stresses (Mahanty et al., 2017; Cheng et al., 2015; Kim et al., 2013). This study showed that nitrite

Fig. 3. Relative expression levels of HSP 70 and HSP 90 in T. rubripes exposed to different concentrations of nitrite over 96 h. The relative mRNA expression was normalized by β-actin. Values are expressed as the mean ± S.D (n = 12). Data with different letters differ significantly (p < 0.05) among groups. The 0 mM nitrite group is the control. ※p < 0.05.

nitrite for 48 and 96 h (p < 0.05) compared to those in the control group. 3.3. Effect of nitrite exposure on HSP gene transcription The transcription levels of hsp70 and hsp90 in treatments with 1, 3, and 6 mM of nitrite for 24, 48, and 96 h were significantly higher than those in the control group (p < 0.05; Fig. 3A and B). The mRNA level of hsp90 was notably elevated in fish exposed to 1, 3, and 6 mM of nitrite for 12 h (p < 0.05; Fig. 3B). 3.4. Effect of nitrite exposure on cytokine-related gene transcription Compared to that in the control group, il-6 gene expression after 1, 3, and 6 mM of nitrite exposure was significantly upregulated in fish exposed for 48 and 96 h (p < 0.05; Fig. 4A). Similar results were detected in fish treated with 3 and 6 mM of nitrite for 24 h. Increased il-12 expression was observed in groups treated with 1, 3, and 6 mM of nitrite after 24 h (p < 0.05; Fig. 4B). There were considerable increases in tnf-α and baff expression after 12 h of exposure to 1, 3, and 6 mM of nitrite compared to those in the control group (p < 0.05; Fig. 4C and D). 4. Discussion Nitrite is a critical pollutant in aquaculture systems because of its toxicity to aquatic organisms (Jensen, 2003). We built a model in which T. rubripes juveniles were exposed to nitrite for up to 96 h to clarify the possible mechanism of nitrite toxicity in fish. We investigated the effects of nitrite exposure on plasma biochemical parameters and the 5

Aquatic Toxicology 218 (2020) 105362

X.-Q. Gao, et al.

Fig. 4. Relative expression levels of inflammatory cytokines in T. rubripes exposed to different concentrations of nitrite over 96 h. The relative mRNA expression was normalized by β-actin. Values are expressed as the mean ± S.D (n = 12). Data with different letters differ significantly (p < 0.05) among groups. The 0 mM nitrite group is the control. ※p < 0.05.

exposure significantly increased the transcript levels of hsp70 and hsp90 in gill tissue. These results are consistent with previous reports for Sparus sarba, Labeo rohita, and Scophthalmus maximus (Deane and Woo, 2007; Banerjee et al., 2015; Jia et al., 2016). Therefore, we predict that the upregulation of HSPs may be a protective mechanism, as HSPs can bind to damaged and misfolded proteins to preserve their original structure. As an important immune response component, inflammation plays a key role in clearing injured tissue, facilitating the repair process, and protecting the host from microbial invasion (Bols et al., 2001). Toxicants, viruses, and bacteria can induce and inhibit the expression levels of inflammatory-related genes (Cheng et al., 2015). Il-6 and il-12 are two important proinflammatory cytokines that induce antibody production, induce T cell proliferation and differentiation, and regulate the expression of other cytokines (Watford et al., 2003; Vignali and Kuchroo, 2012; Eulenfeld et al., 2012; Chen et al., 2012). Chemical exposure alters the expression patterns of il-6 and il-12 (Cheng et al., 2015; Banerjee et al., 2015). In this study, the expression of il-6 and il12 in the gills significantly increased with increased nitrite concentration and exposure time, suggesting activation of the inflammatory response. TNF-α is considered a crucial member of the TNF family of cytokines, which induce cell proliferation, inflammation, and general immune system stimulation (Lama et al., 2011). BAFF is another pleiotropic proinflammatory cytokine that plays a critical role in innate immune system regulation against inflammatory diseases and infections (Ai et al., 2011). In our study, tnf-α and baff levels increased considerably after 12 h of exposure to 1, 3, and 6 mM of nitrite compared to those in the control. These results demonstrated that high nitrite

exposure induced the expression of inflammation-related genes in the gills, causing an inflammatory response. In addition, our results can further elucidate the regulatory mechanisms involved in the inflammatory response of T. rubripes to nitrite stress. In summary, this study describes the impact of nitrite exposure on plasma biochemical parameters and the immune response in T. rubripes. Our results indicated that nitrite exposure caused GOT and ALT activities to increase, TP and Alb levels to decrease, and plasma immunity to decrease. Additionally, nitrite exposure led to the upregulation of both HSP 70 and HSP 90 genes, indicating a nitrite-induced cellular stress response. High nitrite exposure altered the expression levels of cytokines, including il-6, il-12, tnf-α, and baff, to induce cellular inflammation and immunotoxicity. Our results reveal the possible mechanism of aquatic-nitrite-induced toxicity in fish. However, in this study only acute nitrite exposure was used for a limited period. To improve our understanding of the effects of nitrite on fish, further studies encompassing prolonged nitrite exposure to fish would be needed. Data availability statement The data that support the findings of this study are publicly available on Figshare, at https://figshare.com/s/d892d795f92c5270a1d6, DOI: 10.6084/m9.figshare.9248795reference Declaration of Competing Interest All authors have no any potential sources of conflict of interest. 6

Aquatic Toxicology 218 (2020) 105362

X.-Q. Gao, et al.

Acknowledgments

Handy, R.D., Poxton, M.G., 1993. Nitrogen pollution in mariculture: toxicity and excretion of nitrogenous compounds by marine fish. Rev. Fish Biol. Fish. 3, 205–241. Huang, C.Y., Chen, J.C., 2002. Effects on acid-base balance, methaemoglobinemia and nitrogen excretion of european eel after exposure to elevated ambient nitrite. J. Fish Biol. 712–725. Jensen, F.B., 2003. Nitrite disrupts multiple physiological functions in aquatic animals. Comp. Biochem. Physiol., Part A Mol. Integr. Physiol. 135, 9–24. Jia, Yd., Jing, Q.Q., Xing, Z.J., Gao, X.Q., Zhai, J.M., Gaun, C.T., 2018. Effects of two different culture systems on the growth performance and physiological metabolism of tiger pufferfish (takifugu rubripes). Aquaculture. 495, 267–272. Jia, R., Han, C., Lei, J.L., Liu, B.L., Huang, B., Huo, H.H., 2015. Effects of nitrite exposure on haematological parameters, oxidative stress and apoptosis in juvenile turbot (scophthalmus maximus). Aquat. Toxicol. 169, 1–9. Jia, R., Liu, B.L., Han, C., Huang, B., Lei, J.L., 2016. The physiological performance and immune response of juvenile turbot (Scophthalmus maximus) to nitrite exposure. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 181-182, 40–46. Jiang, J.L., Shi, Y., Shan, Z.J., Yang, L.Y., Wang, X.R., Shi, L.L., 2012. Bioaccumulation, oxidative stress and HSP70 expression in Cyprinus carpio L. exposed to microcystinLR under laboratory conditions. Comp. Biochem. Phys. C. 155, 483–490. Jiang, Q., Zhang, W., Tan, H., Pan, D., Yang, Y., Ren, Q., 2014. Analysis of gene expression changes, caused by exposure to nitrite, in metabolic and antioxidant enzymes in the red claw crayfish, cherax quadricarinatus. Ecotoxicol. Environ. Saf. 104, 423–428. Kim, J.H., Dahms, H.U., Han, K.N., 2013. Biomonitoring of the river pufferfish, Takifugu obscurus in aquaculture at different rearing densities using stress-related genes. Aquac. Res. 44, 1835–1846. Kim, J.H., Jin-Young, K., Lok-Ji, L., Kyoung, K.S., Sung, C.H., Baek, H.Y., 2018. Effects of waterborne nitrite on hematological parameters and stress indicators in olive flounders, paralichthys olivaceus, raised in bio-floc and seawater. Chemosphere. 209, 28–34. Lama, F.W.S., Wua, S.Y., Lina, S.J., Lina, C.C., Chen, Y.M., Wang, H.C., Chena, T.W., Lind, H.T., Lina, J.H.Y., 2011. The expression of two novel orange-spotted grouper (Epinephelus coioides) TNF genes in peripheral blood leukocytes, various organs, and fish larvae. Fish Shellfish Immunol. 30, 618–629. Lanneau, D., Brunet, M., Frisan, E., Solary, E., Fontenay, M., Garrido, C., 2008. Heat shock proteins: essential proteins for apoptosis regulation. J. Cell. Mol. Med. 12, 743–761. Lefevre, S., Jensen, F.B., Huong, D.T.T., Wang, T., Phuong, N.T., Bayley, M., 2011. Effects of nitrite exposure on functional haemoglobin levels, bimodal respiration, and swimming performance in the facultative air-breathing fish pangasianodon hypophthalmus. Aquat. Toxicol. 104, 86–93. Lin, Y., Miao, L.H., Zhang, W.X., Pan, W.J., Liang, H.L., Ge, X.P., 2018. Effect of nitrite exposure on oxygen-carrying capacity and gene expression of nf-κb / hif-1α, pathway in gill of bighead carp (aristichthys nobilis). Aquac. Int. 26, 899–911. Mahanty, A., Mohanty, S., Mohanty, B.P., 2017. Dietary supplementation of curcumin augments heat stress tolerance through upregulation of nrf-2-mediated antioxidative enzymes and hsps in puntius sophore. Fish Physiol. Biochem. 43, 1131–1141. Martins, K., Applegate, B., Hagedorn, B., Kennish, J., Zwollo, P., 2015. Di(2-ethylhexyl) phthalate inhibits b cell proliferation and reduces the abundance of igm-secreting cells in cultured immune tissues of the rainbow trout. Fish Shellfish Immunol. 44, 332–341. Martinez, C.B., Souza, M.M., 2002. Acute effects of nitrite on ion regulation in two neotropical fish species. Comp. Biochem. Physiol., Part A Mol. Integr. Physiol. 133, 151–160. Margiocco, C., Arillo, A., Mensi, P., Schenone, G., 1983. Nitrite bioaccumulation in salmo gairdneri rich. And hematological consequences. Aquat. Toxicol. 3, 261–270. Masola, B., Chibi, M., Kandare, E., Naik, Y.S., Zaranyika, M.F., 2008. Potential marker enzymes and metal–metal interactions in Helisoma duryi and Lymnaean atalensis exposed to cadmium. Ecotoxicol. Environ. Saf. 70, 79–87. Magnadóttir, B., 2006. Innate immunity of fish (overview). Fish Shellfish Immunol. 20, 137–151. Miao, L.H., Lin, Y., Pan, W.J., Huang, X., Ge, X.P., Zhou, Q.L., 2018. Comparative transcriptome analysis reveals the gene expression profiling in bighead carp (aristichthys nobilis) in response to acute nitrite toxicity. Fish Shellfish Immunol. 79, 244–255. Michael, M.I., Hilmy, A.M., El-Domiaty, N.A., Wershana, K., 1987. Serum transaminase activity and histopathological changes in Clarias lazera chronically exposed to nitrite. Comp. Biochem. Physiol. C, Comp. Pharmacol. Toxicol. 86, 255–262. Monsees, H., Klatt, L., Kloas, W., Wuertz, S., 2017. Chronic exposure to nitrate significantly reduces growth and affects the health status of juvenile nile tilapia (oreochromis niloticus l.) in recirculating aquaculture systems. Aquac. Res. 48, 3482–3492. Otfda, C., Djdoss, F., Lo, P.M.F., Fernandes, M.N., 2004. Susceptibility of the amazonian fish, colossoma macropomum (serrasalminae), to short-term exposure to nitrite. Aquaculture. 232, 627–636. Ozmen, M., Gungordu, A., Kucukbay, F.Z., Guler, R.E., 2006. Monitoring the effects of water pollution on Cyprinus carpio in Karakaya dam lake. Turkey Ecotoxicology. 15, 157–169. Ricart-Jané, D., Llobera, M., López-Tejero, M.D., 2002. Anticoagulants and other preanalytical factors interfere in plasma nitrate/nitrite quantification by the griess method. Nitric Oxide 6, 178–185. Romano, N., Zeng, C., 2009. Subchronic exposure to nitrite, potassium and their combination on survival, growth, total haemocyte count and gill structure of juvenile blue swimmer crabs, portunus pelagicus. Ecotoxicol. Environ. Saf. 72, 1287–1295. Saoud, I.P., Naamani, S., Ghanawi, J., Nasser, N., 2014. Effects of acute and chronic nitrite exposure on rabbitfish siganus rivulatus growth, hematological parameters, and gill histology. J. Aquac. Res. Dev. 5, 1–9. Saurabh, S., Sahoo, P.K., 2008. Lysozyme: an important defence molecule of fish innate

This study was supported by the National Key R & D Program of China (2017YFD0701701), the Central Public-interest Scientific Institution Basal Research Fund, YSFRI, CAFS (20603022018015), the Key Laboratory of Mariculture & Stock Enhancement in North China’s Sea, the Ministry of Agriculture and Rural Affairs, Dalian Ocean University, the P. R. China (2018-KF-02), the Modern Agriculture Industry System Construction of Special Funds (CARS-47), and a Demonstration project of collaborative innovation in the industry chain of intelligent cage assembly equipment of far-reaching sea. We thank Dalian Tianzheng Industrial Co., Ltd. for providing the samples used in this study and Yellow Sea Fisheries Research Institute for their technical assistance. References Abidi, R., 1990. Endosulfan induced changes in the total serum proteins of Channa punctatus (Bloch). Bol. Fisiol. Anim, Sao Paulo 14, 41–48. Ai, X.G., Shen, Y.F., Min, C., Pang, S.Y., Zhang, J.X., Zhang, S.Q., Zhao, Z.H., 2011. Molecular structure, expression and bioactivity characterization of TNF13B (BAFF) gene in mefugu Takifugu obscurus. Fish Shellfish Immunol. 30, 1265–1274. Alyoussef, A., Al-Gayyar, M.M., 2016. Thymoquinone ameliorated elevated inflammatory cytokines in testicular tissue and sex hormones imbalance induced by oral chronic toxicity with sodium nitrite. Cytokine. 83, 64–74. Banerjee, S., Mitra, T., Purohit, G.K., Mohanty, S., Mohanty, B.P., 2015. Immunomodulatory effect of arsenic on cytokine and HSP gene expression in Labeo rohita fingerlings. Fish Shellfish Immunol. 44, 43–49. Ben Hamed, S., Guardiola, F., Cuesta, A., Martínez, S., Martínez-Sánchez, M.J., Carmen, P.S., 2017. Head kidney, liver and skin histopathology and gene expression in gilthead seabream (sparus aurata l.) exposed to highly polluted marine sediments from portman bay (spain). Chemosphere. 174, 563–571. Bengten, E., Quiniou, M.A., Stuge, T.B., Katagiri, T., Miller, N.W., Clem, L.W., 2002. The igh locus of the channel catfish, ictalurus punctatus, contains multiple constant region gene sequences: different genes encode heavy chains of membrane and secreted igd. J. Immunol. 169, 2488–2497. Bols, N.C., Brubacher, J.L., Ganassin, R.C., Lee, L.E.J., 2001. Ecotoxicology and innate immunity in fish. Dev. Comp. Immunol. 25, 853–873. Chen, X., Yin, D., Hu, S., Hou, Y., 2004. Immunotoxicity of pentachlorophenol on macrophage immunity and igm secretion of the crucian carp (carassius auratus). Bull. Environ. Contam. Toxicol. 73, 153–160. Chen, H.H., Lin, H.T., Foung, Y.F., Lin, H.Y., 2012. The bioactivity of teleost il-6: il-6 protein in orange-spotted grouper (epinephelus coioides) induces the cell differentiation pathway and antibody production. Dev. Comp. Immunol. 38, 285–294. Cheng, C.H., Yang, F.F., Ling, R.Z., Liao, S.A., Miao, Y.T., Ye, C.X., 2015. Effects of ammonia exposure on apoptosis, oxidative stress and immune response in pufferfish (takifugu obscurus). Aquat. Toxicol. 164, 61–71. Ciji, A., Sahu, N.P., Pal, A.K., Akhtar, M.S., 2015. Dietary L-tryptophan modulates growth and immuno-metabolic status of Labeo rohita juveniles exposed to nitrite. Aquac.Res. 46, 2013–2024. Ciji, A., Sahu, N.P., Pal, A.K., Akhtar, M.S., Tincy, V., Mishal, P., 2014. Effect of dietary vitamin e and nitrite exposure on growth and metabolic variables of labeo rohita juveniles. Natl. Acad. Sci. Lett. 37, 123–129. Das, P., Ayyappan, S., Das, B., Jena, J., 2004a. Nitrite toxicity in Indian major carps: sublethal effect on selected enzymes in fingerlings of Catla catla, Labeo rohita and Cirrhinus mrigala. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 138, 3–10. Das, P.C., Ayyappan, S., Jena, J.K., Das, B.K., 2004b. Nitrite toxicity in Cirrhinus mrigala (ham): acute toxicity and sub lethal effect on selected haematological parameters. Aquaculture. 235, 633–644. Deane, E.E., Woo, N.Y.S., 2007. Impact of nitrite exposure on endocrine, osmoregulatory and cytoprotective functions in the marine teleost sparus sarba. Aquat. Toxicol. 82, 90–93. Ellis, A.E., Hastings, T.S., Munro, A.L.S., 1981. The role of Aeromonas salmonicida extracellular products in the pathology of furunculosis. J. Fish Dis. 4, 41–52. Ellis, A.E., 1990. Lysozyme assays. In: Stolen, J.S., Fletcher, T.C., Anderson, D.P., Robertson, B.S., van Muiswinkel, W.B. (Eds.), Techniques in Fish Immunology, FITC -1. SOS Publications, 43 DeNormandie Ave, Fair Haven, NJ 07704-3303 USA, pp. 101–103. Eulenfeld, R., Dittrich, A., Khouri, C., Pia, J.M., Barbara, M., Wolf, A., 2012. Interleukin-6 signalling: more than jaks and stats. Eur. J. Cell Biol. 91, 486–495. Evans, D.H., Piermarini, P.M., Choe, K.P., 2005. The multifunctional fish gill: dominant site of gas exchange, osmoregulation, acid-base regulation, and excretion of nitrogenous waste. Physiol. Rev. 85, 97–177. Gaino, E., Arillo, A., Mensi, P., 1984. Involvement of the gill chloride cells of trout under acute nitrite intoxication. Comparative Biochemistry and Physiology - Part A: Physiology. 77, 611–617. Guo, H., Xian, J.A., Li, B., Ye, C.X., Wang, A.L., Miao, Y.T., 2013a. Gene expression of apoptosis-related genes, stress protein and antioxidant enzymes in hemocytes of white shrimp litopenaeus vannamei under nitrite stress. Comp. Biochem. Physiol. 157, 366–371. Guo, Z.X., He, J.G., Xu, H.D., Weng, S.P., 2013b. Pathogenicity and complete genome sequence analysis of the mud crab dicistrovirus-1. Virus Res. 171, 8–14.

7

Aquatic Toxicology 218 (2020) 105362

X.-Q. Gao, et al. immune system. Aquac. Res. 39, 223–239. Sørensen, J.G., Kristensen, T.N., Loeschcke, V., 2003. The evolutionary and ecological role of heat shock proteins. Ecol. Lett. 6, 1025–1037. Sun, S., Ge, X., Xuan, F., Zhu, J., Yu, N., 2014. Nitrite-induced hepatotoxicity in bluntsnout bream (Megalobrama amblycephala): the mechanistic insight from transcriptome to physiology analysis. Environ. Toxicol. Pharmacol. 37, 55–65. Tejpal, C.S., Pal, A.K., Sahu, N.P., Jha, A.K., Muthappa, N.A., Sagar, V., Rajan, M.G., 2009. Dietary L-tryptophan mitigates crowding stress and augments the growth in Cirrhinus mrigala fingerlings. Aquaculture. 293, 272–277. Tort, L., Balasch, J., Mackenzie, S., 2003. Fish immune system. A crossroads between innate and adaptive responses. Inmunologa 22, 277–286. Vignali, D.A.A., Kuchroo, V.K., 2012. Il-12 family cytokines: immunological playmakers. Nat. Immunol. 13, 722–728. Watford, W.T., Moriguchi, M., Morinobu, A., John, J.O., 2003. The biology of il-12:

coordinating innate and adaptive immune responses. Cytokine Growth Factor Rev. 14, 361–368. Wang, J.X., Zhang, Z., Hu, P., Jiang, Z.Q., Wang, X., Yang, J.J., 2013. Effect of nitrite on hepatic antioxidant enzymes and acute toxicity in juvenile takifugu rubripe. Journal of Guangdong Ocean University. 33, 52–56. Wuertz, S., Schulze, S.G.E., Eberhardt, U., Schulz, C., Schroeder, J.P., 2013. Acute and chronic nitrite toxicity in juvenile pike-perch (sander lucioperca) and its compensation by chloride. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 157, 352–360. Zheng, J., Mao, Y., Su, Y., Wang, J., 2016. Effects of nitrite stress on mrna expresson of antioxidant enzymes, immune-related genes and apoptosis-related proteins in marsupenaeus japonicus. Fish Shellfish Immunol. 58, 239–252. Zikic, R.V., Stajn, A.S., Pavlovic, S.Z., Ognjanovic, B.I., Saicic, Z.S., 2001. Activities of superoxide dismutase and catalase in erythrocytes and plasma transaminase of gold fish (Carassius auratus gibelio Bloch.) exposed to cadmium. Physiol. Res. 50, 105–111.

8