In experimental challenge with infectious clones of Macrobrachium rosenbergii nodavirus (MrNV) and extra small virus (XSV), MrNV alone can cause mortality in freshwater prawn (Macrobrachium rosenbergii)

Virology 540 (2020) 30–37

Contents lists available at ScienceDirect

Virology journal homepage: www.elsevier.com/locate/virology

In experimental challenge with infectious clones of Macrobrachium rosenbergii nodavirus (MrNV) and extra small virus (XSV), MrNV alone can cause mortality in freshwater prawn (Macrobrachium rosenbergii)

T

Warachin Gangnonngiwa,b,∗, Malinee Bunnontaea, Kornsunee Phiwsaiyaa,b, Saengchan Senapina,b, Arun K. Dharc a

Center of Excellence for Shrimp Molecular Biology and Biotechnology (Centex Shrimp), Faculty of Science, Mahidol University, Rama 6 Road, Bangkok, 10400, Thailand National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), Klong 1, Klong Luang, Pratum Thani, 12120, Thailand c Aquaculture Pathology Laboratory, School of Animal and Comparative Biomedical Sciences, University of Arizona, Building 90, 1117 E. Lowell St., Tucson, AZ, 85718, USA b

A R T I C LE I N FO

A B S T R A C T

Keywords: MrNV XSV Freshwater prawn M. rosenbergii White tail disease Infectious clone

To overcome the lack of immortal shrimp cell lines for shrimp viral research, we constructed and tested DNA infectious clones of Macrobrachium rosenbergii nodavirus (MrNV) and extra small virus (XSV) often found together in freshwater prawn (M. rosenbergii) exhibiting white tail disease (WTD). Full-length cDNAs of MrNV and XSV genomic RNA were individually inserted into the baculovirus pFastBacDUAL shuttle vector. Individual Sf9 (insect cell line) transfection resulted in production of RNA (RT-PCR) and capsid proteins (immunofluorescence) for both viruses. Presence of respective virions was confirmed by density gradient purification followed by RTPCR and transmission electron microscopy. Infectivity was by tested in immersion-challenge tests with M. rosenbergii post-larvae (PL) using both semi-purified viruses, individually or combined, and confirmed by histological analysis (morphology and immunofluorescence) and quantitative RT-PCR. Mortality accompanied by WTD lesions occurred with MrNV alone or in combination with XSV but not with XSV alone, despite its replication.

1. Introduction The giant freshwater prawn (Macrobrachium rosenbergii) is commercially cultured in South-East Asia and some Caribbean countries. The post-larvae (PL) of M. rosenbergii are often affected by white tail disease (WTD) with mortalities reaching as high as 100% in some hatcheries. The disease was first reported in the Guadeloupe Island in the French West Indies in 1997 with mass mortality of hatchery PL (Arcier et al., 1999). Five years later, the etiologic agent was described as a non-enveloped, icosahedral virus, Macrobrachium rosenbergii nodavirus (MrNV), measuring 27 nm in diameter that belongs to the family Nodaviridae (Bonami, 2005). Its genome consists of two positivesense, single-stranded RNA fragments. RNA-1 (3202 bp) encodes an RNA-dependent RNA polymerase (RdRp) and a B2 protein whereas RNA-2 (1175 bp) encodes the viral capsid protein (Bonami and Sri Widada, 2011).

In WTD, MrNV is usually accompanied by another virus, extra small virus (XSV). XSV is also a non-enveloped, icosahedral virus that is 15 nm in diameter and contains a 796 bp positive-sense, single-stranded RNA genome that encodes a single capsid protein (Bonami, 2005; Widada and Bonami, 2004). It has been hypothesized that XSV is a satellite virus that depends on the RdRp of MrNV for its replication (Qian et al., 2003), although this remains to be determined. Later, based on challenge experiments using semi-purified preparations of MrNV and XSV, it was proposed that MrNV is likely the major cause of pathology in the mixed infection but the hypothesis was not tested (Zhang et al., 2006). Initially M. rosenbergii was reported as the only host species of WTD outbreaks caused by MrNV and XSV. Subsequent reports revealed that marine shrimp species such as Indian shrimp (Penaeus indicus), Kuruma prawn (P. japonicus) and black tiger shrimp (P. monodon) at the postlarvae (PL) stage were also susceptible and subject to severe infections

∗ Corresponding author. Center of Excellence for Shrimp Molecular Biology and Biotechnology (Centex Shrimp), Faculty of Science, Mahidol University, Rama 6 Road, Bangkok, 10400, Thailand. E-mail address: [email protected] (W. Gangnonngiw).

https://doi.org/10.1016/j.virol.2019.11.004 Received 17 August 2019; Received in revised form 29 October 2019; Accepted 4 November 2019 Available online 05 November 2019 0042-6822/ © 2019 Elsevier Inc. All rights reserved.

Virology 540 (2020) 30–37

W. Gangnonngiw, et al.

2.2. Generation of a recombinant baculovirus vector and transfection

with high mortality (Sudhakaran et al., 2006; Mani et al., 2009). More recently, MrNV and XSV infections were reported in juvenile Pacific white shrimp, P. vannamei but were not associated with high mortality (Senapin et al., 2012). Studies on virus host interactions in shrimp have been hampered due to the lack of an immortal shrimp cell line. In fact, the production of standard virus stocks for challenge studies in shrimp is complicated by the need for an amplification of the inoculum using live Specific Pathogen Free (SPF) shrimp. This can be overcome by engineering recombinant virus through the development of viral infectious clones. In 1978, the first viral infectious clone was made by inserting a DNA copy (cDNA) of an RNA viral genome into the bacteriophage QB that was, in turn, used to infect E. coli to produce infectious virus (Taniguchi et al., 1978). A plasmid-based, reverse genetics system was used to generate infectious clones of double-stranded RNA containing animal viruses (reviewed by Kobayashi et al., 2007). Other reports include an infectious clone of a retrovirus (Lowy et al., 1980), poliovirus (Racaniello and Baltimore, 1981), rabies virus (Schnell et al., 1994), flock house virus (Krishna et al., 2003) and Rhopalosiphum padi virus (Pal et al., 2007). The concept of using recombinant baculovirus to produce infectious clones of a shrimp RNA virus was first demonstrated using Taura syndrome virus of shrimp (Dhar, 2011). Recently, infectious virions of MrNV were produced upon transfecting Sf9 cells using in vitro transcribed viral RNAs (Jariyapong et al., 2018). While this approach demonstrated the feasibility of producing recombinant shrimp virus in insect cells, the method is not robust enough to generate large quantities of inoculum for virus challenge studies in shrimp. Here, we employed an alternative method by using a recombinant pFastBacDUAL shuttle vector carrying cDNA of either the MrNV or XSV genome to produce corresponding infectious viruses that were then tested individually and together in immersion challenges using live shrimp. The study shows the potential of using baculovirus-based shuttle vectors to engineer infectious virus without the need for an immortal shrimp cell line.

Recombinant plasmids of MrNV and XSV in pFastBacDUAL were extracted following the manufacturer's protocol (Favorgen) and used to transform E. coli competent cells DH10B on media containing antibiotics (kanamycin, tetracycline and gentamicin) and X-gal/IPTG for blue-white selection. Bacmid DNA was isolated from recombinant clones using a commercial kit (Qiagen). Recombinant bacmids (1 μg) were transfected into Sf9 cells (9 × 105 cells/well) using Cellfectin (Invitrogen) in 6 well plates (Costar, Corning) for 5 h. Overlying medium was removed, and cells were washed with PBS before adding 2 mL of new medium. At 3–4 days post inoculation, Sf9 cells were harvested and stored at −80 °C. An aliquot of the transfected cells was used for RNA extraction using a kit following the manufacturer's protocol (Qiagen). Gene copy numbers were determined by real-time RTPCR using previously published primers (Zhang et al., 2006). 2.3. Immunofluorescence analysis At day 4 after transfection, Sf9 cells were seeded on cover glasses (15 mm diameter) (Menzel-glaser®, Menzel GmbH & Co KG) in 24 well plates (Costar, Corning) for 1 h. They were then fixed with 4% paraformaldehyde in PBS for 15 min before washing twice with PBS followed by cell-permeabilization in 0.1% Triton X-100. Cells were incubated with 10% fetal bovine serum at 37 °C for 1 h before incubation with monoclonal antibodies (mAb) against MrNV (Wangman et al., 2012) and XSV (Longyant et al., 2012) at a dilution of 1:1000 at 37 °C for 1 h. The experiment was carried out in parallel with 2 negative controls, one consisting of naïve Sf9 cells and another of Sf9 cells transfected with the empty baculovirus vector that were also probed using the same mAb. Cells were washed twice with PBS-T and incubated with GAM Alexa Flour 546 (Molecular probes) dilution 1:500 at 37 °C for 1 h. After washing twice with PBS-T, the cells were counterstained with TO-Pro3 iodide (Molecular probes) at a dilution of 1:500 for 1 h. Then they were washed with PBS-T before adding antifade reagent (Prolong® Gold, Molecular probes), covering with a cover glass and viewing by confocal, laser scanning microscopy.

2. Materials and methods 2.4. Purification of MrNV and XSV from Sf9 cells by ultracentrifugation 2.1. Construction of full-length cDNA clones of MrNV and XSV in a shuttle vector

Optiprep (Alere Technologies GmbH, Jena, Germany) solutions for density gradients were prepared in 700 μL lots by dilution with buffer (150 mM KCl, 30 mM MgCl2, 120 mM Tricine-KOH, pH 7.8) to give concentrations of 55, 45, 35, 25, 15 and 5% (w/v) for layering in 55Ti tubes (ultra-clear™ tubes 13 × 51 mm) that were then kept at 4 °C overnight. Sf9 cells were harvested 3 days after exposure to clones. Cells transfected with MrNV recombinant clone and XSV clone were separately homogenized and filtered using 40 μm filter and the filtrates were overlayed on the Optiprep™ density gradients for centrifugation at 100,000×g at 4 °C using an ultracentrifuge (Optima™ L-100 XP). An opaque white band was collected and diluted in 5 mL of TN buffer before centrifugation again at 200,000×g at 4 °C. The resulting pellet was re-suspended in 15 μL of TN buffer and aliquoted into 2 tubes, one for RNA detection and the other for transmission electron microscopy (TEM). For TEM, the purified virus preparation (5 μL) was loaded onto a 300-mesh, formvar-coated copper grid and incubated for 15 min at room temperature. The excess liquid was removed using filter paper. The sample was negatively stained with 10 μL of 2% phosphotungstic acid for 3 min and dried before observation using a Hitachi H7100 electron microscope at 100 kV.

Genomic RNA was extracted from MrNV and XSV-infected shrimp with Trizol reagent (Invitrogen) as directed by the manufacturer and then converted to cDNA using random hexamer primers (Invitrogen) with reverse transcriptase (Promega). For MrNV, RNA1 (RdRp, 3202 bp) was cloned under the control of polyhedrin promotor (PPH) in pFastBacDUAL vector (Thermo Fisher Scientific, USA). MrNV RNA2 (capsid, 1175 bp) and the XSV genome (capsid, 796 bp) were initially cloned into pDrive vector (Qiagen, Germany). To clone RNA2 in pFastBacDUAL vector under Pp10 promoter, RNA1 in pFastBacDUAL was digested with the restriction enzyme SmaI then treated with Antarctic phosphatase (New England Biolabs) before purification by gel electrophoresis and extraction (Favorgen). The RNA2 fragment was separated from pDrive vector by digestion with EcoRI treatment, gel electrophoresis and gel extraction. To prepare blunt ends, gel-purified RNA2 was treated with DNA polymerse I Lg (Klenow) fragment (New England Biolabs). Subsequently, SmaI digested RNA1 in pFastBacDUAL and RNA2 were ligated using Mighty ligation mix (Takara). After bacterial transformation, recombinant clones were selected by colony PCR. The XSV sequence was digested and separated from pDrive vector by restriction enzyme digestion with BamHI and XbaI (New England Biolabs). The pFastBacDUAL vector was digested with the same enzymes for cloning XSV genome under the PPH promoter. Ligation and cloning were carried out as described for MrNV above.

2.5. M. rosenbergii experimental challenge M. rosenbergii post-larvae (PL) at 28 days of age (PL10) were obtained from Charoen Pokphand Co. Ltd. (Bangkok, Thailand) and acclimatized in the laboratory for 2 days before carrying out challenge 31

Virology 540 (2020) 30–37

W. Gangnonngiw, et al.

3. Results

experiments. The PLs were chosen for experimental challenge because. Larvae, PL and early juveniles of M. rosenbergii are susceptible to WTD, whereas adults are resistant (Sahul Hameed et al., 2004). The PLs were divided into 5 groups of 32 PL per treatment. The negative controls consisted of an unchallenged group and a group exposed to empty bacmid. For the 3 viral test groups, shrimp were incubated with extracts from appropriate Sf9 cells in 300 mL of 7 ppt artificial sea water. Tested groups were exposed to i) 108 MrNV copies, ii) 108 XSV copies or iii) 108 MrNV copies plus 108 XSV copies. After 2 h exposure, the PL were separated individually into 20 mL of 7 ppt artificial sea water. Experiments were carried out in 3 replicates. Shrimp were collected for viral detection of MrNV and XSV by RT-PCR assays (see below).

3.1. Recombinant plasmid construction Genome organization of Macrobrachium rosenbergii nodavirus (MrNV) and XSV. GenBank accession numbers of RNA-1, NC_005094, and RNA-2, NC_005095 are shown in Fig. 1A. Schematic presentations of the pFastBacDUAL shuttle vectors constructed for expression of MrNV or XSV are shown in Fig. 1B. MrNV-RNA1 (3202 bases) was cloned under the control of the polyhedrin promotor (PPH) and RNA2 (1175 bases) under the control of the P10 promotor (Pp10). The XSV genome (796 bp) in pFastBacDUAL shuttle vector was cloned separately downstream of the polyhedrin promotor (PPH). The recombinant plasmids containing full-length genomes of MrNV and XSV were used as templates for PCR amplification of the corresponding viral genomes (Fig. 1C) and for sequencing to confirm genome integrity and orientation in the cloned vectors.

2.6. RT-PCR detection of MrNV and XSV Infected Sf9 cells, samples of purified virus and experimentally challenged shrimp were collected for RNA extraction using a commercial kit (Qiagen). The extracted RNA was treated with DNase I (Thermo Scientific) before making cDNA using random hexamer primers (Invitrogen) and reverse transcriptase (Promega). The subsequent PCR steps were carried out using these cDNA templates with either MrNV or XSV-specific primers and actin primers for control reactions (Table 1).

3.2. Viral proteins expressed in Sf9 cells After construction of the MrNV and XSV vectors, Sf9 cells were separately transfected and at 4 days post-incubation, positive expression of the viral capsid proteins was confirmed by immunofluorescence in the cytoplasm of the transfected cells using mAb specific for the respective capsid proteins (Fig. 2).

2.7. Histopathology Moribund prawns were preserved with Davidson's fixative and subjected to histological analysis with hematoxylin and eosin (H&E) staining following the methods of Bell and Lightner (1998). Adjacent tissue sections were subjected to immunohistochemical analysis using monoclonal antibodies (mAbs) specific for MrNV or XSV capsid proteins, as previously described (Wangman et al., 2012., Longyant et al., 2012). Briefly, tissue sections were exposed to the relevant mAb at 1:500 dilution at 37 °C for 1 h. Sample sections were then washed and incubated with an immunofluorescent-labeled goat anti-mouse IgGs HRP conjugate for 1 h at 37 °C. Sections without the first antibody served as the negative controls. Signal detection was achieved using a DAB substrate and counterstained with tuloidine blue staining modified from a published method (Trump et al., 1961). Images were captured using a confocal microscope. The overall experimental steps performed in this study are illustrated in Supplemental Fig. 1.

3.3. Viral particle detection in Sf9 cells At 3–4 days post-transfection with MrNV or XSV, the Sf9 cells were separately harvested for homogenization and subjected to density gradient ultracentrifugation that revealed putative bands for MrNV and XSV at 25–35% and 15–25% Optiprep, respectively. When samples from these bands were subjected to negative staining and examination by TEM putative viral particles were seen for MrNV (mean diameter of 5 particles = 27.87 nm, ± SD 0.348) and for XSV (mean diameter of 5 particles = 16.55 nm, ± SD 1.26) (Fig. 3). The comparative diameters of MrNV and XSV in naturally infected M. rosenbergii have been reported to be 27 and 15 nm, respectively. The presence of MrNV and XSV in the putative viral preparations was also confirmed using respective RNA extracts as templates for their respective RT-PCR detection methods (see below).

Table 1 Primers for detection of MrNV and XSV. Product sizes labeled with “a” are whole genome or gene sequences while those labeled with “b” are fragments of the same. Organism MrNV

Gene RdRp

Capsid

XSV

M. rosenbergii

Capsid

Actin

Primer name RNA1-fragment1-F RNA1-fragment1-R RNA1-fragment2-F RNA1-fragment2-R Mr-RdRp-F Mr-RdRp-R qMrNV-F qMrNV-R RNA2-fragment1-F RNA2-fragment1-R RNA2-fragment2-F RNA2-fragment2-R MrNv2F MrNv2R FL-XSV-F FL-XSV-R XSV-F XSV-R qXSV-F qXSV-R McBr-beta actin F McBr-beta-actin R

Primer sequence (5′-3′)

Product size

GTTAAACGTTTTGTTTTCTAGC ACACCTACATTCGCTTCGGG CCCGAAGCGAATGTAGGTGT CGAAAGAGTGAAGGAGACTTGG GCATTTGTGAAGAATGAACCG CATGTTCAACTTTCTCCACGT AGGATCCACTAAGAACGTGG CACGGTCACAATCCTTGCG CCCATCATGTGCTAGATATGAC AGGCAGGCTACGTCACAAGT ACTTGTGACGTAGCCTGCCT AAAGGATATTCGATATTCTATC GATACAGATCCACTAGATGACC GACGATAGCTCTGATAATCC CCACGTCTAGCTGCTGAC GTT AAGGTCTTTATTTATCGACGC GGAGAACCATGAGATCACG CTGCTCATTACTGTTCGGAGTC AGCCACACTCTCGCATCTGA CTCCAGCAAAGTGCGATACG CCCAGAGCAAGAGAGGTA GCGTATCCTTCGTAGATGGG

32

Ref.

1486 bp

a

This study

1736 bp

a

This study

729 bp

b

Senapin et al. (2012)

211 bp

b

Zhang et al. (2006)

664 bp

a

This study

534 bp

a

This study

681 bp

b

Behera et al. (2011)

796 bp

a

This study

507 bp

b

Sri Widada, Veronique, Shi, Qian, & Bonami (2004)

68 bp

b

300 bp

Zhang et al. (2006) Zhang et al. (2006)

Virology 540 (2020) 30–37

W. Gangnonngiw, et al.

Fig. 1. Constructions of infectious cDNA clones of MrNV and XSV using a pFastBacDUAL shuttle vector. (A) Genome organization of Macrobrachium rosenbergii nodavirus (MrNV) and XSV. GenBank accession numbers of RNA-1, NC_005094, and RNA2, NC_005095. (B) A vector map of RNA1 of MrNV under the control of polyhedrin promotor (PPH) and RNA2 under the control of P10 promotor (Pp10) in a pFastBacDUAL vector (Invitrogen™ Life Technologies, a part of Thermo Fisher Scientific, USA). A vector map of XSV capsid gene was under the control of PPH promoter in a pFastBacDUAL vector. (C) Photomicrograph of an agarose gels of PCR amplicons representing RdRp and capsid genes of MrNV, and capsid gene of XSV generated using pFastBacDUAL shuttle vectors containing MrNV and XSV genomes as templates in PCR. The primers used for the partial genome sequences are listed in Table 1.

formation were present for both viruses in their respective Sf9 cell cultures. The additional demonstration of putative virions for both of these viruses and for the vector baculovirus by density gradient separations using OptiPrepTM followed by electron microscopy supported the proposal that virions of MrNV and XSV had been produced. However, final confirmation of viral integrity required challenge tests (see below).

3.4. MrNV and XSV genomic RNA confirmed in Sf9 cells by RT-PCR Total RNA was extracted from the density-gradient viral preparations described above and then treated with DNase I to eliminate any residual DNA that might be present in the extracts. When these DNase Itreated RNA were used directly as templates for in PCR assays for target viral genes, all the tests were negative (Fig. 4), indicating the lack of any residual DNA from the transfection vectors. In contrast, all the target genes of the two viruses were successfully amplified when the DNase I-treated RNA extracts were subjected to RT-PCR. Taken together, the results indicated that all the components for virion

33

Virology 540 (2020) 30–37

W. Gangnonngiw, et al.

Fig. 2. Photomicrographs of positive immunofluorescence for capsid proteins of MrNV and XSV in Sf9 cells at 4 days post transfection with recombinant bacmids. (A) Column of photomicrographs with positive red immunofluorescence for capsid proteins GAM Alexa Flour 546. (B) Column of the same fields in A stained with TOPRO3 iodide to identify cell nuclei (blue). (C) Column of the same fields in A shown by phase contrast.

respective uni-challenged groups was confirmed (Fig. 6). In contrast, the negative control group exposed to the empty vector and the untreated negative control group were negative for both viruses while the internal control for beta actin (300 bp) was positive in both groups, confirming the good quality of the RNA template. When moribund shrimp collected at 5–7 days from the MrNV and MrNV + XSV groups were subjected to histological analysis using H&Estained tissue section, some muscle lesions characteristic of white-tail disease were seen (Fig. 7), but not so many as was expected given the mortality, and this perhaps explained the absence of gross whitening of the muscle typical of white tail disease. It also revealed that mortality could occur without gross signs of muscle whitening. When adjacent sections of the tissue used for H&E staining were subjected to immunohistochemical analysis using specific mAb for each virus, positive immunofluorescence for MrNV was found only in the few suspected lesions identified by H&E staining (Fig. 7).

3.5. Successful MrNV and XSV infections using semi-purified viruses from SF9 cultures When test prawns were challenged by immersion with Sf9 viral preparations of MrNV alone, XSV alone or MrNV plus XSV, mortality began at 24 h post challenge and was observed only in PL challenged with the MrNV preparation alone or with the mixture of the MrNV and XSV (Fig. 5). None of the prawns (including those moribund) showed whitened tail muscles characteristic of white tail disease. Despite the lack of gross signs of disease, cumulative mortality by day 3 post challenge was 28% in the MrNV + XSV group, while that in the MrNValone group was 22% and that in the XSV-alone group was 3% (Fig. 5). Mortality in the unchallenged control group was 0% while that in the bacmid control group was 5%. There was no significant difference in mortality among the XSV-challenged group, the bacmid control group and the unchallenged control (p > 0.05), while mortality for all of these was significantly different (p < 0.05) from that in the MrNV and MrNV + XSV challenge groups. However, there was no significant difference (p > 0.05) in mortality between the MrNV and MrNV + XSV challenge groups, indicating that MrNV alone was capable of causing shrimp mortality. Using primers for the detection of the RdRp region of MrNV (729 bp) and the capsid region for XSV (507 bp), the presence of MrNV and XSV together in the dual challenge group and separately in the

4. Discussion During the early days of WTD research in M. rosenbergii, it was discovered that there was a close link between MrNV and XSV (Qian et al., 2003, Bonami et al., 2005). It was later proposed that XSV was a satellite virus that lacked an RNA-dependent RNA-polymerase (RdRp) and that it was thus dependent on the RdRp of MrNV for its own Fig. 3. Transmission electron micrographs of negatively stained viral preparations of MrNV (left), XSV (middle) and recombinant baculovirus (right). Sf9 cells were transfected with recombinant baculovirus vectors containing MrNV and XSV genomes, and viruses were purified by density gradient centrifugation, as described in the method section.

34

Virology 540 (2020) 30–37

W. Gangnonngiw, et al.

Fig. 4. Agarose gels showing amplicons for whole genome detection of MrNV and XSV in transfected Sf9 cells. Lanes 1, 3, 5, 7 and 9 show positive RTPCR amplicons for MrNV-RNA1 and MrNV-RNA2 and a 796-bp amplicon representing XSV genome (primer sequences are provided in Table 1). Lanes 2, 4, 6 and 8 show absence of PCR amplicons using the same DNaseI-treated RNA templates. N = negative control (water), M = 2 log DNA marker (New England Biolabs).

Fig. 5. Percent cumulative mortality in M. rosenbergii after challenge with viruses prepared from infectious clones compared to unchallenged and bacmid-challenged controls. One way ANOVA statistical analysis using SPSS version 18.0 revealed that mortality from the MrNV (red line 28%) and MrNV + XSV (grey line 22%) were both significantly different from the controls and XSV (p < 0.05) but not from one another (p > 0.05), while mortality for XSV and the controls were not significantly different (p > 0.05).

Fig. 6. A photomicrograph of an agarose gels containing RT-PCR amplicons from M. rosenbergii post-larvae at 3 days after challenge with MrNV alone, XSV alone or combination MrNV + XSV derived from transfected Sf9 cells. The beta actin internal control was positive for all samples indicating the good quality of the RNA template. The no-challenge group and the empty bacmid group (negative controls) gave no amplicons for either virus. In contrast, XSV (507 bp) was detectable in both the XSV-only challenge and dual-challenge groups but not in the MrNV-only group. Similarly, MrNV (729 bp) was detectable in the MrNV-only and the dual-challenge groups but not in the XSV-only group. + = positive controls using respective plasmids, - = negative control (water).

then revealed in experimental challenge tests with M. rosenbergii. This process allowed for the preparation of viral stocks of MrNV and XSV in which cross contamination could be assured, and single and mixed viral challenges could be carried out in experimental challenges with freshwater prawns. The results revealed that MrNV alone can cause significant mortality (28%) in prawn PL and that the mortality caused was not significantly different (p > 0.05) from that caused by the MrNV + XSV combination (22%). However, considering the fact that the number of replicates for each of the two treatment groups was relatively low, it would not obviate the fact that MrNV alone can be virulent. It is noteworthy that none of the shrimp showed clinical manifestation on the muscle, i.e. white muscle tissue despite mortality and H&E showing muscle necrosis. The reason for the apparent lack of clinical manifestation is not known but perhaps due to the acute nature of the infection in a laboratory challenged experiment mortality occurred before external clinical signs. This is analogous to the lack of white spot on the exoskeleton in experimentally challenged shrimp under laboratory condition with white spot syndrome virus (WSSV)

replication (Zhang et al., 2006). Subsequently, Zhang et al. (2006) reported that viral preparations dominated by MrNV were much more virulent than those dominated by XSV, raising the question as to whether MrNV alone could cause prawn mortality. They could not confirm their speculation that MrNV alone might be capable of causing mortality in freshwater prawns because of inability to prepare pure stocks of either XSV or MrNV from natural, mixed infections. Others have reported that occasional outbreaks of WTD show the presence of only MrNV by PCR detection (Yoganandhan et al., 2006; Senapin et al., 2010). However, even negative PCR results for XSV detection could not exclude the possibility of XSV presence below detectable levels. Overall, the data from the present study clearly demonstrate that Sf9 cells transfected with recombinant baculovirus carrying DNA copies of MrNV and XSV genomes can produce respective, mature virions. The morphology and sizes of the virions produced in Sf9 cells (a non-natural host of either virus) were similar to those of the respective wild type viruses. In addition, both viruses contained their respective RNA genomes. The infectious nature of the non-host cell derived virions was 35

Virology 540 (2020) 30–37

W. Gangnonngiw, et al.

Fig. 7. H&E histology and immunofluorescence of muscle in post-larvae of M rosenbergii after MrNV + XSV challenge at 5–7 days post-infection.

Department of Biology, Faculty of Science, Srinakharinwirot University, Bangkok who kindly provided the antibodies used in this work, Center of Nanoimaging staff, Faculty of Science, Mahidol University for helping on analysis of laser scanning confocal microscopy, and Panudda Meenium for her technical assistance. The authors would also like to thank Prof. Dr. T.W. Flegel for assistance in histological analysis and in reviewing and editing the draft manuscript.

(Dhar, Arun K., unpublished). During white spot disease outbreak in shrimp ponds, often animals infected with WSSV display white spot on the carapace, a characteristic symptom of WSSV infection. However, despite acute mortality, animals do not display white spots on exoskeleton under laboratory-challenged condition. In summary, the results of the present study unequivocally demonstrated that MrNV alone can cause shrimp mortality in the absence of XSV. This finding now provides further support to our previous studies (Jariyapong et al., 2018) and a prediction of Zhang et al. (2006) that MrNV alone can cause shrimp mortality in the absence of XSV. However, the possibility of somewhat higher virulence in a mixed infection of MrNV + XSV remains to be determined. That question and questions about MrNV virulence (with or without XSV) for other crustaceans, or questions as to whether other prawn RNA viruses can also support XSV replication are worthy of further investigation. It is now possible because relatively stable viral stocks of MrNV and XSV are now available, and can be maintained and prepared for tests at any time without having to resort to viral amplification using live prawn. Indeed, our results using immersion challenges with XSV alone did give evidence of XSV replication by PCR and by immunofluorescence analysis, suggesting that an RdRp of unknown origin, possibly host origin, can support replication of XSV in the challenged shrimp. Finally, the demonstration that infectious MrNV and XSV clones can be generated in non-host Sf9 cells by use of the baculovirus expression system suggests that the same strategy may be applicable to other shrimp viruses. If so, it would greatly alleviate the problem of lack of an immortal shrimp cell line for propagation and maintenance of infectious shrimp viruses and for exploring avenues to develop antiviral therapies.

Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.virol.2019.11.004. References Arcier, J.-M., Herman, F., Lightner, D.V., Redman, R.M., Mari, J., Bonami, J.-R., 1999. A viral disease associated with mortalities in hatchery-reared postlarvae of the giant freshwater prawn Macrobrachium rosenbergii. Dis. Aquat. Org. 38 (3), 177–181. Retrieved from. https://www.scopus.com/inward/record.uri?eid=2-s2.00033619639&partnerID=40&md5=7301020965970c6c688b7557a45c0d13. Behera, D.P., Devdas, K., Nayak, L., 2011. Reverse transcriptase polymerase chain reaction is a sensitive diagnostic tool for detection of nodavirus infection in Macrobrachium rosenbergii. Int JourFish&Auuacul 3. Bonami, J.-R., 2005. White tail disease of the giant freshwater prawn, Macrobrachium rosenbergii: separation of the associated virions and characterization of MrNV as a new type of nodavirus. J. Fish Dis. 28 (1), 23–31. Bonami, J.-R., Sri Widada, J., 2011. Viral diseases of the giant fresh water prawn Macrobrachium rosenbergii: a review. J. Invertebr. Pathol. 106 (1), 131–142. https:// doi.org/10.1016/j.jip.2010.09.007. Dhar, Arun K., 2011. Expression of positive sense single stranded RNA virus and uses thereof. US provisional patent application. Publication number: 20130195914. https://patents.justia.com/patent/20130195914. Jariyapong, P., Pudgerd, A., Weerachatyanukul, W., Hirono, I., Senapin, S., Dhar, A.K., Chotwiwatthanakun, C., 2018. Construction of an infectious Macrobrachium rosenbergii nodavirus from cDNA clones in Sf9 cells and improved recovery of viral RNA with AZT treatment. Aquaculture 483, 111–119. https://doi.org/10.1016/j. aquaculture.2017.10.008. Kobayashi, T., Antar, A.A.R., Boehme, K.W., Danthi, P., Eby, E.A., Guglielmi, K.M., Dermody, T.S., 2007. A plasmid-based reverse genetics system for animal doublestranded RNA viruses. Cell Host Microbe 1 (2), 147–157. https://doi.org/10.1016/j. chom.2007.03.003. Krishna, N.K., Marshall, D., Schneemann, A., 2003. Analysis of RNA packaging in wildtype and mosaic protein capsids of flock house virus using recombinant baculovirus vectors. Virology 305 (1), 10–24. Longyant, S., Senapin, S., Sanont, S., Wangman, P., Chaivisuthangkura, P.,

Declaration of competing interest The authors declare no conflict of interest. Acknowledgements This research project is supported by Mahidol University. The authors would like to thank Prof. Dr. Paisarn Sithigorngul of the 36

Virology 540 (2020) 30–37

W. Gangnonngiw, et al.

cultivated whiteleg shrimp Penaeus vannamei in Asia. Aquaculture 338, 41–46. https://doi.org/10.1016/j.aquaculture.2012.01.019. Sri Widada, J., Veronique, R., Shi, Z., Qian, D., Bonami, J.-R., 2004. Dot-blot hybridization and RT-PCR detection of extra small virus (XSV) associated with white tail disease of prawn. Dis. Aquat. Org. 58. https://doi.org/10.3354/dao058083. Sudhakaran, R., Musthaq, S., Haribabu, P., Mukherjee, S., Chavali, G., Hameed, A.S., 2006. Experimental transmission of Macrobrachium rosenbergii nodavirus (MrNV) and extra small virus (XSV) in three species of marine shrimp (Penaeus indicus, Penaeus japonicus and Penaeus monodon). Aquaculture 257. https://doi.org/10.1016/j. aquaculture.2006.02.053. Taniguchi, T., Palmieri, M., Weissmann, C., 1978. QB DNA-containing hybrid plasmids giving rise to QB phage formation in the bacterial host. Nature 274 (5668), 223–228. Trump, B.F., Smuckler, E.A., Benditt, E.P., 1961. A method for staining epoxy sections for light microscopy. J. Ultrastruct. Res. 5 (4), 343–348. https://doi.org/10.1016/ S0022-5320(61)80011-7. Wangman, P., Senapin, S., Chaivisuthangkura, P., Longyant, S., Rukpratanporn, S., Sithigorngul, P., 2012. Production of monoclonal antibodies specific to Macrobrachium rosenbergii nodavirus using recombinant capsid protein. Dis. Aquat. Org. 98 (2), 121–131. Retrieved from. http://www.int-res.com/abstracts/dao/v98/ n2/p121-131/. Widada, J.S., Bonami, J.-R., 2004. Characteristics of the monocistronic genome of extra small virus, a virus-like particle associated with Macrobrachium rosenbergii nodavirus: possible candidate for a new species of satellite virus. J. Gen. Virol. 85 (Pt 3), 643–646. https://doi.org/10.1099/vir.0.79777-0. Yoganandhan, K., Leartvibhas, M., Sriwongpuk, S., Limsuwan, C., 2006. White tail disease of the giant freshwater prawn Macrobrachium rosenbergii in Thailand. Dis. Aquat. Org. 69 (2–3), 255–258. https://doi.org/10.3354/dao069255. Zhang, H., Wang, J., Yuan, J., Li, L., Zhang, J., Bonami, J.-R., Shi, Z., 2006. Quantitative relationship of two viruses (MrNV and XSV) in white-tail disease of Macrobrachium rosenbergii. Dis. Aquat. Org. 71 (1), 11–17. https://doi.org/10.3354/dao071011.

Rukpratanporn, S., Sithigorngul, P., 2012. Monoclonal antibodies against extra small virus show that it co-localizes with Macrobrachium rosenbergii nodavirus. Dis. Aquat. Org. 99 (3), 197–205. https://doi.org/10.3354/dao02482. Lowy, D.R., Rands, E., Chattopadhyay, S.K., Garon, C.F., Hager, G.L., 1980. Molecular cloning of infectious integrated murine leukemia virus DNA from infected mouse cells. Proc. Natl. Acad. Sci. U. S. A 77 (1), 614–618. Retrieved from. http://www. ncbi.nlm.nih.gov/pmc/articles/PMC348325/. Mani, R., Basha, N., Mani, S., Hernandez, I., Sri Widada, J., Bonami, J.-R., Hameed, A.S., 2009. Studies on the occurrence of white tail disease (WTD) caused by MrNV and XSV in hatchery-reared post-larvae of Penaeus indicus and P. monodon. Aquaculture 292. https://doi.org/10.1016/j.aquaculture.2009.03.051. Pal, N., Boyapalle, S., Beckett, R.J., Miller, W.A., Bonning, B., 2007. A baculovirus-expressed dicistrovirus that is infectious to aphids. J. Virol. 88 (6), 3610 3610. Qian, D., Shi, Z., Zhang, S., Cao, Z., Liu, W., Li, L., Bonami, J.-R., 2003. Extra small viruslike particles (XSV) and nodavirus associated with whitish muscle disease in the giant freshwater prawn, Macrobrachium rosenbergii. J. Fish Dis. 26 (9), 521–527. https:// doi.org/10.1046/j.1365-2761.2003.00486.x. Racaniello, V.R., Baltimore, D., 1981. Cloned poliovirus complementary DNA is infectious in mammalian cells. Science 214 (4523), 916–919. Schnell, M.J., Mebatsion, T., Conzelmann, K.K., 1994. Infectious rabies viruses from cloned cDNA. EMBO J. 13 (18), 4195–4203. Retrieved from. http://www.ncbi.nlm. nih.gov/pmc/articles/PMC395346/. Sahul Hameed, A.S., Yoganandhan, K., Sri Widada, J., Bonami, J.R., 2004. Experimental transmission and tissue tropism of Macrobrachium rosenbergii nodavirus (MrNV) and its associated small virus (XSV). Dis. Aquat. Org. 62, 191–196. Senapin, S., Molthathong, S., Phiwsaiya, K., Jaengsanong, C., Chuchird, N., 2010. Application of high resolution melt (HRM) analysis for duplex detection of Macrobrachium rosenbergii nodavirus (MrNV) and extra small virus (XSV) in shrimp. Mol. Cell. Probes 24 (5), 291–297. https://doi.org/10.1016/j.mcp.2010.06.003. Senapin, S., Jaengsanong, C., Phiwsaiya, K., Prasertsri, S., Laisutisan, K., Chuchird, N., Flegel, T.W., 2012. Infections of MrNV (Macrobrachium rosenbergii nodavirus) in

37