- Email: [email protected]
In vivo selection of carbapenem-resistant Klebsiella pneumoniae by OmpK36 loss during meropenem treatment
Available online at www.sciencedirect.com
Diagnostic Microbiology and Infectious Disease 65 (2009) 447 – 449 www.elsevier.com/locate/diagmicrobio
In vivo selection of carbapenem-resistant Klebsiella pneumoniae by OmpK36 loss during meropenem treatment Wonkeun Songa , Borum Suhb , Jun Yong Choic , Seok Hoon Jeongb,⁎, Eun Hee Jeonb , Young Ki Leed , Seong Geun Honge , Kyungwon Leeb a
Department of Laboratory Medicine, Hallym University College of Medicine, 120-950 Seoul, Republic of Korea Department of Laboratory Medicine and Research Institute of Bacterial Resistance, Yonsei University College of Medicine, 120-752 Seoul, Republic of Korea c Department of Internal Medicine, Yonsei University College of Medicine, 120-752 Seoul, Republic of Korea d Department of Internal Medicine, Hallym University College of Medicine, 120-950 Seoul, Republic of Korea e Department of Laboratory Medicine, CHA University School of Medicine, 463-712 Sungnam, Republic of Korea Received 11 June 2009; accepted 17 August 2009
b
Abstract We recovered a carbapenem-resistant Klebsiella pneumoniae isolate H224 under in vivo meropenem selection pressure. Insertional inactivation of a major porin gene, ompK36, by IS5 element might play a role in acquiring carbapenem resistance in this strain harboring plasmid-borne DHA-1 AmpC β-lactamase. © 2009 Elsevier Inc. All rights reserved. Keywords: OmpK35; OmpK36; DHA-1; Carbapenems; IS5
Carbapenems have widely been used as the drug of choice to treat serious infections caused by Klebsiella pneumoniae producing extended-spectrum β-lactamases (ESBLs). However, rapid dissemination of carbapenem-resistant K. pneumoniae has repeatedly been reported since the first identification of K. pneumoniae producing KPC-1 carbapenemase from a hospital in North Carolina in 1996 (Nordmann et al., 2009; Yigit et al., 2001). Carbapenem resistance in K. pneumoniae has mainly been ascribed to enzymatic degradation by plasmid-borne carbapenemases (Queenan and Bush, 2007). However, the association between the loss of both or either one of the 2 major porins, OmpK35 and OmpK36, and increased carbapenem MICs has been described in K. pneumoniae harboring ESBLs or AmpC enzymes (Doumith et al., 2009; Lee et al., 2007b). The aim of this study was to investigate the mechanisms involved in acquiring carbapenem resis-
⁎ Corresponding author. Tel.: +82-2-2228-2448; fax: +82-2-313-0908. E-mail address: [email protected] (S.H. Jeong). 0732-8893/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.diagmicrobio.2009.08.010
tance in a K. pneumoniae strain under in vivo meropenem selection pressure. The patient was an 80-year-old female undergoing hemodialysis. She was admitted to an intensive care unit in a secondary-care hospital in Seoul, Korea, for symptoms of hematuria and fever on October 30, 2008. The patient had visited a local clinic for a urinary tract infection (UTI) 7 days before admission and had received cefotaxime for 5 days and then switched to imipenem for 2 days. The initial diagnosis was sepsis with a UTI, and carbapenem-susceptible K. pneumoniae isolates coproducing ESBL and AmpC were recovered from blood (isolate H209) and urine (isolate H210) specimens. Meropenem was administered from the day of admission, and the symptoms soon improved. However, a carbapenem-resistant K. pneumoniae isolate (isolate H224) was recovered from a urine specimen 15 days later. Meropenem therapy was continued because the clinical symptoms improved. The patient was discharged from the hospital without complications. All 3 K. pneumoniae isolates showed identical XbaI macrorestriction patterns on pulsed-field gel electrophoresis. Etest experiments (AB BIODISK, Solna, Sweden) showed
448
W. Song et al. / Diagnostic Microbiology and Infectious Disease 65 (2009) 447–449
that MICs of imipenem (N32 mg/L) and meropenem (8 mg/L) for isolate H224 were higher than those of isolates H209 and H210 (Table 1). An AmpC inhibitor, aminophenylboronic acid (at a fixed concentration of 6 mg/L), lowered MICs of imipenem and meropenem to 1.5 and 0.25 mg/L, respectively, but clavulanic acid (4 mg/L) and Phe–Arg–βnaphthylamide (20 mg/L; Sigma-Aldrich, St. Louis, MO) did not. The modified phenotypic confirmatory test for ESBL production showed that all 3 isolates produced both ESBL and AmpC enzymes (Song et al., 2007). However, all isolates showed negative results on both Hodge test and imipenem and EDTA–sodium mercaptoacetic acid doubledisk synergy test for the screening of carbapenemases and metallo-β-lactamases, respectively (Lee et al., 2001). All 3 isolates transferred ceftazidime resistance to azideresistant recipient Escherichia coli J53 by conjugation, but not imipenem resistance despite repeated attempts. The transconjugants exhibited a high level of resistance to ceftazidime (MIC, N256 mg/L) but a susceptibility to both imipenem and meropenem. Polymerase chain reaction (PCR) and sequencing experiments detected the blaSHV-12 and blaDHA-1 genes, but no genes encoding carbapenemase of classes A, B, and D. Isoelectric focusing experiments revealed bands of pI 7.8 and 8.2, which correspond to DHA1 and SHV-12, respectively. Both blaSHV-12 and blaDHA-1 probes hybridized with the same 70-kbp plasmid linearized by S1 nuclease digestion. The P replicon also hybridized with the plasmid. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) experiments were carried out to investigate alterations of outer membrane proteins (OMPs) as previously described (Kaczmarek et al., 2006). The experiments exhibited a lack of 36-kDa OMP in only the isolate H224 (Fig. 1). Real-time quantitative PCR experiments using primers and probes listed in Table 2 showed that the expression level of the OmpK36 gene in isolate H224 was 22 and 29 times lower than that of isolates H209 and H210, respectively. PCR experiments detected the OmpK35 and OmpK36 genes in all 3 isolates. Sequences of the OmpK35 gene in all 3 isolates were 100% identical to that of K. pneumoniae strain CI507 (GenBank accession no. FJ577672). OmpK36 gene sequences in isolates H209 and
Table 1 Carbapenems MICs with or without inhibitors for clinical isolates of K. pneumoniae by Etest Isolate
H209 H210 H221
MICs (mg/L) Without inhibitor
Clavulanic acid (4 mg/L)
APB (6 mg/L)
PAβN (20 mg/L)
IMP
MER
IMP
MER
IMP
MER
IMP
MER
0.25 0.75 N32
0.094 0.19 8
0.125 0.125 24
0.047 0.064 6
0.125 0.25 1.5
0.016 0.016 0.25
0.38 0.25 N32
0.15 0.19 12
APB = aminophenylboronic acid; PAβN = Phe–Arg–β-naphthylamide; IMP = imipenem; MER = meropenem.
Fig. 1. SDS-PAGE profiles of OMPs. Lane M, molecular marker; lane 1, control K. pneumoniae strain P60; lane 2, imipenem-susceptible K. pneumoniae isolate H209; lane 3, imipenem-susceptible K. pneumoniae isolate H210; lane 4, imipenem-resistant K. pneumoniae isolate H224.
H210 were 100% identical to that of K. pneumoniae strain VM522 (accession no. FJ577673). However, the PCR product size of the OmpK36 gene in isolate H224 was about 2.4 kb, which was larger than the expected size of 1.2 kb, suggesting the insertion of additional DNA. Direct sequencing of PCR products demonstrated that IS5 element was inserted into the open reading frame of the OmpK36 gene at the 827th nucleotide sequence from the start codon (Fig. 2). IS5 was 1196 bp in size and contained 3 orfs, including the ins5A gene in reverse direction and the ins5B and ins5C genes in the forward direction (Sawers, 2005). IS5 generated a 4-bp duplication (5′-CTAA-3′) at the predicted insertion site and was bound by imperfect 16-bp inverted repeat sequences. In vivo development of carbapenem resistance in sequential K. pneumoniae isolates has previously been described in 2 strains. The first strain, which produced a CTX-M-1 cluster ESBL, acquired ertapenem resistance by Table 2 Nucleotide sequences of primers and probes used in real-time PCR experiments Primer and probe
Sequence (5′→3′)
ompK35 forward ompK35 reverse
ACGTACAGACCAAAGGCAAGG ACTTCGATGTATTTAACCAGATCCG
ompK35 probe ompK36 forward ompK36 reverse
Accession no. of reference gene FJ577675, AJ011501
CGTGCTGGCTTCTCCGGCGGC TCAGTACCAGTTCGACTTCGG TTTTGTAGTCAACATAGGTGGACATG FJ577673, FJ577675 ompK36 probe CTGCGTCCGTCCGTGGCTTACCTG 16S rRNA forward AGCTAGAGTATGGGAGAGGATGG 16S rRNA reverse TTCGTACCTCAGCGTCAGTATTAG EU030641, NR026026 16S rRNA probe TGCCTTCGCCATCGGTATTCCTCCAGA
W. Song et al. / Diagnostic Microbiology and Infectious Disease 65 (2009) 447–449
449
Fig. 2. Schematic representation of the genetic organization of insertion element IS5 disrupting ompK36 gene in K. pneumoniae isolate H224. The transcription directions of ins5A, ins5B, ins5C, and ompK36 genes are depicted as black arrows. IR = inverted repeat sequences; DR = direct repeat sequences.
loss of OmpK36 during ertapenem plus amikacin therapy (Elliott et al., 2006). The second strain (isolate Lkp14) produced CTX-M-3 and SHV-5 ESBLs and acquired ertapenem resistance by acquiring the blaDHA-1 gene and losing OmpK36 during flomoxef therapy (Lee et al., 2007a). Insertional inactivation of ompK36 genes by IS5 was also described in the latter strain, similarly to our strain. However, the 2 strains showed differences in the insertion positions, as follows: 97th and 827th nucleotide sequence from the start codon in isolates Lkp14 and H224, respectively. In combination with the production of plasmid-borne DHA-1 enzyme, OmpK36 loss may have contributed to the in vivo selection of carbapenem-resistant K. pneumoniae under the selective pressure of meropenem. Carbapenem resistance arising from selectional loss of major porins in K. pneumoniae producing ESBLs and/or AmpCs is a cause for concern, considering the high prevalence of these enzymes in nosocomial K. pneumoniae isolates. Thus, the continuous monitoring of carbapenem susceptibility is warranted. Nucleotide sequence accession numbers. The nucleotide sequence data reported in this article are available in the GenBank nucleotide database under accession number GQ148784. Acknowledgment This work was supported by the Korea Research Foundation Grant (KRF-2008-E00194). References Doumith M, Ellington MJ, Livermore DM, Woodford N (2009) Molecular mechanisms disrupting porin expression in ertapenem-resistant Kleb-
siella and Enterobacter spp. clinical isolates from the UK. J Antimicrob Chemother 63:659–667. Elliott E, Brink AJ, van Greune J, Els Z, Woodford N, Turton J, Warner M, Livermore DM (2006) In vivo development of ertapenem resistance in a patient with pneumonia caused by Klebsiella pneumoniae with an extended-spectrum β-lactamase. Clin Infect Dis 42:e95–e98. Kaczmarek FM, Dib-Hajj F, Shang W, Gootz TD (2006) High-level carbapenem resistance in a Klebsiella pneumoniae clinical isolate is due to the combination of blaACT-1 β-lactamase production, porin OmpK35/ 36 insertional inactivation, and down-regulation of the phosphate transport porin PhoE. Antimicrob Agents Chemother 50:3396–3406. Lee K, Chong Y, Shin HB, Kim YA, Yong D, Yum JH (2001) Modified Hodge and EDTA-disk synergy tests to screen metallo-β-lactamase– producing strains of Pseudomonas and Acinetobacter species. Clin Microbiol Infect 7:88–91. Lee CH, Chu C, Liu JW, Chen YS, Chiu CJ, Su LH (2007a) Collateral damage of flomoxef therapy: in vivo development of porin deficiency and acquisition of blaDHA-1 leading to ertapenem resistance in a clinical isolate of Klebsiella pneumoniae producing CTX-M-3 and SHV-5 βlactamases. J Antimicrob Chemother 60:410–413. Lee K, Yong D, Choi YS, Yum JH, Kim JM, Woodford N, Livermore DM, Chong Y (2007b) Reduced imipenem susceptibility in Klebsiella pneumoniae clinical isolates with plasmid-mediated CMY-2 and DHA-1 β-lactamases co-mediated by porin loss. Intern J Antimicrob Agents 29:201–206. Nordmann P, Cuzon G, Naas T (2009) The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis 9: 228–236. Queenan AM, Bush K (2007) Carbapenemases: the versatile β-lactamases. Clin Microbiol Rev 20:440–458. Sawers RG (2005) Transcript analysis of Escherichia coli K-12 insertion element IS5. FEMS Microbiol Lett 244:397–401. Song W, Bae IK, Lee YN, Lee CH, Lee SH, Jeong SH (2007) Detection of extended-spectrum β-lactamases by using boronic acid as an AmpC βlactamase inhibitor in clinical isolates of Klebsiella spp. and Escherichia coli. J Clin Microbiol 45:1180–1184. Yigit H, Queenan AM, Anderson GJ, Domenech-Sanchez A, Biddle JW, Steward CD, Alberti S, Bush K, Tenover FC (2001) Novel carbapenemhydrolyzing β-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother 45:1151–1161.
Diagnostic Microbiology and Infectious Disease 65 (2009) 447 – 449 www.elsevier.com/locate/diagmicrobio
In vivo selection of carbapenem-resistant Klebsiella pneumoniae by OmpK36 loss during meropenem treatment Wonkeun Songa , Borum Suhb , Jun Yong Choic , Seok Hoon Jeongb,⁎, Eun Hee Jeonb , Young Ki Leed , Seong Geun Honge , Kyungwon Leeb a
Department of Laboratory Medicine, Hallym University College of Medicine, 120-950 Seoul, Republic of Korea Department of Laboratory Medicine and Research Institute of Bacterial Resistance, Yonsei University College of Medicine, 120-752 Seoul, Republic of Korea c Department of Internal Medicine, Yonsei University College of Medicine, 120-752 Seoul, Republic of Korea d Department of Internal Medicine, Hallym University College of Medicine, 120-950 Seoul, Republic of Korea e Department of Laboratory Medicine, CHA University School of Medicine, 463-712 Sungnam, Republic of Korea Received 11 June 2009; accepted 17 August 2009
b
Abstract We recovered a carbapenem-resistant Klebsiella pneumoniae isolate H224 under in vivo meropenem selection pressure. Insertional inactivation of a major porin gene, ompK36, by IS5 element might play a role in acquiring carbapenem resistance in this strain harboring plasmid-borne DHA-1 AmpC β-lactamase. © 2009 Elsevier Inc. All rights reserved. Keywords: OmpK35; OmpK36; DHA-1; Carbapenems; IS5
Carbapenems have widely been used as the drug of choice to treat serious infections caused by Klebsiella pneumoniae producing extended-spectrum β-lactamases (ESBLs). However, rapid dissemination of carbapenem-resistant K. pneumoniae has repeatedly been reported since the first identification of K. pneumoniae producing KPC-1 carbapenemase from a hospital in North Carolina in 1996 (Nordmann et al., 2009; Yigit et al., 2001). Carbapenem resistance in K. pneumoniae has mainly been ascribed to enzymatic degradation by plasmid-borne carbapenemases (Queenan and Bush, 2007). However, the association between the loss of both or either one of the 2 major porins, OmpK35 and OmpK36, and increased carbapenem MICs has been described in K. pneumoniae harboring ESBLs or AmpC enzymes (Doumith et al., 2009; Lee et al., 2007b). The aim of this study was to investigate the mechanisms involved in acquiring carbapenem resis-
⁎ Corresponding author. Tel.: +82-2-2228-2448; fax: +82-2-313-0908. E-mail address: [email protected] (S.H. Jeong). 0732-8893/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.diagmicrobio.2009.08.010
tance in a K. pneumoniae strain under in vivo meropenem selection pressure. The patient was an 80-year-old female undergoing hemodialysis. She was admitted to an intensive care unit in a secondary-care hospital in Seoul, Korea, for symptoms of hematuria and fever on October 30, 2008. The patient had visited a local clinic for a urinary tract infection (UTI) 7 days before admission and had received cefotaxime for 5 days and then switched to imipenem for 2 days. The initial diagnosis was sepsis with a UTI, and carbapenem-susceptible K. pneumoniae isolates coproducing ESBL and AmpC were recovered from blood (isolate H209) and urine (isolate H210) specimens. Meropenem was administered from the day of admission, and the symptoms soon improved. However, a carbapenem-resistant K. pneumoniae isolate (isolate H224) was recovered from a urine specimen 15 days later. Meropenem therapy was continued because the clinical symptoms improved. The patient was discharged from the hospital without complications. All 3 K. pneumoniae isolates showed identical XbaI macrorestriction patterns on pulsed-field gel electrophoresis. Etest experiments (AB BIODISK, Solna, Sweden) showed
448
W. Song et al. / Diagnostic Microbiology and Infectious Disease 65 (2009) 447–449
that MICs of imipenem (N32 mg/L) and meropenem (8 mg/L) for isolate H224 were higher than those of isolates H209 and H210 (Table 1). An AmpC inhibitor, aminophenylboronic acid (at a fixed concentration of 6 mg/L), lowered MICs of imipenem and meropenem to 1.5 and 0.25 mg/L, respectively, but clavulanic acid (4 mg/L) and Phe–Arg–βnaphthylamide (20 mg/L; Sigma-Aldrich, St. Louis, MO) did not. The modified phenotypic confirmatory test for ESBL production showed that all 3 isolates produced both ESBL and AmpC enzymes (Song et al., 2007). However, all isolates showed negative results on both Hodge test and imipenem and EDTA–sodium mercaptoacetic acid doubledisk synergy test for the screening of carbapenemases and metallo-β-lactamases, respectively (Lee et al., 2001). All 3 isolates transferred ceftazidime resistance to azideresistant recipient Escherichia coli J53 by conjugation, but not imipenem resistance despite repeated attempts. The transconjugants exhibited a high level of resistance to ceftazidime (MIC, N256 mg/L) but a susceptibility to both imipenem and meropenem. Polymerase chain reaction (PCR) and sequencing experiments detected the blaSHV-12 and blaDHA-1 genes, but no genes encoding carbapenemase of classes A, B, and D. Isoelectric focusing experiments revealed bands of pI 7.8 and 8.2, which correspond to DHA1 and SHV-12, respectively. Both blaSHV-12 and blaDHA-1 probes hybridized with the same 70-kbp plasmid linearized by S1 nuclease digestion. The P replicon also hybridized with the plasmid. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) experiments were carried out to investigate alterations of outer membrane proteins (OMPs) as previously described (Kaczmarek et al., 2006). The experiments exhibited a lack of 36-kDa OMP in only the isolate H224 (Fig. 1). Real-time quantitative PCR experiments using primers and probes listed in Table 2 showed that the expression level of the OmpK36 gene in isolate H224 was 22 and 29 times lower than that of isolates H209 and H210, respectively. PCR experiments detected the OmpK35 and OmpK36 genes in all 3 isolates. Sequences of the OmpK35 gene in all 3 isolates were 100% identical to that of K. pneumoniae strain CI507 (GenBank accession no. FJ577672). OmpK36 gene sequences in isolates H209 and
Table 1 Carbapenems MICs with or without inhibitors for clinical isolates of K. pneumoniae by Etest Isolate
H209 H210 H221
MICs (mg/L) Without inhibitor
Clavulanic acid (4 mg/L)
APB (6 mg/L)
PAβN (20 mg/L)
IMP
MER
IMP
MER
IMP
MER
IMP
MER
0.25 0.75 N32
0.094 0.19 8
0.125 0.125 24
0.047 0.064 6
0.125 0.25 1.5
0.016 0.016 0.25
0.38 0.25 N32
0.15 0.19 12
APB = aminophenylboronic acid; PAβN = Phe–Arg–β-naphthylamide; IMP = imipenem; MER = meropenem.
Fig. 1. SDS-PAGE profiles of OMPs. Lane M, molecular marker; lane 1, control K. pneumoniae strain P60; lane 2, imipenem-susceptible K. pneumoniae isolate H209; lane 3, imipenem-susceptible K. pneumoniae isolate H210; lane 4, imipenem-resistant K. pneumoniae isolate H224.
H210 were 100% identical to that of K. pneumoniae strain VM522 (accession no. FJ577673). However, the PCR product size of the OmpK36 gene in isolate H224 was about 2.4 kb, which was larger than the expected size of 1.2 kb, suggesting the insertion of additional DNA. Direct sequencing of PCR products demonstrated that IS5 element was inserted into the open reading frame of the OmpK36 gene at the 827th nucleotide sequence from the start codon (Fig. 2). IS5 was 1196 bp in size and contained 3 orfs, including the ins5A gene in reverse direction and the ins5B and ins5C genes in the forward direction (Sawers, 2005). IS5 generated a 4-bp duplication (5′-CTAA-3′) at the predicted insertion site and was bound by imperfect 16-bp inverted repeat sequences. In vivo development of carbapenem resistance in sequential K. pneumoniae isolates has previously been described in 2 strains. The first strain, which produced a CTX-M-1 cluster ESBL, acquired ertapenem resistance by Table 2 Nucleotide sequences of primers and probes used in real-time PCR experiments Primer and probe
Sequence (5′→3′)
ompK35 forward ompK35 reverse
ACGTACAGACCAAAGGCAAGG ACTTCGATGTATTTAACCAGATCCG
ompK35 probe ompK36 forward ompK36 reverse
Accession no. of reference gene FJ577675, AJ011501
CGTGCTGGCTTCTCCGGCGGC TCAGTACCAGTTCGACTTCGG TTTTGTAGTCAACATAGGTGGACATG FJ577673, FJ577675 ompK36 probe CTGCGTCCGTCCGTGGCTTACCTG 16S rRNA forward AGCTAGAGTATGGGAGAGGATGG 16S rRNA reverse TTCGTACCTCAGCGTCAGTATTAG EU030641, NR026026 16S rRNA probe TGCCTTCGCCATCGGTATTCCTCCAGA
W. Song et al. / Diagnostic Microbiology and Infectious Disease 65 (2009) 447–449
449
Fig. 2. Schematic representation of the genetic organization of insertion element IS5 disrupting ompK36 gene in K. pneumoniae isolate H224. The transcription directions of ins5A, ins5B, ins5C, and ompK36 genes are depicted as black arrows. IR = inverted repeat sequences; DR = direct repeat sequences.
loss of OmpK36 during ertapenem plus amikacin therapy (Elliott et al., 2006). The second strain (isolate Lkp14) produced CTX-M-3 and SHV-5 ESBLs and acquired ertapenem resistance by acquiring the blaDHA-1 gene and losing OmpK36 during flomoxef therapy (Lee et al., 2007a). Insertional inactivation of ompK36 genes by IS5 was also described in the latter strain, similarly to our strain. However, the 2 strains showed differences in the insertion positions, as follows: 97th and 827th nucleotide sequence from the start codon in isolates Lkp14 and H224, respectively. In combination with the production of plasmid-borne DHA-1 enzyme, OmpK36 loss may have contributed to the in vivo selection of carbapenem-resistant K. pneumoniae under the selective pressure of meropenem. Carbapenem resistance arising from selectional loss of major porins in K. pneumoniae producing ESBLs and/or AmpCs is a cause for concern, considering the high prevalence of these enzymes in nosocomial K. pneumoniae isolates. Thus, the continuous monitoring of carbapenem susceptibility is warranted. Nucleotide sequence accession numbers. The nucleotide sequence data reported in this article are available in the GenBank nucleotide database under accession number GQ148784. Acknowledgment This work was supported by the Korea Research Foundation Grant (KRF-2008-E00194). References Doumith M, Ellington MJ, Livermore DM, Woodford N (2009) Molecular mechanisms disrupting porin expression in ertapenem-resistant Kleb-
siella and Enterobacter spp. clinical isolates from the UK. J Antimicrob Chemother 63:659–667. Elliott E, Brink AJ, van Greune J, Els Z, Woodford N, Turton J, Warner M, Livermore DM (2006) In vivo development of ertapenem resistance in a patient with pneumonia caused by Klebsiella pneumoniae with an extended-spectrum β-lactamase. Clin Infect Dis 42:e95–e98. Kaczmarek FM, Dib-Hajj F, Shang W, Gootz TD (2006) High-level carbapenem resistance in a Klebsiella pneumoniae clinical isolate is due to the combination of blaACT-1 β-lactamase production, porin OmpK35/ 36 insertional inactivation, and down-regulation of the phosphate transport porin PhoE. Antimicrob Agents Chemother 50:3396–3406. Lee K, Chong Y, Shin HB, Kim YA, Yong D, Yum JH (2001) Modified Hodge and EDTA-disk synergy tests to screen metallo-β-lactamase– producing strains of Pseudomonas and Acinetobacter species. Clin Microbiol Infect 7:88–91. Lee CH, Chu C, Liu JW, Chen YS, Chiu CJ, Su LH (2007a) Collateral damage of flomoxef therapy: in vivo development of porin deficiency and acquisition of blaDHA-1 leading to ertapenem resistance in a clinical isolate of Klebsiella pneumoniae producing CTX-M-3 and SHV-5 βlactamases. J Antimicrob Chemother 60:410–413. Lee K, Yong D, Choi YS, Yum JH, Kim JM, Woodford N, Livermore DM, Chong Y (2007b) Reduced imipenem susceptibility in Klebsiella pneumoniae clinical isolates with plasmid-mediated CMY-2 and DHA-1 β-lactamases co-mediated by porin loss. Intern J Antimicrob Agents 29:201–206. Nordmann P, Cuzon G, Naas T (2009) The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis 9: 228–236. Queenan AM, Bush K (2007) Carbapenemases: the versatile β-lactamases. Clin Microbiol Rev 20:440–458. Sawers RG (2005) Transcript analysis of Escherichia coli K-12 insertion element IS5. FEMS Microbiol Lett 244:397–401. Song W, Bae IK, Lee YN, Lee CH, Lee SH, Jeong SH (2007) Detection of extended-spectrum β-lactamases by using boronic acid as an AmpC βlactamase inhibitor in clinical isolates of Klebsiella spp. and Escherichia coli. J Clin Microbiol 45:1180–1184. Yigit H, Queenan AM, Anderson GJ, Domenech-Sanchez A, Biddle JW, Steward CD, Alberti S, Bush K, Tenover FC (2001) Novel carbapenemhydrolyzing β-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother 45:1151–1161.