Rapid acquisition of decreased carbapenem susceptibility in a strain of Klebsiella pneumoniae arising during meropenem therapy

ORIGINAL ARTICLE

BACTERIOLOGY

Rapid acquisition of decreased carbapenem susceptibility in a strain of Klebsiella pneumoniae arising during meropenem therapy J. Findlay1, A. Hamouda1, S. J. Dancer2 and S. G. B. Amyes1 1) Centre for Infectious Disease, The University of Edinburgh, Edinburgh, UK and 2) Hairmyres Hospital, East Kilbride, UK

Abstract A strain of Klebsiella pneumoniae (K1) was isolated from a catheterized patient with a urinary tract infection. The patient was subsequently treated with meropenem, after which K. pneumoniae (K2) was once again isolated from the patient’s urine. Susceptibility testing showed that strain K1 was fully susceptible to carbapenem antibiotics with the exception of ertapenem, to which it exhibited intermediate resistance, whilst K2 was resistant to ertapenem and meropenem. From pulsed-field gel electrophoresis profiling both strains exhibited identical banding patterns. Both contained CTX-M-15, OXA-1, SHV-1 and TEM-1 b-lactamase genes following PCR analyses. Outer membrane protein analysis demonstrated that K1 and K2 lacked an OMP of c. 40 kDa, with an additional OMP of c. 36 kDa missing from K2. Mutation studies showed that the K2 OMP phenotype could be selected by single-step carbapenem-resistant mutants of K1. Expression of transcriptional activator ramA and efflux pump component gene acrA were up-regulated in both strains by RT-PCR. Neither strain expressed ompK35, but ompK36 was found in both. Sequence analysis revealed gene sequences of ompK35, ompK36 and ramR in both strains; notably, ramR contained a mutation resulting in a premature stop codon. Transconjugation studies demonstrated transfer of a plasmid into E. coli encoding the CTX-M-15, TEM-1 and OXA-1 b-lactamases. We concluded that the carbapenem-resistant phenotype observed from this patient was attributable to a combination of CTX-M-15 b-lactamase, up-regulated efflux and altered outer membrane permeability, and that K2 arose from K1 as a direct result of meropenem therapy. Keywords: CTX-M-15, efflux, ertapenem, Klebsiella pneumoniae, outer membrane proteins Original Submission: 15 December 2010; Revised Submission: 2 February 2011; Accepted: 3 March 2011 Editor: M. Drancourt Article published online: 23 March 2011 Clin Microbiol Infect 2012; 18: 140–146 10.1111/j.1469-0691.2011.03515.x Corresponding author: S. G. B. Amyes, The University of Edinburgh, Centre for Infectious Disease, 49 Little France Crescent, Edinburgh EH16 4SB, UK E-mail: [email protected] Part of this work was presented at the 50th Interscience Conference on Antimicrobial Agents and Chemotherapy, Boston, MA, 2010.

Introduction Over the last three decades an increasing number of antibiotic resistance mechanisms have been emerging in members of the Enterobacteriaceae, particularly to the b-lactam antibiotics [1,2]. Resistance to these agents is most commonly mediated by either the production of enzymes, b-lactamases, which act to hydrolyse and therefore disable the antibiotics, or by the alteration of the expression of the outer

membrane proteins (OMPs), which can act to decrease the diffusion of antibiotics through the cell membrane, preventing access to their target site [3,4]. Often a combination of both can result in extremely high levels of resistance to most, if not all, b-lactam antibiotics [3]. The loss of expression of two of the major OMPs in K. pneumoniae, OmpK35 and OmpK36, has been shown to contribute significantly to reduced susceptibility to b-lactam antibiotics in several studies [4,5]. Studies suggest that such porin loss coupled with extended-spectrum b-lactamase (ESBL) production can confer resistance to b-lactam antibiotics, including carbapenems [5,6]. It has previously been shown that reduced susceptibility to both ertapenem and meropenem can be achieved via the overexpression of efflux genes, in particular, members of the resistance-nodulation division (RND) family; however, imipenem susceptibility remains unchanged, suggesting that it is

ª2011 The Authors Clinical Microbiology and Infection ª2011 European Society of Clinical Microbiology and Infectious Diseases

CMI

Findlay et al. Development of carbapenem resistance during therapy

not a good substrate for these efflux systems [7–9]. RND family efflux pumps have been shown to have a broad substrate range, demonstrating that the activation of a single resistance mechanism can result in clinical levels of resistance to several classes of antibiotics [10]. Overexpression of efflux pumps has been shown to contribute to carbapenem resistance in Pseudomonas aeruginosa, usually in conjunction with porin loss and/or ampC overexpression [7,11]. Klebsiella pneumoniae is known to cause a variety of serious nosocomial infections, particularly in immunocompromized patients. In recent years, the incidence of carbapenem resistance in K. pneumoniae has increased significantly, largely due to the production and dissemination of carbapenemases such as the KPC enzymes [12]. A study by the National Healthcare Safety Network in the USA over a 12-month period from 2006 to 2007 revealed that K. pneumoniae comprised 5.8% of the total hospital-acquired infections (HAIs) and 7.7% of catheter-associated urinary tract infections (UTIs) [13]. The same study showed that 21.2% of those K. pneumoniae isolates were resistant to cephalosporins and 10.1% exhibited resistance to carbapenems [13]. These drugs are traditionally viewed as the ‘drugs of last resort’ for multidrug-resistant (MDR) K. pneumoniae infections. In this report we describe the in vivo clinical development of carbapenem resistance in a strain of K. pneumoniae after meropenem therapy.

Materials and Methods

141

Susceptibility testing

Susceptibility testing was performed by agar doubling dilution according to British Society for Antimicrobial Chemotherapy (BSAC) guidelines [16]. MICs were determined to the following antibiotics: amikacin, ampicillin, aztreonam, cefoxitin, ceftazidime, chloramphenicol, ciprofloxacin, colistin, ertapenem, gentamicin, imipenem, imipenem/EDTA, meropenem, piperacillin, sulbactam, tetracycline, tigecycline and tobramycin. Clavulanic acid synergy testing was performed with clavulanic acid incorporated into Iso-sensitest (IST) agar (Oxoid, Hampshire, UK) at 4 mg/L and using 10 lg ertapenem discs (Oxoid). Pulsed-field gel electrophoresis (PFGE) typing

PFGE was performed according to the protocol of Miranda et al. [17]. Plugs were digested with XbaI. PFGE was performed with a CHEF-DRII system (Bio-Rad, Hertfordshire, UK) with a pulse time of 5–40 s over 22 h at 200 V. A Lambda Ladder PFG Marker (New England Biolabs, Hertfordshire, UK) was used as a size standard. PCR detection of b-lactamase genes

Isolates K1 and K2 were screened by PCR for the presence of the genes for the following b-lactamases: AmpC, CTX-M, GES, GIM, IMP, KPC, NDM, NMC/IMI, OXA, PER, SHV, SIM, SME, SPM, TEM, VEB and VIM. Positive control clinicallyisolated strains were used for each PCR. Amplification was carried out using cell lysate with Promega Go-Taq polymerase (Promega, Hampshire, UK) and all products were sequenced. All primers used in this study are listed in Table 1.

Bacterial strains

Modified Hodge test

K. pneumoniae strains K1 and K2 were found in separate urine samples from a catheterized patient with a UTI, in Hairmyres Hospital, Scotland, in 2008. K1 was collected prior to meropenem therapy and K2 was collected after meropenem therapy 5 days later. Carbapenem-susceptible K. pneumoniae ATCC 13883 was used as a control strain for OMP profiling and susceptibility testing. K. pneumoniae MGH78578, a clinical strain that contains the b-lactamases TEM-1 and SHV-12 and does not produce the OMP OmpK35 [14,15], was used as a control strain in mutation studies. Two previously characterized CTX-M-15 b-lactamase-containing K. pneumoniae strains, CTX-M-15 (1) and CTX-M-15 (2) (46th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy, abstract no. 86), were included as controls for susceptibility disc testing. A KPC-2-containing K. pneumoniae was used as a control for the modified Hodge test and Escherichia coli 25922 was used as the indicator strain. Rifampicin-resistant E. coli J62-2 was used as a recipient strain in transconjugation studies.

A modified Hodge test was performed to detect carbapenemase activity in strains K1 and K2 [18]. Analysis of gene expression

Total RNA was extracted from isolate cultures in the exponential growth phase (OD  0.5) using the RiboPure Bacteria kit (Ambion, Warrington, UK) and treated with DNase 1. cDNA was synthesized from 120 ng of RNA using the ProtoScript M-MuLV First Strand cDNA Synthesis kit (New England Biolabs). One microlitre of cDNA was used in PCR reactions. PCR reactions were run on an agarose gel and stained with ethidium bromide for visualization. All assays were performed in duplicate and with genomic DNA controls. Outer membrane profiling

Outer membrane proteins were extracted according to the protocol of Tsu-Lan et al. [23]. Cultures were grown in both high osmolarity medium (LB broth) and low osmolarity medium (NB broth) as OmpK35 expression is known to be

ª2011 The Authors Clinical Microbiology and Infection ª2011 European Society of Clinical Microbiology and Infectious Diseases, CMI, 18, 140–146

142

Clinical Microbiology and Infection, Volume 18 Number 2, February 2012

CMI

TABLE 1. The primers used in this study Primers Gene detection and sequencing AmpC_F & R CTX_F & R GES_F & R GIM_F & R IMP_F & R KPC_F & R NDM_F & R NMC/IMI_F & R OXA_F & R PER_F & R SHV_F & R SIM_F & R SME_F & R SPM_F & R TEM_F & R VEB_F & R VIM_F & R OmpK35_F & R OmpK36_F & R RamR_F & R RT-PCR analysis ramA_RTF & RTR acrA_RTF & RTR ompK35_RTF & RTR ompK36_RTF & RTR 16S_RTF & RTR

Forward sequence (5¢–3¢)

Reverse sequence (5¢–3¢)

Product size (bp)

References

ATCAAAACTGGCAGCCG GACGTCCGTATTTGCCTTC ATGCGCTTCATTGACGCAC TCGACACACCTTGGTCTGAA GGAATAGAGTGGCTTAAYTCTC CAGCTCATTCAAGGGCTTTC GACCGATGACCGCCCAG ATGTCATTAGGTGATATGGC CCGTTAAAATTAAGCCCTTT ATGAATGTCATTATAAAAGC CGCCGGGTTATTCTTATTTG TACAAGGGATTCGGCATCG TAGAGGAAGACTTTGATGGG AAAATCTGGGTACGCAAACG AGACGTCAGGTGGCACTTTT CGACTTCCATTTCCCGATGC GATGGTGTTTGGTCGCATA ATTTTGCACAAAAGGGGATG CAGCACAATGAATATAGCCGAC CATCCCGGAGGCTTTATGAT

GAGCCCGTTTTATGCACCCA ACCGTCGGTGACGATTTTAG CTATTTGTCCGTGCTCAGG AACTTCCAACTTTGCCATGC CCAAACYACTASGTTATCT GGCGGCGTTATCACTGTATT GACTTGGCCTTGCTGTCCTT GCATAATCATTTGCCGTACC GGTCTGTGACTTTGCCGTCT AATTTGGGCTTAGGGCAGAA CCACGTTTATGGCGTTACCT TAATGGCCTGTTCCCATGTG GCATAATCATTCGCAGTACC ACATTATCCGCTGGAACAGG GGCACCTATCTCAGCGATCT GGACTCTGCAACAAATACGC CGAATGCGCAGCACCAG AGAATTGGTAAACGATACCCACG GCTGTTGTCGTCCAGCAGGTTG CGCTCGACCTTAAACACGTC

550 985 864 477 188 196 372 398 994 925 1069 570 636 271 977 643 390 1117 1126 862

[6] [19] [20] [21] [21] This This [6] This [20] This [21] [6] [21] [22] [20] [21] This [6] This

CTGCAACGGCTGTTTTTACA GTCCTCAGGTCAGTGGCATT AAAACGGCAACAAACTGGAC GCGCTCTGTCTCCTACCAAC CAGCCACACTGGAACTGAGA

GTGGTTCTCTTTGCGGTAGG GGTGCCCAACAGTTTCTGAT AGACGGGTTTTTGTGGTCTG GGTGTACTGAGTGGCCAGGT GTTAGCCGGTGCTTCTTCTG

334 200 211 188 220

This This This This This

inhibited in the former [24]. Protein concentrations were estimated using a Nanodrop 1000 spectrophotometer and c. 50 lg was separated on a 12% SDS PAGE gel. Gels were stained with coomassie blue. Mutation studies

Overnight broth cultures of K1 and MGH78578 were spread onto IST agar plates containing either ertapenem or meropenem at 4–16· their respective MICs. Plates were incubated for 24 h and colonies were picked for further analysis of their susceptibility and OMP profiles.

work work work work

work & [6] work work work work work work

strains (K1 and K2) were mixed in a 1:4 ratio, and cells were collected by centrifugation and resuspended in 30 lL of cold saline. Five microlitre aliquots of the resuspension were spotted onto a nutrient agar plate and incubated at 37C for 6 h. Growth was collected and resuspended in cold saline and inoculated onto nutrient agar plates containing rifampicin at 16 mg/L and one of the selective antibiotics, gentamicin, ceftazidime or meropenem, at a range of concentrations.

Results

Sequencing of ompK35, ompK36 and ramR

Susceptibility profiles

OMP genes ompK35 and ompK36 and ramR were amplified and sequenced from strains K1, K2 and ATCC 13883. OMP gene sequences of ATCC 13883 and the ramR gene sequence from the sequenced genome of K. pneumoniae MGH78578 (NC 009648) were used as comparators.

Both strains K1 and K2 were resistant to most antibiotics tested, with the following exception: K2 was resistant to both ertapenem and meropenem, with intermediate resistance to imipenem, whilst K1 was susceptible to all three (Table 2). Colistin was the only antibiotic to which both strains were susceptible. Antibiotic disc testing in the presence of clavulanic acid showed that ertapenem disc diameters increased significantly in the presence of clavulanic acid for strains K1, K2, CTX-M-15 (1) and CTX-M-15 (2) but no change was observed for ATCC 13883 or MGH78578 (Table 3).

Plasmid profiling

The plasmids of K1 and K2 were profiled using the S1 nuclease/PFGE method [25]. Briefly, agarose plugs of K1 and K2 were digested at 37C for 45 min with 8 U of S1 nuclease. Reactions were stopped with the addition of 0.5 M EDTA and plugs were run by PFGE under the same conditions as used for XbaI typing. Transconjugation studies

Transconjugation assays were performed as follows: overnight cultures of the recipient (E. coli J62-2) and donor

PFGE analysis

Strains K1 and K2 showed identical banding patterns by PFGE analysis, indicating that they are of the same clonal type (Fig. 1). This suggests that K1 and K2 are almost certainly isogenic, K1 being the progenitor of K2.

ª2011 The Authors Clinical Microbiology and Infection ª2011 European Society of Clinical Microbiology and Infectious Diseases, CMI, 18, 140–146

Findlay et al. Development of carbapenem resistance during therapy

CMI

143

TABLE 2. The susceptibility profiles of K1, K2, the K1 meropenem mutant, the K1 ertapenem mutant, MGH78578 and the MGH78578 meropenem mutant Antibiotic

K1

S/I/R

K2

S/I/R

K1_Mero

S/I/R

K1_Ert

S/I/R

MGH

S/I/R

MGH_Mero

S/I/R

Amikacin Ampicillin Aztreonam Cefoxitin Ceftazidime Chloramphenicol Ciprofloxacin Colistin Ertapenem Gentamicin Imipenem Meropenem Piperacillin Sulbactam Tetracycline Tigecycline Tobramycin

32 >512 >256 64 >128 64 >256 1 1 128 0.125 0.125 >512 >32 16 4 64

R R R R R R R S S R S S R R R R R

32 >512 64 >128 >128 64 64 1 64 128 4 8 >512 >32 8 2 64

R R R R R R R S R R I R R R R I R

32 >512 >256 >128 >128 64 256 1 64 128 4 8 >512 >32 16 2 64

R R R R R R R S R R I R R R R I R

32 >512 >256 >128 >128 64 >256 1 64 128 4 8 >512 >32 16 2 128

R R R R R R R I R R I R R R R I R

2 >512 ND 16 1 512 2 1 0.25 16 0.25 0.125 128 32 >256 0.25 16

S R ND R S R R S S R S S R R R S R

2 >512 ND 64 1 512 2 1 1 16 0.5 0.5 128 >32 >256 0.25 16

S R ND R S R R S I R S S R R R S R

MIC values are in mg/L. S, sensitive; I, intermediate; R, resistant. ND, not determined.

TABLE 3. Ertapenem disk susceptibility testing in the presence/absence of clavulanic acid (Clav). Diameters are in millimetres

Ertapenem Ertapenem/Clav Difference

K1

K2

CTX-M-15 (1)

CTX-M-15 (2)

ATCC 13883

MGH78 578

26 31 5

0 12 12

30 37 7

28 36 8

38 38 0

40 40 0

OMP analysis and sequencing

OMP analysis showed that both K1 and K2 lacked a major OMP of around 40 kDa, assumed to be OmpK35, when compared with the profile of ATCC 13883. K2 was also shown to lack another protein of around 36 kDa, compatible with OmpK36 (Fig. 2). The sequencing of ompK35 and ompK36 from K1, K2 and ATCC 13883 revealed a number of mutations in both genes when compared with ATCC 13883 but identical sequences between the two strains. Therefore the 36 kDa protein found lacking in K2 cannot be

FIG. 1. The pulsed-field typing of K1 and K2 after digestion with XbaI.

b-Lactamase detection

Both strains were shown to contain the b-lactamases CTXM-15, OXA-1, TEM-1 and SHV-1, but no carbapenemases were detected. The modified Hodge test showed no indication of carbapenemase activity.

FIG. 2. A section of an SDS PAGE gel showing the major OMPs in K1, K2, ATCC 13883, MGH78578, an MGH78578 meropenem mutant and a K1 meropenem mutant. NB, nutrient broth; LB, LuriaBertani broth.

ª2011 The Authors Clinical Microbiology and Infection ª2011 European Society of Clinical Microbiology and Infectious Diseases, CMI, 18, 140–146

144

Clinical Microbiology and Infection, Volume 18 Number 2, February 2012

explained by the mutations found in the ompK36 gene sequence. Mutation studies

Both K1 ertapenem and meropenem mutants were shown to exhibit a similar resistance and identical OMP phenotype to that of K2 (Table 2 and Fig. 2). MGH78578 meropenem mutants exhibited porin loss similar to that of the K1 mutants and K2 strain, and showed an increase in MICs of ertapenem from 0.25 to 1 mg/L. An increase from 0.25 to 0.5 mg/L was observed in the MIC of imipenem and an increase from 0.125 to 0.5 mg/L was observed in the MIC of meropenem. It is unlikely that porin loss alone can be responsible for the carbapenem resistance exhibited by K2. RT-PCR

RT-PCR analysis of K1, K2 and ATCC 13883 showed that ramA and acrA were upregulated in both K1 and K2. This suggests that much of the MDR phenotype exhibited by both K1 and K2 may be attributed to active efflux mechanisms. Analysis of the OMP gene expression showed that ompK35 was not expressed in either strain and ompK36 was expressed at similar levels in each strain (Fig. 3). This suggests that the OMP absent in both K1 and K2 was indeed OmpK35 and that the absence of OmpK36 in K2 may be due to a post-transcriptional process. It is likely that ompK35 expression is inhibited as a consequence of ramA overexpression, as has been found previously [26]. ramR sequencing

The sequencing of ramR, the repressor gene of ramA, revealed that both K1 and K2 contained identical mutations, which resulted in a premature stop codon at amino

FIG. 3. The expression of the selected genes in K1, K2 and ATCC 13883. NB, nutrient broth; LB, Luria-Bertani broth.

CMI

acid position 83. RamA is a known regulator of the AcrAB efflux pump; therefore the ramA and subsequent acrA overexpression are likely to be attributable to this mutation [27]. Transconjugation studies and plasmid profiling

K1/J62-2 transconjugants were obtained by selection with rifampicin and gentamicin, but no transconjugants were obtained with ceftazidime or meropenem. Susceptibility testing showed that the transconjugants were resistant to gentamicin and ceftazidime but not to carbapenems. PCR analysis of the transconjugant strains showed that the transferred plasmid contained CTX-M-15, TEM-1 and OXA-1 b-lactamases. No K2/J62-2 transconjugants could be obtained. S1 nuclease plasmid profiling showed that K1 and K2 both contained plasmids of c. 194, 97 and 70 kb, and K1 also appeared to have an additional plasmid of <48 kb that was not present in K2. Analysis of the transconjugant strains showed that the plasmid of c. 97 kb had been transformed into the recipient strain, indicating that CTX-M-15, TEM-1 and OXA-1 b-lactamase genes are present on the same plasmid. The ability to select for the transconjugants with gentamicin indicates that the plasmid additionally carries an aminoglycoside resistance determinant.

Discussion Although the production of dedicated carbapenemases is often viewed as the primary cause of carbapenem-resistant K. pneumoniae infections, this study has shown that carbapenem resistance resulting in failed therapy is possible in the absence of such enzymes. The importance of permeability changes and the presence of b-lactamases, not normally associated with carbapenem resistance, may have been underestimated regarding their importance in conferring levels of resistance that can be detrimental to infection treatment. It has previously been suggested that CTX-M-15 may be capable of contributing towards carbapenem resistance through the hydrolysis of ertapenem, which this study supports [5]. The reduced ertapenem susceptibility levels observed in strain K1 could be attributed to the presence of the plasmid-borne b-lactamase, CTX-M-15. Although the strain in question additionally contained other b-lactamase genes (OXA-1, TEM-1, SHV-1), only the CTX-M-15 b-lactamase has previously been reported to exhibit a degree of carbapenemase activity and, in this case, it seems likely that CTX-M-15 b-lactamase plays a contributory role in exerting the carbapenem-resistant phenotype, specifically to ertapenem.

ª2011 The Authors Clinical Microbiology and Infection ª2011 European Society of Clinical Microbiology and Infectious Diseases, CMI, 18, 140–146

CMI

Findlay et al. Development of carbapenem resistance during therapy

The contribution of efflux mechanisms to carbapenem resistance is currently a disputed topic, although efflux undoubtedly plays an important role in conferring the MDR phenotype displayed by the isolates in this study [11,28]. Although the precise effect of active efflux in exporting carbapenems from bacterial cells remains unknown, the upregulation of the transcriptional activator ramA and subsequently the RND family efflux pump gene, acrA, present in both strains, may contribute to the high ertapenem MICs exhibited. Resistance to ertapenem has been associated with a combination of efflux mechanisms and permeability changes in a study of clinical strains of E. cloacae [9]. It is possible that ertapenem may be a suitable substrate for this efflux system. Expression of the major OMPs is certainly an important factor for the access of various classes of antibiotics into the bacterial cell and it appears that in K. pneumoniae, OmpK36 is of particular importance for carbapenem permeability. The absence of this porin alone was shown to confer intermediate resistance to ertapenem and reduce susceptibility to meropenem in the control strain MGH78578, and the absence of this porin appears to be the sole factor in the conversion of K1 into K2. These results suggest that OmpK36 acts as the primary channel for the passage of ertapenem and meropenem but not for imipenem. It has been shown that imipenem is capable of penetrating the bacterial cell wall faster than meropenem [29], probably due to a combination of its zwitterionic charge and smaller size, and this may allow imipenem to penetrate other porins that meropenem and ertapenem cannot. No carbapenemases were found in either K. pneumoniae strain despite being subjected to PCR detection using primers for all known carbapenemases found in Gram-negative bacteria. This finding alongside the maintained imipenem susceptibility in K2 suggests that a carbapenemase is not responsible for conferring the observed phenotype but rather a combination of the aforementioned resistance mechanisms. Perhaps the most important feature to note is the ease by which porin-deficient mutants could be selected, particularly with ertapenem, which could inadvertently make any subsequent therapy with meropenem less effective or even defunct. Such findings are particularly worrying when considering that, in the incidence of the spread of a similar K. pneumoniae clone, such infections would be untreatable in UK hospitals, where the only effective drugs, colistin and imipenem, are not typically used. This study demonstrates the interplay between different resistance mechanisms that are capable of achieving levels of carbapenem resistance, in the absence of a carbapenemase, that are sufficient to lead to therapy failure.

145

Acknowledgements This work was funded by an educational grant provided by Astra Zeneca Plc.

Transparency Declaration The authors have no conflict of interest to declare.

References 1. Hawkey PM, Jones AM. The changing epidemiology of resistance. J Antimicrob Chemother 2009; 64 (suppl 1): 3–10. 2. Paterson DL, Bonomo RA. Extended-spectrum b-lactamases: a clinical update. Clin Microbiol Rev 2005; 18: 657–686. 3. Nordmann P. Trends in b-lactam resistance among Enterobacteriaceae. Clin Infect Dis 1998; 27 (suppl 1): 100–106. 4. Yang D, Guo Y, Zhang Z. Combined porin loss and extended spectrum b-lactamase production is associated with an increasing imipenem minimal inhibitory concentration in clinical Klebsiella pneumoniae strains. Curr Microbiol 2009; 58: 366–370. 5. Girlich D, Poirel L, Nordmann P. CTX-M expression and selection of ertapenem resistance in Klebsiella pneumoniae and Escherichia coli. Antimicrob Agents Chemother 2009; 53: 832–834. 6. Kaczmarek FM, Dib-Hajj F, Shang W, Gootz TD. High-level carbapenem resistance in a Klebsiella pneumoniae clinical isolate is due to the combination of blaACT-1 b-lactamase production, porin OmpK35/36 insertional inactivation, and down-regulation of the phosphate transport porin PhoE. Antimicrob Agents Chemother 2006; 50: 3396– 3406. 7. Kohler T, Michea-Hanzehpour M, Epp SF, Pechere J-C. Carbapenem activities against Pseudomonas aeruginosa: respective contributions of OprD and efflux systems. Antimicrob Agents Chemother 1999; 43: 424– 427. 8. Masuda N, Ohya S. Cross-resistance to meropenem, cephems, and quinolones in Pseudomonas aeruginosa. Antimicrob Agents Chemother 1992; 36: 1847–1851. 9. Szabo D, Silveira F, Hujer AM et al. Outer membrane protein changes and efflux pump expression together may confer resistance to ertapenem in Enterobacter cloacae. Antimicrob Agents Chemother 2006; 50: 2833–2835. 10. Webber MA, Piddock LJV. The importance of efflux pumps in bacterial antibiotic resistance. J Antimicrob Chemother 2003; 51: 9–11. 11. Quale J, Bratu S, Gupta J, Landman D. Interplay of efflux system, ampC, and oprD expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob Agents Chemother 2006; 50: 1633–1641. 12. Bratu S, Landman D, Haag R et al. Rapid spread of carbapenemresistant Klebsiella pneumoniae in New York city: a new threat to our antibiotic armamentarium. Arch Intern Med 2005; 165: 1430– 1435. 13. Hidron AI, Edwards JR, Patel J et al. Antimicrobial-resistant pathogens associated with healthcare-associated infections: annual summary of data reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2006–2007. Infect Control Hosp Epidemiol 2008; 29: 996–1011.

ª2011 The Authors Clinical Microbiology and Infection ª2011 European Society of Clinical Microbiology and Infectious Diseases, CMI, 18, 140–146

146

Clinical Microbiology and Infection, Volume 18 Number 2, February 2012

14. Schjorring S, Struve C, Krogfelt KA. Transfer of antimicrobial resistance plasmids from Klebsiella pneumoniae to Escherichia coli in the mouse intestine. J Antimicrob Chemother 2008; 62: 1086–1093. 15. Ogawa W, Li DW, Yu P et al. Multidrug resistance in Klebsiella pneumoniae MGH78578 and cloning of genes responsible for the resistance. Biol Pharm Bull 2005; 28: 1505–1508. 16. Andrews JM. Determination of minimum inhibitory concentrations. J Antimicrob Chemother 2001; 48 (suppl 1): 5–16. 17. Miranda G, Kelly C, Solorzano F, Leanos B, Coria R, Patterson JE. Use of pulsed-field gel electrophoresis typing to study an outbreak of infection due to Serratia marcescens in a neonatal intensive care unit. J Clin Microbiol 1996; 34: 3138–3141. 18. Lee K, Chong Y, Shin HB, Kim YA, Yong D, Yum JH. Modified Hodge and EDTA-disk synergy tests to screen metallo-b-lactamaseproducing strains of Pseudomonas and Acinetobacter species. Clin Microbiol Infect 2001; 7: 88–91. 19. Gniadkowski M, Schneider I, Pałucha A, Jungwirth J, Mikiewicz B, Bauernfeind A. Cefotaxime-resistant Enterobacteriaceae isolates from a hospital in Warsaw, Poland: identification of a new CTX-M-3 cefotaxime-hydrolyzing b-lactamase that is closely related to the CTX-M-1/ MEN-1 enzyme. Antimicrob Agents Chemother 1998; 42: 827–832. 20. Park YJ, Lee S, Kim YR, Oh EJ, Woo GJ, Lee K. Occurrence of extended-spectrum b-lactamases and plasmid-mediated AmpC b-lactamases among Korean isolates of Proteus mirabilis. J Antimicrob Chemother 2006; 57: 156–158. 21. Ellington MJ, Kistler J, Livermore DM, Woodford N. Multiplex PCR for rapid detection of genes encoding acquired metallo-b-lactamases. J Antimicrob Chemother 2007; 59: 321–322.

CMI

22. Poirel L, Heritier C, Tolun V, Nordmann P. Emergence of oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae. Antimicrob Agents Chemother 2004; 48: 15–22. 23. Wu T-L, Siu LK, Su L-H et al. Outer membrane protein change combined with co-existing TEM-1 and SHV-1 b-lactamases lead to false identification of ESBL-producing Klebsiella pneumoniae. J Antimicrob Chemother 2001; 47: 755–761. 24. Domenech-Sanchez A, Martinez-Martinez L, Hernandez-Alles S et al. Role of Klebsiella pneumoniae OmpK35 porin in antimicrobial resistance. Antimicrob Agents Chemother 2003; 47: 3332–3335. 25. Barton BM, Harding GP, Zuccarelli AJ. A general method for detecting and sizing large plasmids. Anal Biochem 1995; 226: 235–240. 26. George AM, Hall RM, Stokes HW. Multidrug resistance in Klebsiella pneumoniae: a novel gene, ramA, confers a multidrug resistant phenotype in Escherichia coli. Microbiology 1995; 141: 1909–1920. 27. Hentschke M, Wolters M, Sobottka I, Rohde H, Aepfelbacher M. ramR mutations in clinical isolates of Klebsiella pneumoniae with reduced susceptibility to tigecycline. Antimicrob Agents Chemother 2010; 54: 2720–2723. 28. Grobner S, Linke D, Schutz W et al. Emergence of carbapenem-nonsusceptible extended-spectrum b-lactamase-producing Klebsiella pneumoniae isolates at the university hospital of Tu¨bingen, Germany. J Med Microbiol 2009; 58: 912–922. 29. Yang Y, Bhachech N, Bush K. Biochemical comparison of imipenem, meropenem and biapenem: permeability, binding to penicillin-binding proteins, and stability to hydrolysis by b-lactamases. J Antimicrob Chemother 1995; 35: 75–84.

ª2011 The Authors Clinical Microbiology and Infection ª2011 European Society of Clinical Microbiology and Infectious Diseases, CMI, 18, 140–146