In vivo transcription of bacteriophage φ29 DNA early and late promoter sequences

.I. Mol.

Riol.

(1986)

191,

191-197 -

In Viva Transcription of Bacteriophage 429 DNA Early and Late Promoter Sequences Rafael

P. Mellado,

Isabel Barthelemy

and Margarita

Salas

Centro de Biologia Molecular (CSIC- UAM) Universidad Aut6nomn, Canto Blanc0 28049 Madrid, Spain (Received

16

Novem.ber

1986, and in revised form

21 April

1986)

The in wivo transcription initiation sites of eight putative 429 promoters have been accurat,ely determined: seven of them correspond to early promoters, including the four main ones, and the other corresponds to the only late promoter found in viva. Comparison of the 429 promoter sequences with the consensus sequence for the Bacillus subtilis 043 in the recognition of the viral RNA polymerase suggests that the a43 enzyme is involved early promoters, whereas the late promoter sequences share homology with the consensus sequence only at. its - 10 region.

1. Introduction

and

The in vivo transcription initiation sites of 429 DNA have been localized in the viral genome by nuclease S1 mapping experiments (I. Barthelemy, M. Salas & R. P. Mellado, unpublished results). Early 429 transcripts beginning at positions close t,o the Bacilk subtilis RNA polymerase binding sites Al, A2, A3, BI, B2, Cl and C2 (Sogo et aZ., 1979) have been found, as well as an early transcript that starts close to the AlTV Escherichia coli RNA polymerase binding site (Sogo et al., 1984). Late viral transcription begins at a single site near the B. subtilis RNA polymerase binding site A3 (Sogo et al., 1979); see also Figure 1. A good correlation between in a&o and in vivo transcription initiation was generally obtained, except that no in vitro transcription initiation has been reported at or near the AlIV site. 429 DNA sequence data are available for the first 5708 hase-pairs from the left end of the viral genome (Yoshikawa & Ito, 1982) and for the last 2216 hase-pairs from the right end of the phage DNA (Garvey et al., 1985). The known DNA sequences cover practically the entire early region of the genome and include all the in vivo transcription initiation sites identified by nuclease S, mapping at the viral genome except the two early sites close to the Bl and B2 positions (Barthelemy et al., unpublished results). In this paper, the precise locations of some of the in viva 429 transcription initiation sites have been determined. 429 early promoter sequences at the - 10 and - 35 regions comprise TATAATT ( - 10) t Hyphens

have

been

omitted

from

sequences

sequences, recognized by the polymerase. The 429 late includes a TATAAT sequence lacks the -35 consensus account of some of these (Salas et aE., 1985).

2. Materials and Methods (:L) Bacteria

and bacteriophage and enzymes

strains:

reagents

H. subtilis 1lONA trp- spoA su- was used as host for the bacteriophage d29 growth. Restriction endonucleases were from New England Biolabs, nuclease S1 from PL Biochemicsls, guanylyl transferase from Bethesda Resea,rc?h Laboratories, calf intestinal alkaline phosphat,ase, bacteriophage T4 polynucleotide kinase and the large fragment of the E. coli DR;A polymerase I (Kleuowenzyme) from Boehringer-Mannheim. [y-32P]i1TP (x3000 Ci/mmol), [a-32P]dATP (~400 Ci/ mmol) and [cL-~*P]GTP (x400Ci/mmol) were from Amrrsham Tnternational.

(b)

Preparation

and

labelling

of nucleic

acids

429 DNA was prepared as described by Sogo et al. ( 1979). Total RNA was isolated from 429-infected cells in either the presence or absence of chloramphenicol and then 5’-end-labelled with guanylyl transferase and [u-~*P]GTP as described (Christie & Calendar, 1983). 1,abelling of DNA fragments at their 5’ termini with polynucleotide kinase and [Y-~‘P]ATP, and at their 3’ ends with [a-32P]dATP and the Klenow enzyme was as described (Escarmis & Salas, 1981). Double and singlestranded DNAs were purified by diffusion from polyacrylamide gels.

for

191 $03.00/O

( -35)

promoter. which also at the - 10 region, sequence. A preliminary results has been given

clarity. 0~~-~836/S6/lSOlQl~,7

TTGACA

I,‘. subtilis 043 RNA

0

1986 Academic

Press Inc. (London)

Ltd.

K. I’. :I/lellado

192

et al.

(0) early genes A

% L

I

MA

23

456

7

8

8.5

9

IO

II

12

13

I4

I5

16

17

H

(bl 260 I58 I

8 427

378

855

996

654

IA’

I I I

/ B m Al F

r

986

I Cl

/‘i ~Alln G

/

/

/-

\ M

K H f?It A2flA3 / \ /A \

E

t

Jt

D

[ 81 H

K

6

J

/

\ N’ \ f+ F* 162

A

t

D

E

I

I

C MC; I

ti c2

c

Figure 1. 429 DNA fragments used in the Si mapping experiments. (a) The genetic and in viwo transcriptional maps of 429 are summarized. (b) The physical maps for the Hind111 (t) and HpaII (4) endonueleases are depicted. Extensions show the HinfI (7) sites in the Hind111 B fragment, the EcoRI (p) and A&III (T) sites in the Hind111 C fragment and the MnZI (7) sites in the Hind111 H fragment. Black dots inside the map followed by capital letters indicate the B. subtilis and E. coli RNA polymerase binding sites (Sogo et al., 1979. 1984).Letters outside the map are the Hind111 (above) or HpaII (below) fragments. Numbers at t’he extensions are the sizes of the subfragments in basepairs.

(c) S, mapping

and DNA sequence analysis

Conditions for the protection of 5’-end-labelled DNA or R,NA to the S1 digestion were as described (Christie & Calendar, 1983). DNA sequencing reactions were as described by Maxam & Gilbert (1980) with some modifications (Escarmis & Salas. 1982).

3. Results (a) Early

transcripts initiating at the Al A II I: sites and within the Hi&Z11 K fragment

To map more accurately

and

the 5’ end of the

mRNAs initiating in vivo at or near the Al and AlIV RNA polymerase binding sites (Barthelemy et al., unpublished results), the 5’-end-labelled oligo-

at 166 (Al) and 310 (AlIV) nucleotides, respectively, from the left ends of the above subfragments were found (Fig. 2(a) and (b)). An oligonucleotide 132 baseslong from the 5’ end of the early strand from the Hind111 K fragment was protected from S, digestion by hybridization to early mRNA, as determined when run on a denaturing polyacrylamide gel side by side with a, set of sequencing reactions (Fig. 2(c)). All the sizes of the protected oligonucleotides in these and the following experiments were corrected by the 1*5nucleotide difference in mobility between deoxynucleotides generated by S, cleavage and those generated by chemical sequencing reactions (Sollner-Webb & Reeder. 1979).

nucleotides protected from S, digestion by the early mRNA Hinff

initiating

within

(b) 429 transcripts HindIII

the 260 and 672-base-pair

subfragments from fragment Hind111 B (Fig. l), respectively, were run on a denaturing polyacrylamide gel parallel to the nucleotides resulting from the chemical cleavage of a set of sequencing reactions. Transcription initiation sites

initating within

the

H fragment

The length of the 5’-end-labelled 346 base-pair subfragment, from fragment Hind111 H (Fig. 1) protected by hybridization to early 429 mRNA was determined by fractionation on deMnZI

429 Early and Late Promote,r Sequences G 2

193

T G

T c

T

f AG:Cb

c

: AG:

c

132

-310

(0)

(b)

(cl

Figure 2. Precise location of the transcripts initiat.ing close to the Al and AlIV binding sites. (a) and (b) Transcription initiation within the 260 (Al) and 672 (AlIV) base-pair HinfI subfragments, respectively, from fragment HindIIT B (see Fig. 1). (e) Transcription initiation within the HindIII K fragment. The indicated sequencing reactions are from the early strand of the EcoRI-Aha111 subfragment from: (a) and (b) fragment Hind111 C; and (c) the early strand of the Hind111 F fragment. Lanes a, b and c: products of digestion with nuclease S, after hybridization of the early strand of each fragment with RNA extracted at 15 min (lane a). 30 min (lane b) and 15 min (lane c). from cells infected with 429 in the presence of chloramphenicol. Electrophoresis was in (a) and (b) 6”h and (c) S?, acrylamide/S Murea gels. In Figs 2. 3, 4 and 6 lengths are given in nucleotides.

oG

346

G + A

T + C

G + C

bA

G

T + C

C

:: GACC

c

-

714212-

(a)

(b)

(c)

Figure 3. Precise location of the transcripts initiating within the Hind111 H fragment. (a) and (b) Early strand from the 346 base-pair M&I subfragment from the Hind111 H fragment (see Fig 1). (c) Hind111 H fragment late strand. The indicated sequencing reactions are from: (a) the Hind111 F fragment early strand; (b) the 346 base-pair &MI subfragment late strand; and (c) the Hind111 H fragment late strand. Lanes a, b and c: products of digestion with nuclease S, after hybridization of the early strand from the MnZI subfragment (lanes a and b) and the late strand from the Hind111 H fragment (lane c), with RNA extracted 30 min after R. subtilis infection with $29 in the presence (lanes a and b) or absence (lane c) of chloramphenicol. Electrophoresis was on 8?0 acrylamide/8 M-urea gels.

194

R. P. Mellado

1 aA

G

T + CC

T

G

et al. initiating within the IIilLdITT H fragment upst,ream from the 346 base-pair MnlI subfragment, as shown when the early strand from the Hind111 H fragment was used (Barthelemy of al., unpublished result’s). The 5’.end-labelled oligonucleot’ide from t,hr Hind111 H fragment strand protected from S, digestion by late mRNA was run on a. denaturing polyacrylamide gel alongside the nucleotides produced in the sequencing reactions carried out on the 5’-end-labelled N&d111 H late strand. Several protected bands indicating a transcription start point close to the A3 binding site and around the nucleotide 78 from the 5’ end of the HindTII H late strand were observed (Fig. 3(c)). t,ranscription

biGL

244-

122 I2 I

(c) $29 transcripts

(a)

(b)

Figure 4. Preciselocation of the transcripts initiating close to the B2 and (:I binding sites. (a) and (b) Transcription initiating within (a) the Hind111 F fragment or (b) the EcoRI-AhaIII subfragmentfrom the Hind111 C fragment (see Fig. 1). The indicated sequencing reactions are in both cases from the earl? strand of the E’coRI-AM11 subfragment.Lanesa and b: products of digestionwith nuclease6, after hybridization of the early strand from (lane a) the Hind111 F fragment, and (lane b) the EcoRI-&a111 subfragment. with RNA extracted 15 min after infection of B. subtilis with 429 in the presence of chloramphenicol. Electrophoresis was on Go;, acrylamide/8 M-Urea gels.

naturing polyacrylamide gels side by side with the nucleotides resulting from sequencing reactions. Figure 3(a) and (b) shows protected bands indicating a transcription start point at’ 212 to 214 nucleotides and at 117 to 118 nucleotides, respectively, from the 5’ end of the early strand of the 346 base-pair MnZI subfragment. These initiation sites are close to the A2 binding site where about 570 and 470 nucleotides, respectively, were protected when Ohe entire early strand from the Hind111 H fragment was used in S, mapping experiments (Barthelemy et al., unpublished results). In addition, an oligonucleotide of 346 bases, the subfragment size, was also prot,ected (Fig. 3(a)), confirming the existence of 429 early

.

‘

.

initiating Cl sites

at the Bd and

The 5’-end-labelled oligonucleotides protected from S, digestion by early mRNA initiating close to the B2 and Cl binding sites were run on denaturing polyacrylamide gels parallel to the nucleotides resulting from sequencing reactions. Figure 4(a) shows the two main prot’ect,cd bands for RNA t’hat initiated at 121 to 122 nucleotides from the left, 5’ end of the early strand from the 429 DNA HindTII F fragment, where the B2 site is located. Figure 4(b) shows the localization of the main early mRNA start site at 244 nucleotides from the 5’-end-labelled left end of the early strand from the EcoRT-AhaTIT subfragment from fragment IIindIII C, which includes the Cl site (Fig. I). The transcription initiation site for the Cl promoter has been recently located (Dobinson & Spiegelman. 1985) three nucleotides downstream from that reported here.

(d) Sequence

?f the left end of the HindIf F fragwbent

Since the known 429 DNA sequence from the right end of the genome extends only t,o the right half of the HindITT F fragment. the sequencing of the left half of this fragment, where the early transcription initiation site f32 is located (Barthelemy et al.. unpublished results), was carried out to an extent that permit,ted the inference of the B2 promot’er sequence (see below). Figure 5 shows the sequence of the first 170 nucleotides from the left end of the Hind111 F fragment labelled at the 5’ or 3’ end and sequenced as indicated in Materials and Methods. .

.

YO

TCCCTTTCGCTGTTCCTTTCCCTGCGGGT~ACCCCTATTATACACGGTTTATACGGCTTTGTGTGTATCGGAAATATATT... AGGGAAAGCGACAAGGAAAGGGACGCCCAATGGGGATAATATGTGCCAAATATGCCGAAACACACACATAGCCTTTATATAA...

Figure 5. Nucleotide sequence of the left end of the 429 DNA Hind111 F fragment. The 170 nucleotides from both DXA strands at the left end of the Hind111 F fragment are shown. Sequencing reactions were as indicated in Materials and Methods.

$29 Early and Late Promoter Sequences

G

G + A

T + C

C

a

bG

G + A

T + C

C

195

(Fig. 6(a)). This small difference could be due to the fact that the labelled mRNA contains an extra GMP residue added to its 5’ end through a 5’ to 5’ triphosphate bridge, as a result of the 5’.endlabelling reaction with guanylyl transferase.

4. Discussion Eight different 429 in vice transcription initiation sites: from the nine identified by S, mapping experiments (Barthelemy ef al., unpublished results), have been precisely mapped on the $29 genome. Clust,ers of 5’.end-labelled protected oligonucleotides instead of single ones were normally visualized in the denat,uring polyacrylamide gels as a result of S, digestion. This S, nibbling effect has been observed previously (Christie & Calendar, 1983, 1985), although the existence of some ambiguity in the initiation of the 429 DNA transcription in viva cannot be excluded. The fine mapping of the 5’ termini from the 429 mRNAs made i,n viva has enabled us to search at the DNA level for putative sequences that could modulate the synt’hesis of such mRNAs. A comparison of the DKA sequences upstream from the transcription initiation sit,eswit’h t,he consensus promoter sequences of cr43 RXA polymerase from B. wbtilis is presented in Figure 7. (0)

( b)

Figure 6. Precise location of the transcripts initiating within the Hind111 L fragment. (a) Location of the 5’ end of the oligodeoxynucleotide protected from S, digestion by hybridization of the early strand from the S-endlabelled Hind111 I, fragment with RNA isolated 15 min after infection with $29 (lane a), alongside the indicated sequencing reactions from the RsaI-Hinff fragment spanning from nucleotides 2761 to 3538 in the 429 genome (Yoshikawa 8: Ito. 1982). (b) 5’-end-labelled mRNA protected from Si digestion by hybridization to the H&d111 L fragment early strand (lane b) alongside the indicated sequencingreactionsfrom the late strand of the Hind111 F fragment. Electrophoresis was on 6qib acrylamide/8 M-urea gels.

(e) 429 transcripts initiating at the C’2 site An initiat’ion site located at 114 to 115 nucleotides from the 5’-end-labelled early strand from the Hind111 L fragment was observed (Fig. 6(a)) when the oligonucleotide protected from S, digestion by hybridization to 429 mRNA was fractionated on a polyacrylamide denaturing gel side by side with the nucleotides resulting from the chemical cleavage of sequencing reactions. The 5’-end-labelled oligoribonucleotide protected by hybridization with t,he Hind111 L fragment early strand (Barthelemy et al., unpublished results) was run alongside a set of sequencing reactions. Two oligoribonucleotides of 117 and 118 baseslong were mainly protected (Fig. 6(b)); these sizes are slightly larger than the 114 and 115 bases estimated for the protected oligodeoxynucleotides

(a) 429 early promoters The first four promoter sequences depicted in Figure 7 correspond to the transcripts initiating close to the Cl and C2 sites and to the transcripts start,ing at 212 to 214 and 117 to 118 nucleotides from the left end of the 346 base-pair MnlI subfragment. from fragment Hind111 H (Fig. l), considered to be strong promoters (Barthelemy et al., unpublished results). As a general rule, we will name the 429 promoters as the in citro B. subtilis RXA polymerase binding sites. If more than one transcript is initiated around a particular binding site, the respective promoter will be identified by the name of the binding site followed by a small letter indicating, in alphabetical order, position in the direction of t’ranscription.

its relative Thus, the

four promoters mentioned above will be named Cl, (“2. A2b and A2c, respectively. As shown in Figure 7 there are sequences related to the TATAAT consensus sequence recognized by the B. subtilis a43 RNA polymerase around the - 10 regions of the four promoters. An homologous sequence coinciding in 11 out of 12 nucleotides, comprising the - 10 promoter region and finishing at or near the + 1 position, is the more relevant feature for the Cl and C2 promoters. At the -35 region sequences closely related to the -35 TTQACA

consensus

sequence

recognized

by the cr43

RKA polymerase could be derived for the Cl, C2, A2b and A2c promoters. The sequence CAAA, and more often ACAAA, appears repeated also around the -35 region for the Cl, C2 and A2b promoters. The

sequence

for

the

early

Al.

AlTV

and

B2

K. 1’. Mellad

196

-35 TTGACA

crA3consensus

et al. -10 TATAAT

Cl-early

TTAATCAACGTTTACAAAGTGAACAGGAAGG~GTGTTA~CTATATAGAGACACAGCGGACATA --------4----

CZ-early

CGAAAAGGGTAGACAAACTATCGTTTAACATGTTATACTATAAT~~GTAAGGTAATAAG -----------W--*-4-4---

AZb-early

AAAAAAGTCTTGCAAAAAGTTATACAGGTGTGGTTAARTAGAG~~AGAC~C~CCTT -----P-B

AZc-early

TAGAAAAGTGTTGAAAATTGTCGAACAGGGTGATATAATAAAAGAGTAGAAGAGATACAGA -------

B2-early

ATTTCCGATACACACAAAGCCGTATAAACCGTGTATAATAGGGG~CCCGCAGGG~GG -m-s ----m--+-et-

Al -early

CTATTAATGTTTGACAACTATTACAGAGTATGCTATAATGGTAGTATCAATGGTACGGTAC -----BP---+-+*-4---

AlIV-early

GGACAATGGTACATGATTGATATATGTTTAGGCTACAAAGGGPAA~AGATACATACAG -------h ---+

?29-early

consensus

TTGACAAA

A3-late

TGNTANAATAG

CCACAAATCCTTATGTATCAGGGTTCACGTGGTATAATT~GTAGTACTAATAGATTATA ---w

Figure 7. 429 early and late promoter sequences. Wavy lines indicate the initiation sites and transcription. Continuous lines under sequences denote t’hose in the 429 promoters t’hat correspond to sequences recognized by the R. subtilia RNA polymerase a43 subunit,. Broken underlines show regions among the different early promoters from which the - 35 and - 10 early 429 consensus sequences have Arrows below the sequences indicate the existence of dyad symmetry.

promoters, considered to be weak (Barthelemy et unpublished results), are also shown in Figure 7. At the - 10 region of the B2 promoter a perfect consensussequence is found, and at the - 35 region the last base of the TACACA sequence overlaps the ACAAA motif. The Al and AlIV promoter sequencesaround the - 10 region match in 10 out of 13 bases. The sequence ACAA overlaps by three basesthe TTGACA sequence in the -35 region of the Al promoter. There is no ACAAA-like sequence in the - 35 region of the AlIV promoter and a TTGACA-like sequence is only 11 nucleotides away from the - 10 consensussequence. Considering together all the 429 early promoters mentioned, the common sequences TTGACAAA and TGNTANAATAG could be derived for the -35 and -10 region, respectively (Fig. 7). The homology among the Cl, C2, A2b and A2c promoters at, their respective - 10 regions, al.,

particularly suggests

between

the

Cl

and

C2 promoters.

role for these sequences in the recognition of the 429 main early promoters by R. s&i&s 043 RNA polymerase. In fact, it is not a

4 direction of the consensus of homology been derived.

infrequent to find the TGN sequence preceding the TATAAT sequence in several B. subtilis a43 promoters (Doi, 1984), as occurs in the $29 early promoters. Regions of dyad symmetry can be spotted in most of the 429 promoters (Frg. 7). and in the Cl, C2 and A2c promoters the sequences AACA and TGTT are involved in such symmetry. Nevertheless, the role played bv the inverted repeats in the in viva 429 transcription initiation, if any, remains to be determined. The Al and B2 promoters, from which no in viz10 5’.end-labelled mRNA was found (Barthelemy et al., unpublished results), might eventually function in viva, since their promoter sequences can be aligned with those of the Cl, C2, A2b and A2c strong early promoters, but their transcripts either are made in relatively small amounts or their halflives are too short to be detected when the 5’ ends of in zivo early mRNA are radioactively labelled. A possible regulatory role for the B2 transcripts has been considered (Barthelemy et al., unpublished results). The Al promoter is not efficient either in vitro (Sogo et al., 1984) or in viva, which is

429 Early and Late Promoter Sequences surprising because of its perfect consensus - 35 and - 10 regions and 17 base-pair spacing. On the other hand, there are no known 429 genes that could be transcribed from it, with the exception of a DNA sequence coding for a small polypeptide, about 30 amino acids long, as inferred from the DNA sequencing data (Yoshikawa & Ito, 1982). This particular DNA sequence can also be transcribed in vivo from the A2b or A2c upstream promoters, since transcription from the A2b start point proceeds down to the left end of the 429 genome (unpublished results). The AlIV promoter might not function in viva since, although there is a consensus-like sequence in the - 10 region, the spacing with the TTGACA-like sequence is only 11 base-pairs. From a comparison of the sequence features observed upstream from the early transcription initiation sites in the 429 genome with those corresponding to the transcript initiating within the Hind111 K fragment, from which no homologous promoter sequencescan be derived (not shown) and a 5’-end-labelled mRNA initiating at this particular site was not found (Barthelemy et al., unpublished results), we conclude that the above transcript is most probably due to 5’-end-labelled DNA protection from Si digestion by RNA preferentially cleaved at this position.

197

1979) could act either as a a-like factor or as a positive activator enhancing transcription from the A3 promoter. A correlation between in vivo and in vitro 429 transcription initiation needs to be made to assess whether the same or different promoter sequences are used in both cases.In particular, the study of in vitro transcription from the late A3 promoter will help in the understanding of how 429 late transcription is controlled. This investigation has been aided by Researchgrant 5 ROl GM27242-06from the National Institutes of Health. by grant no. Desarrollo de a Grant from the recipient Council.

3325 from the Comision Asesora para el la Investigation Cientillca y Tecnica and by Fondo de Investigaciones Sanitarias. I.B. is of a Fellowship from the Spanish Research

References Christie, G. E. & Calendar. R. (1983). J. &‘o1. Biol. 167, 773-790. Christie, G. E. & Calendar, R. (1985). J. ~Wol. BioZ. 181, 373-382. Dobinson, K. F. & Spiegelman, G. B. (1985). J. Biol. Chem.

Doi.

260,

595Cb5955.

R. H. (1984). In Genetic Engine&ng Biotechnology and Genetic subtilis.

i)2 Bacillus Engineerin.g

vol. 2, pp. 121-155,Intercept Ltd. C. & Salas, M. (1981). Proc. ,Vuf. Acad. Aci., I!.S.A. 78 14461450. Escarmis, C. 6 Salas, M. (1982). ,Vucl. .4rids lies. 10. 5785-5798. Garvey, K. J.. Yoshikawa, H. d Ito. J. (1985). Gene, 40, 30 l-309. Maxam. 8. M. & Gilbert. W. (1980). Methods Enzymol. 65, Reviews,

Escarmis,

(b) The 429 late promoter The sequence for the 429 late promoter, A3, is also shown in Figure 7. At the - 10 region, the TGGTATAATTA sequence shares some homology with the TGNTANAATAG sequence derived from the early 429 promoters and includes the TATAAT consensus sequence for the a43 RNA polymerase. No sequence homology could be found at the -35 region, where the ACAAA motif is also lacking. The existence in the late A3 promoter of sequences sharing homology with the - 10 consensussequence recognized by the B. subtilis a43 RNA polymerase may explain why this promoter could function in vitro as an RNA polymerase binding and transcription initiation site. The viral protein p4 that controls 429 late transcription in vivo (Sogo et al..

499-560.

Salas. M.. Barthelemy, I. & Mellado. R. P. (1986). In Genetics and Biotechnology of Bacilli (Ganesan. A. T. & Hoch, ,J.. eds), Academic Press. Pr’rw York and London, in the press. Sogo. J. M.. Inciarte, M. R., Corral, J.. Vinuela. E. & Salas. M. (1979). J. Mol. Biol. 127, 411-436. Sogo, J. M.. Lozano. M. & Salas. M. (1984). XWI. Acids Res. 12. 194331960. Sollner-Webb. B. & Reeder, R. H. (1979). (‘rll, 18, 485 499. Yoshikawa. H. 8r Ito. *J. (1982). Gene. 17. 323-335.

Edited by M. E. Gottesman

Note added in proof. In Figure 5, at position 119-121, sequence from position 118 to 122 reads GTTTA, V. PaEes (personal communication).

there is an additional T. A base-pair. so that the in agreement with the results of C. Vliek and