Increased risk of metabolic syndrome with genetic polymorphism of ADIPOQ among a Temiar population in Malaysia

Meta Gene 24 (2020) 100653

Contents lists available at ScienceDirect

Meta Gene journal homepage: www.elsevier.com/locate/mgene

Increased risk of metabolic syndrome with genetic polymorphism of ADIPOQ among a Temiar population in Malaysia

T

Mohd Nizam Zaharya, Nur Sakinah Haruna, Norhaslinda Ridzwana, Mimie Noratiqah Jumlia, Mohd Adzim Khalili Rohina, Rosliza Yahayab, Nik Ahmad Shaifuddin Nik Himb, ⁎ Azizul Fadzlin Wan Jusohb, a b

Faculty of Health Sciences, Universiti Sultan Zainal Abidin, Gong Badak Campus, 21300 Kuala Nerus, Terengganu, Malaysia Faculty of Medicine, Universiti Sultan Zainal Abidin, Medical Campus, 20400 Kuala Terengganu, Terengganu, Malaysia

A R T I C LE I N FO

A B S T R A C T

Keywords: Metabolic syndrome Temiar Orang Asli community ADIPOQ +45T > G +276G > T

Metabolic syndrome (MetS) is characterised by increased blood pressure, elevated fasting blood glucose, increased triglycerides, reduced high-density lipoprotein cholesterol and central obesity. The cause is multifactorial and includes gene-environment interactions. ADIPOQ gene has been linked to its development, but results have been conflicting. The gene is expressed in adipose tissue and it encodes a protein that is involved with metabolic and hormonal processes. The objective of this study was to investigate the association between the genetic variants of the ADIPOQ gene (+45T > G and +276G > T) with MetS among a relocated indigenous Temiar subtribe community in Malaysia. This cross-sectional study investigated 123 relocated Temiar volunteers in Kelantan. Modified NCEP ATP III criteria were used to diagnose MetS. DNA was extracted from peripheral blood and genotyped for ADIPOQ +45T > G and +276G > T polymorphisms using Polymerase Chain ReactionRestriction Fragment Length Polymorphism (PCR-RFLP) technique. Associations between ADIPOQ +45T > G (rs2241766) and +276G > T (rs1501299) polymorphisms and MetS were investigated using a binary logistic regression analysis and calculations of odds ratios (ORs). Compared to the wild-type gene, the OR for the occurrence of MetS with heterozygous (T/G) was 87.2 and with homozygous (G/G) genotype was 26.5 at the ADIPOQ +45T > G locus. Similarly, the OR was 38.2 for heterozygous (G/T) and 19.7 for homozygous (T/T) at the ADIPOQ +276G > T locus. The genetic polymorphisms at the ADIPOQ +45T > G (rs2241766) and +276G > T (rs1501299) loci increased the odds for development of MetS among the relocated Temiar subtribe. The results have significant implications for primary prevention strategies to reduce risks for MetS.

1. Introduction Metabolic syndrome (MetS) is a significant risk factor for cardiovascular diseases. An increased blood pressure characterises it; elevated blood glucose; increased triglycerides; reduced high-density lipoprotein cholesterol; and central obesity (Kaur, 2014). Its prevalence is increasing worldwide as a result of increasing affluence. ADIPOQ is expressed in adipose tissue and encodes adipocyte-specific polypeptide hormone, adiponectin that circulates in the plasma. Adiponectin is involved with metabolic and hormonal processes. Mutations in ADIPOQ are associated with adiponectin deficiency implicated in MetS (Edwards et al., 2008)and Type 2 Diabetes Mellitus (T2DM) (Lillioja and Wilton, 2009). ADIPOQ is polymorphic. The variant ADIPOQ +45T > G (rs2241766) alters ADIPOQ expression by altering its RNA splicing

⁎

process and stability (Yang et al., 2003) and has been associated with insulin resistance, T2DM and MetS (Hara et al., 2002; Gu et al., 2004; Melistas et al., 2009; Ruan and Dong, 2016) as well as with obesity and other risks for MetS (Gupta et al., 2012; Ramya et al., 2013; Zaki et al., 2014; Ji et al., 2018). Furthermore, ADIPOQ +276G > T (rs1501299) variant was associated with obesity-related risks among young adults in Europe (Karmelic et al., 2012; Filippi et al., 2005) and with T2DM and MetS among Korean patients (Hwang et al., 2010). Our recent study among a Malaysian Aborigine sub-tribe, the Temiar's also found that serum adiponectin, a product of ADIPOQ, was negatively correlated with most of MetS criteria (Zahary et al., 2019). There however occurred inconsistent observations with associations between ADIPOQ and obesity, MetS and other associated conditions (Menzaghi et al., 2007; Henneman et al., 2010; Salmenniemi et al., 2005; Kalniņa et al., 2009; Berthier et al., 2005; Wang et al., 2009;

Corresponding author. E-mail address: [email protected] (A.F. Wan Jusoh).

https://doi.org/10.1016/j.mgene.2020.100653 Received 3 July 2019; Received in revised form 5 January 2020; Accepted 15 January 2020 Available online 17 January 2020 2214-5400/ © 2020 Elsevier B.V. All rights reserved.

Meta Gene 24 (2020) 100653

M.N. Zahary, et al.

III criteria suggested the cut-off points of waist circumference should be ethnic specific where individuals of Asian origin should use the cut-off of 90 cm in men and 80 cm in women. For NCEP criteria, abdominal obesity is a component of the syndrome but not a prerequisite for its diagnosis (Moy and Bulgiba, 2010).

Bostrom et al., 2009). Studies in several populations found no association between ADIPOQ +45T > G (rs2241766) polymorphism and T2DM and CVD (Bacci et al., 2004; Qi et al., 2006; Jung et al., 2006; Mohammadzadeh et al., 2016). In different populations, there may occur different gene-gene and gene-environment interactions resulting in variable results. The Temiar subtribe presents a unique opportunity to study geneenvironment interactions. Over the last decades, they have undergone relocation programs that exposed them to less friendly environments of modern living. We hypothesise that, with infrequent inter-marriages, their genetic materials are well preserved. While suited for their original habitats, they may be ill-prepared for the new environment, and the deleterious effects of the environment would be more discernible. The present study was therefore undertaken to investigate the association between the genetic polymorphisms of the ADIPOQ gene (+45T > G and +276G > T) with the risk of developing MetS among a Temiar subtribe in Malaysia.

2.3. Anthropometric measurements Weight and BMI were assessed in the upright position using an automated body composition analyser (Model HBF-36, Karada Scan, Bioelectrical Impedance principle, Omron, Japan). The analyser also provided body age, visceral fat content and resting metabolic rate. WC was measured to the nearest 0.1 cm using a non-stretchable measuring tape. Blood pressure (BP) was the average of two readings, 2 min apart on the right arm in a sitting position, using an automated and calibrated digital blood pressure monitor (Omron HEM-757, Japan). Subjects were advised not to smoke, exercise or eat for 30 min and not to climb stairs for 15–30 min, and were made to rest for at least 5 min before the measurements.

2. Materials and methods 2.1. Study subjects

2.4. Genotyping of ADIPOQ +45T > G (rs2241766) and +276G > T (rs1501299) polymorphisms

This study was approved by the UniSZA Human Research Ethics Committee (UHREC) at the Universiti Sultan Zainal Abidin (UniSZA) in Terengganu and complied with the Helsinki declaration of the World Medical Association (2013). Written permissions were also obtained from Jabatan Kemajuan Orang Asli (JAKOA, Department for Aborigines Development) and village heads. Voluntary participation was invited through the heads via the Jabatan Hal Ehwal Orang Asli (JHEOA, Department for Aborigines Affairs) and signed written informed consents. They comprised 123 members from a Temiar subtribe in Gua Musang in Kelantan, aged 18 years and above without psychiatric illness, neurological deficits or body dysmorphia. Before study commencement, participants were requested to fast for at least 8 h. They then completed a standardised interviewer-based socio-demographics questionnaire. Recorded were their ages, gender, marital status, highest educational level attained, working place, income, family medical history, and history of tobacco and alcohol consumption.

Genomic DNA was extracted from the venous blood that was collected from each subject using a commercial DNA extraction kit (QIAamp DNA Blood Mini kit [Qiagen, Hilden, Germany]). ADIPOQ +45T > G (rs2241766) and +276G > T (rs1501299) polymorphisms were detected employing Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP). Amplicons containing ADIPOQ genetic variants were amplified using appropriate primers (ADIPOQ45 FW: 5′ CTACACACAGGGAATAATGCTA 3′, ADIPOQ45 RV: 5′ TATCAGTGTAGGAGGTCTGTG 3′, ADIPOQ276 FW: 5′ GGGAGCTGT TCTACTGCTATT 3′, ADIPOQ276 RV: 5′ TCTTGTAGTAACCACCAAC AGA 3′) which generated 490 base-pair and 634 base-pair fragments respectively. PCR was performed in a volume of 20 μL consisting of 1.875 mM MgCl2 (Applied Biosystems, California, USA), 1 X GeneAmp PCR Buffer II (Applied Biosystems, California, USA), 0.375 mM dNTPs (Applied Biosystems, California, USA), 0.5 μM of each forward and reverse specific primers, 4 ng/μL of template DNA and 1 unit of AmpliTaq Gold DNA Polymerase (Applied Biosystems, California, USA). PCR was performed in 40 cycles, and cycling conditions included predenaturation at 96 °C for 5 min, denaturation at 95 °C for 1 min, at 50 °C for 1 min and 72 °C for 1 min. This stage was followed by a final extension at 72 °C of for 7 min on a Veriti™ 96-Well Thermal Cycler (Applied Biosystems, CA, USA). Amplicons were then detected by gel electrophoresis in a 2% agarose gel. Amplicons containing polymorphic sites +45T > G (rs2241766) and +276G > T (rs1501299) were then digested using BspHI and BsmI restriction enzymes (New England Biolabs Inc., Ipswich, MA, USA) for 15 min at 37 °C and 15 min at 65 °C respectively. For ADIPOQ +45T > G (rs2241766) polymorphism, the wild type T allele would be cleaved by BspHI. It produced two fragments (274 and 216 bp). The G allele would not be cleaved by BspHI (490 bp). Heterozygous genotype would show three fragments of 490, 274 and 216 bp sizes. Genotypes

2.2. Metabolic syndrome definition Metabolic syndrome was defined following the criteria provided by the modified NCEP ATP III. According to the modified NCEP criteria, the presence of any three of the following five factors is required for a diagnosis of MetS: (i) abdominal obesity, (ii) hypertriglyceridemia (triglycerides ≥1.7 mmol/L); (iii) low HDL cholesterol (HDL cholesterol ≤1.03 mmol/L for men and ≤1.29 mmol/L for women); (iv) elevated blood pressure (systolic blood pressure ≥ 130 mmHg and/or diastolic blood pressure ≥ 85 mmHg or current use of antihypertensive drugs); (v) impaired fasting glucose (fasting plasma glucose ≥5.6 mmol/L). A diagnosis of MetS required the fulfillment of at least any three criteria out of five criteria (Table 1). The modified NCEP ATP

Table 1 Metabolic syndrome defined by modified NCEP-ATP III used in the present study (Moy and Bulgiba, 2010). Risk factors

Modified NCEP-ATP III

Metabolic syndrome criteria: At least any three risk factors i. Abdominal obesity– WC Male: ≥90 cm, female: ≥80 cm ii. Hypertriglyceridemia ≥1.7 mmol/L or specific treatment for this lipid abnormality iii. Low HDL cholesterol Male: < 1.03 mmol/L, female: < 1.29 mmol/L or specific treatment for this lipid abnormality iv. Elevated blood pressure Systolic BP ≥ 130 and/or diastolic BP ≥ 85 mmHg or on treatment of previously diagnosed hypertension v. Impaired fasting glucose ≥5.6 mmol/L or previously diagnosed type 2 diabetes mellitus

WC: waist circumference, BP: blood pressure, HDL: high density lipoprotein. 2

Meta Gene 24 (2020) 100653

M.N. Zahary, et al.

2

1

3

4

M

2.5. Statistical analysis

490 bp

Chi-squared test was used to compare genotype frequencies for ADIPOQ+45T > G (rs2241766) and +276G > T (rs1501299) polymorphisms between MetS and non-MetS individuals. Odds Ratios (ORs) and 95% Confidence Interval (CI) were calculated using binary logistic regression (SPSS 18.0, IBM Corporation, Armonk, New York, USA) to evaluate the risk association between ADIPOQ +45T > G (rs2241766) and +276G > T (rs1501299) polymorphisms with MetS. All statistical tests were two-sided and p < .05 was considered statistically significant.

274 bp 216 bp

3. Results and discussion Of the 123 individuals recruited, 49 (39.8%) had MetS, and 74 did not. There were 37 males and 86 females. Their mean age ± SD for MetS subjects was 38.61 ± 12.65 (See also Table 2). The genotype frequencies of ADIPOQ gene variants are compared in Table 3 for subjects with MetS and without MetS. The association of socio-demographic and MetS criteria with MetS susceptibility risk among Temiar subtribe was analysed using simple logistic regression (Table 4). The ORs of developing MetS with ADIPOQ +45T > G (rs2241766) and +276G > T (rs1501299) were calculated against the wild type T/T at the +45T > G (rs2241766) locus and G/G at the +276G > T (rs1501299) locus. The OR was 87.2 (p < .01) for heterozygous (T/G) genotype, and 26.5 (P = .003) for homozygous (G/ G) genotype at the ADIPOQ +45T > G (rs2241766) locus. At the ADIPOQ +276G > T (rs1501299) locus, heterozygous (G/T) gave an OR of 38.2 (P < .001) and homozygous (T/T), 19.7 (P < .01) (Table 4). This study yielded some compelling results suggesting a role for ADIPOQ in MetS. ADIPOQ-expressed adiponectin has insulin-sensitising and anti-atherogenic effects. Located on the chromosome at locus 3q27, ADIPOQ polymorphisms have been associated with obesity, T2DM and related phenotypes (Siitonen et al., 2011). It has also been suggested to play a role in regulating glucose and lipid metabolism, insulin sensitivity and anti-atherogenic activity (Ruan and Dong, 2016). Its association with MetS have also been, therefore, extensively investigated (Hara et al., 2002; Gupta et al., 2012; Gable et al., 2006). A uniqueness of this study is the choice of subjects and setting. It investigated the genotype frequencies of ADIPOQ +45T > G (rs2241766) and +276G > T (rs1501299) polymorphisms and their association with MetS among relocated Temiar subtribe in Malaysia. In their original habitats, the Temiar's live in remote areas subsisting on forest gathering and wild-life hunting. Isolated, they tend to conserve their genetic make-ups inter-breed. With developments, such natural habitats are dwindling, and their livelihood comes under threat. They are thus relocated to modern areas that now expose to the ‘bad habits’ of modern living for which they may intrinsically be ill-equipped. The high odd ratios for MetS in association with ADIPOQ +45T > G (rs2241766) and +276G > T (rs1501299) polymorphisms (OR: 87.2 and 38.2 respectively) among them are compelling. The strongest association was observed with ADIPOQ +45T > G (rs2241766) polymorphism. The results suggested that individuals heterozygous for T/G and homozygous for G/G at the ADIPOQ +45T > G (rs2241766) locus have an eighty seven-fold and twenty six-fold higher risks for developing MetS respectively, compared to individuals without putative mutations. Similarly, individuals with heterozygous (G/T) and homozygous (T/T) genotypes at the +276G > T (rs1501299) locus had a thirty eight-fold and nineteen-fold higher risk for developing MetS, compared to individuals who carried the homozygous wild type genotype (G/G). ADIPOQ gene is located in the chromosomal region identified by genome-wide linkage analysis to be a susceptibility locus for MetS (Edwards et al., 2008) and type 2 diabetes (Lillioja and Wilton, 2009). Although ADIPOQ +45T > G (rs2241766) polymorphism is a silent

Fig. 1. Representative gel electrophoresis of PCR-RFLP analysis of ADIPOQ +45T > G (rs2241766) polymorphism. Lane: M, 100 bp marker; Lane 1, heterozygous genotype (490, 274 and 216 bp); Lane 2 and 3, homozygous variant genotype (490 bp); Lane 4, homozygous wild type genotype (274 and 216 bp).

1

2

3

4

M

634 bp 265 bp 256 bp 113 bp

Fig. 2. Representative gel electrophoresis of PCR-RFLP analysis of ADIPOQ +276G > T (rs1501299) polymorphism. Lane: M, 100 bp marker; Lane 1, heterozygous genotype (634, 265, 256 and 113 bp); Lane 2, homozygous wild type genotype (265, 256 and 113 bp); Lane 3 and 4, homozygous variant genotype (634 bp).

were then assigned as homozygous wild type (T/T), heterozygous (T/G) and homozygous variant (G/G) based on fragment sizes, as shown in Fig. 1. For ADIPOQ +276G > T (rs1501299) polymorphism, the homozygous wild type (G/G) would yield three fragments of 265, 256 and 113 bp with the T allele not being cleaved by BsmI and would, produce only a single 634 bp fragment. Heterozygous genotype would appear as four fragments of 634, 265, 256 and 113 bp sizes (Fig. 2). The genotyping results of PCR-RFLP analysis were validated by DNA sequencing. DNA sequencing was not carried out for all the samples. Therefore, two samples were selected from respective genotypes (homozygous wild type, heterozygous and homozygous variant genotype) of the two polymorphisms studied, were then subjected to DNA sequencing for validation purposes.

3

Meta Gene 24 (2020) 100653

M.N. Zahary, et al.

Table 2 Sociodemographic, anthropometric and MetS components characteristics of study subjects (n = 123). Variables

MetS

Non-MetS

n (%) Sociodemographic characteristics Gender Male Female Age (years) Anthropometry Height (cm) Weight (kg) BMI (kg/m2) MetS criteria WC (cm) Systolic BP (mmHg) Diastolic BP (mmHg) FBG (mmol/L) Fasting TG (mmol/L) Fasting HDL-C (mmol/L)

Mean ± SD)

n (%)

P-value Mean (SD)

0.057a,* 10 (20.4) 39 (79.6)

27 (36.5) 47 (63.5) 38.61 ± 12.65

35.04 ± 14.25

0.025b,*

149.8 ± 18.2 62.2 ± 14.07 31.6 ± 4.14

153.9 ± 13.03 60.4 ± 13.38 22.5 ± 3.19

0.152b 0.460b < 0.001b,*

91.5 ± 12.89 137.0 ± 21.23 90.4 ± 13.1 7.2 ± 3.37 1.9 ± 0.63 0.9 ± 0.35

74.9 ± 8.3 126.7 ± 18.15 81.3 ± 11.28 5.6 ± 2.02 1.3 ± 0.2 1.4 ± 0.23

< 0.001b,* 0.005b,* < 0.001b,* 0.001b,* < 0.001b,* < 0.001b,*

BMI: Body mass index, WC: Waist circumference, BP: Blood pressure, FBG: Fasting blood glucose, TG: Triglyceride, HDL-C: High density lipoprotein. a Chi-squared test, * P < .05 versus non-MetS. b Independent t-test, * P < .05, versus non-MetS. Table 3 Genotype and allele frequencies of ADIPOQ +45T > G (rs2241766) and +276G > T (rs1501299) polymorphism in study subjects (n = 123). MetS

Non-MetS

n = 49 (%)

n = 74 (%)

Table 4 Association of socio-demographic, MetS criteria, ADIPOQ +45T > G (rs2241766) and +276G > T (rs1501299) polymorphisms with MetS susceptibility risk among Temiar subtribe (n = 123).

P-value

Variables

Genotype Homozygous wildtype (TT) Heterozygous (TG) Homozygous variant (GG) Allele T G Genotype Homozygous wildtype (GG) Heterozygous (GT) Homozygous variant (TT) Allele G T

ADIPOQ +45T > G (rs2241766) 19 (38.8) 72 (97.3) 23 (46.9) 1 (1.4) 7 (14.3) 1 (1.4) 61 (62.2) 147 (99.3) 37 (37.6) 1 (0.7) ADIPOQ +276G > T (rs1501299) 14 (28.6) 69 (93.2) 31 (63.3) 4 (5.4) 4 (8.2) 1 (1.4)

< 0.001

59 (60.2) 39 (39.8)

< 0.001

142 (95.9) 6 (4.1)

Socio-demographic Age Gender Male Female BMI Mets criteria WC BP < 131/ < 86 > 130/ > 85 FBG HDL TG ADIPOQ polymorphism ADIPOQ45 TT TG GG ADIPOQ276 GG GT

< 0.001

< 0.001

mutation (Gly15Gly) in exon 2, ADIPOQ +45T > G (rs2241766) may affect ADIPOQ expression by altering its RNA splicing process and stability (Yang et al., 2003). This variant may affect the level and characteristics of adiponectin in blood, leading to insulin resistance, type 2 diabetes and MetS (Ruan and Dong, 2016). The G allele has indeed been associated with insulin resistance, obesity and T2DM in many populations (Hara et al., 2002; Ji et al., 2018) and with serum adiponectin (Gu et al., 2004) contributing to MetS, T2DM and insulin insensitivity (Melistas et al., 2009). A previous study among Temiar's also reported that serum adiponectin was negatively correlated with most of MetS criteria (Zahary et al., 2019). Conditions like MetS are consequent to complex genes-environment interactions. Thus, although associations between ADIPOQ +45T > G (rs2241766) polymorphism with MetS has been reported in many studies, a study among Italian patients with type II diabetes investigating the role of ADIPOQ +45T > G (rs2241766) polymorphism in CVD failed to show an association (Bacci et al., 2004). Similarly, another study involving a cohort of T2DM patients also showed no significant association between the polymorphism with adiponectin levels and the risk of CVD (Qi et al., 2006). A lack of association between the polymorphism and CVD has also been reported among Korean patients (Jung et al., 2006) and in Iranian T2DM patients (Mohammadzadeh

TT

Crude OR (95% CI)

Wald statistics (df)

P-value

1.02 (0.99, 1.05)

1.99 (1)

0.159⁎

1.00 0.45 (0.19, 1.04) 2.07 (1.58, 2.71)

3.54 (1) 27.89 (1)

0.060⁎ < 0.001⁎

1.14 (1.09, 1.20)

26.96 (1)

< 0.001⁎

1.00 0.39 (0.18, 0.83) 1.30 (1.08, 1.58) 0.002 (0.00, 0.02) 87.82 (16.58, 465.17)

6.04 (1) 7.40 (1) 28.53 (1) 27.68 (1)

0.014⁎ 0.007⁎ < 0.001⁎ < 0.001⁎

1.00 87.16 (11.05, 687.23) 26.53 (3.07, 228.96)

17.98 (1) 8.89 (1)

< 0.001⁎ 0.003⁎

36.04 (1)

< 0.001⁎

6.65 (1)

0.01⁎

1.00 38.196 (11.63, 125.46) 19.714 (2.046, 189.940)

The model reasonably fits well. Model assumptions are met. There are no interaction and multicollinearity problems. ⁎ Simple logistic regression.

et al., 2016). On the other hand, studies have also shown associations between the polymorphism with obesity and other associated risks for MetS (Gupta et al., 2012; Ramya et al., 2013; Zaki et al., 2014). ADIPOQ +276G > T (rs1501299) polymorphism was found to be associated with obesity-related risks among young adults in a European population (Karmelic et al., 2012; Filippi et al., 2005) and has been suggested to have an independent role in the development of MetS among Korean patients with T2DM (Hwang et al., 2010). Nevertheless, again, there occurred inconsistencies in reported finding across populations (Salmenniemi et al., 2005; Kalnina et al., 2009; Berthier et al., 2005;

4

Meta Gene 24 (2020) 100653

M.N. Zahary, et al.

Wang et al., 2009; Bostrom et al., 2009). The apparent discrepant results underscore the complexity of gene-environment interactions in predisposing to diseases.

caucasians. Diabetes. 53, S31–S35. Gupta, V., Khadgawat, R., Ng, H.K.T., Walia, G.K., Kalla, L., Rao, V.R., 2012. Association of TCF7L2 and ADIPOQ with body mass index, waist-hip ratio, and systolic blood pressure in an endogamous ethnic group of India. Genet. Test Mol. Biomarkers 16, 948–951. Hara, K., Boutin, P., Mori, Y., Tobe, K., Dina, C., Yasuda, K., 2002. Genetic variation in the gene encoding adiponectin is associated with an increased risk of type 2 diabetes in the Japanese population. Diabetes. 51, 536–540. Henneman, P., Aulchenko, Y.S., Frants, R.R., Zorkoltseva, I.V., Zillikens, M.C., Frolich, M., Oostra, B.A., Van Dijk, K.W., Van Duijn, C.M., 2010. Genetic architecture of plasma adiponectin overlaps with the genetics of metabolic syndrome-related traits. Diabetes Care 33, 908–913. Hwang, J.Y., Park, J.E., Choi, Y.J., Huh, K.B., Kim, W.Y., 2010. SNP276G > T polymorphism in the adiponectin gene is associated with metabolic syndrome in patients with type II diabetes mellitus in Korea. Eur. J. Clin. Nutr. 64, 105–107. Ji, M.J., Ku, E.J., Oh, T.K., Jeon, H.J., 2018. Association of Adiponectin 45T/G polymorphism with diabetic cardiovascular complications in Korean Type 2 diabetes. J. Korean Med. Sci. 33, e124. Jung, C.H., Rhee, E.J., Kim, S.Y., Shin, H.S., Kim, B.J., Sung, K.C., 2006. Associations between two single nucleotide polymorphisms of adiponectin gene and coronary artery diseases. Endocr. J. 53, 671–677. Kalniņa, I., Latkovskis, G., Ņkitina-Zaķe, L., Mackevičs, V., Pečulis, R., Kāpa, I., 2009. Analysis of polymorphisms at the adiponectin gene locus in association with type 2 diabetes, body mass index and cardiovascular traits in Latvian population. Proc. Latvian Acad. Sci. 63, 174–179. Karmelic, I., Lovric, J., Bozina, T., Ljubi, H., Vogrinc, Z., Bozina, N., Serti, J., 2012. Adiponectin level and gene variability are obesity and metabolic syndrome markers in a young population. Arch. Med. Res. 43, 145–153. Kaur, J.A., 2014. A comprehensive review on metabolic syndrome. Cardiol. Res. Pract. 2014, 943162. Lillioja, S., Wilton, A., 2009. Agreement among type 2 diabetes linkage studies but a poor correlation with results from genome-wide association studies. Diabetologia. 52, 1061–1074. Melistas, L., Mantzoros, C.S., Kontogianni, M., Antonopoulou, S., Ordovas, J.M., Yiannakouris, N., 2009. Association of the +45T > G and +276G > T polymorphisms in the adiponectin gene with insulin resistance in nondiabetic Greek women. Eur. J. Endocrinol. 161, 845–852. Menzaghi, C., Trischitta, V., Doria, A., 2007. Genetic influences of adiponectin on insulin resistance, type 2 diabetes, and cardiovascular disease. Diabetes. 56, 1198–1209. Mohammadzadeh, G., Ghaffari, M.A., Heibar, H., Bazyar, M., 2016. Association of two common single nucleotide polymorphisms (+45T/G and +276G/T) of ADIPOQ gene with coronary artery disease in type 2 diabetic patients. Iran. Biomed. J. 20, 152–160. Moy, F.M., Bulgiba, A., 2010. The modified NCEP ATP III criteria maybe better than the IDF criteria in diagnosing metabolic syndrome among Malays in Kuala Lumpur. BMC Public Health 10, 678. https://doi.org/10.1186/1471-2458-10-678. Qi, L., Doria, A., Manson, J.E., Meigs, J.B., Hunter, D., Mantzoros, C.S., 2006. Adiponectin genetic variability, plasma adiponectin, and cardiovascular risk in patients with type 2 diabetes. Diabetes. 55, 1512–1516. Ramya, K., Ayyappa, K.A., Ghosh, S., Mohan, V., Radha, V., 2013. Genetic association of ADIPOQ gene variants with type 2 diabetes, obesity and serum adiponectin levels in south Indian population. Gene. 532, 253–262. Ruan, H., Dong, L.Q., 2016. Adiponectin signaling and function in insulin target tissues. J. Mol. Cell Biol. 8, 101–109. Salmenniemi, U., Zacharova, J., Ruotsalainen, E., Vauhkonen, I., Pihlajamaki, J., Kainulainen, S., 2005. Association of adiponectin level and variants in the adiponectin gene with glucose metabolism, energy expenditure, and cytokines in offspring of type 2 diabetic patients. J. Clin. Endocrinol. Metab. 90, 4216–4223. Siitonen, N., Pulkkinen, L., Lindstrom, J., Kolehmainen, M., Eriksson, J.G., Venojärvi, M., Ilanne-Parikka, P., Keinänen-Kiukaanniemi, S., Tuomilehto, J., Uusitupa, M., 2011. Association of ADIPOQ gene variants with body weight, type 2 diabetes and serum adiponectin concentrations: the Finnish Diabetes Prevention study. BMC Med. Genet. 12, 5. Wang, Y., Zhang, D., Liu, Y., Yang, Y., Zhao, T., Xu, J., Li, S., Zhang, Z., Feng, G., He, L., Xu, H., 2009. Association study of the single nucleotide polymorphisms in adiponectin-associated genes with type 2 diabetes in Han Chinese. J. Genet. Genomics 36, 417–423. World Medical Association, 2013. World medical association declaration of Helsinki ethical principles for medical research involving human subjects. JAMA 310, 2191–2194. Yang, W.S., Tsou, P.L., Lee, W.J., Tseng, D.L., Chen, C.L., Peng, C.C., Lee, K.C., Chen, M.J., Huang, C.J., Tai, T.Y., Chuang, L.M., 2003. Allele-specific differential expression of a common adiponectin gene polymorphism related to obesity. J. Mol. Med. 81, 428–434. Zahary, M.N., Harun, N.S., Yahaya, R., Nik Him, N.A.S., Rohin, M.A.K., Ridzwan, N.H., Jumli, M.N., Wan Jusoh, A.F., 2019. Serum adiponectin and resistin: correlation with metabolic syndrome and its associated criteria among temiar subtribe in Malaysia. Diabetes Metab. Syndr. Clin. Res. Rev. 13, 2015–2019. Zaki, M., El-Salam, M., Hassan, N.A.M., Mohamed, S.K., Zaher, M.M., Ibraheim, R.A.M., Elkhouly, A.E., Ismail, S., 2014. Association of adiponectin gene polymorphisms 276G > T with obesity and biochemical parameters in adolescents. Int J Pharm Pharm Sci 6, 226–229.

4. Conclusion The present study provided results suggesting a crucial role of ADIPOQ polymorphisms in predisposing Temiar individuals to MetS. The high odds ratios for the development of MetS in association with ADIPOQ +45T > G (rs2241766) and +276G > T (rs1501299) polymorphisms among the Temiar's are intriguing. It suggests a protective role of adiponectin in MetS. In the current study, the genetic background noises were minimised by studying a small population of individuals who live in a very close-knit society. They tend to marry each other and hence reducing the chance of genetic admixture. Their genetic make-up may have protected them in their native environment but once relocated, the unfriendly outside environments make them susceptible. However, the small sample size of the present study might influence the power of the study in analysing the risk association of these two polymorphisms with MetS susceptibility. Further studies with larger sample sizes are warranted including in other similarly protected populations to test whether the mutations do indeed confer susceptibility to MetS. Acknowledgements The authors would like to thank the Malaysian Ministry of Higher Education for providing a research grant (RAGS/1/2015/SKK01/ UNISZA/03/1) for us to undertake this study. The authors also would like to thank Jabatan Kemajuan Orang Asli (JAKOA) for their logistics, technical and staff support. We also would like to extend our gratitude to the Temiar subtribe in Kuala Betis, Gua Musang, Kelantan for their willingness to participate in this study. We would also like to thank BML Global Enterprise for providing technical expertise and few lab facilities. Declaration of Competing Interest The authors whose names are listed certify that they have NO affiliations with or involvement in any organization with any financial interest or non-financial interest in the subject matter or materials discussed in this article. References Bacci, S., Menzaghi, C., Ercolino, T., Ma, X., Rauseo, A., Salvemini, L., 2004. The +276 G/T single nucleotide polymorphism of the adiponectin gene is associated with coronary artery disease in type 2 diabetic patients. Diabetes Care 27, 2015–2020. Berthier, M.T., Houde, A., Cote, M., Paradis, A.M., Mauriège, P., Bergeron, J., 2005. Impact of adiponectin gene polymorphisms on plasma lipoprotein and adiponectin concentrations of viscerally obese men. J. Lipid Res. 46, 237–244. Bostrom, M.A., Freedman, B.I., Langefeld, C.D., Liu, L., Hicks, P.J., Bowden, D.W., 2009. Association of adiponectin gene polymorphisms with type 2 diabetes in an African American population enriched for nephropathy. Diabetes. 58, 499–504. Edwards, K.L., Hutter, C.M., Wan, J.Y., Kim, H., Monks, S.A., 2008. Genome-wide linkage scan for the metabolic syndrome: the GENNID study. Obesity (Silver Spring, Md). 16, 1596–1601. Filippi, E., Sentinelli, F., Romeo, S., Arca, M., Berni, A., Tiberti, C., 2005. The adiponectin gene SNP+276G > T associates with early-onset coronary artery disease and with lower levels of adiponectin in younger coronary artery disease patients (age < or=50 years). J. Mol. Med. 83, 711–719. Gable, D.R., Hurel, S.J., Humphries, S.E., 2006. Adiponectin and its gene variants as risk factors for insulin resistance, the metabolic syndrome and cardiovascular disease. Atherosclerosis. 188, 231–244. Gu, H.F., Abulaiti, A., Ostenson, C.G., Humphreys, K., Wahlestedt, C., Brookes, A.J., Efendic, S., 2004. Single nucleotide polymorphisms in the proximal promoter region of the adiponectin (APM1) gene are associated with type 2 diabetes in Swedish

5