Increases in immune parameters by inulin and Bacillus subtilis dietary administration to gilthead seabream (Sparus aurata L.) did not correlate with disease resistance to Photobacterium damselae

Fish & Shellfish Immunology 32 (2012) 1032e1040

Contents lists available at SciVerse ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Increases in immune parameters by inulin and Bacillus subtilis dietary administration to gilthead seabream (Sparus aurata L.) did not correlate with disease resistance to Photobacterium damselae Rebeca Cerezuela, Francisco A. Guardiola, José Meseguer, M. Ángeles Esteban* Fish Innate Immune System Group, Department of Cell Biology and Histology, Faculty of Biology, University of Murcia, 30100 Murcia, Spain

a r t i c l e i n f o

a b s t r a c t

Article history: Received 19 January 2012 Received in revised form 15 February 2012 Accepted 20 February 2012 Available online 6 March 2012

The present work evaluates the effects of inulin and Bacillus subtilis, single or combined, on immune parameters, immune-related gene expression and protection against Photobacterium damselae subsp. piscicida in gilthead seabream (Sparus aurata). Three trials were conducted. In the first trial, different concentrations of inulin (10, 15 and 30 g kg
1) (as a prebiotic) were administered to determine the optimal concentration for stimulating the seabream’s immune system. In the second trial, the optimum concentration of inulin (10 g kg
1) was combined with B. subtilis (as a probiotic). Following two and four weeks of the treatment, the main immune parameters, as well as the expression of seven immunerelated genes, were measured. In the final trial, fish fed the same diet as in the second trial were challenged intraperitoneally with P. damselae subsp. piscicida (109 cfu g
1). Treatment groups for the second and third trial were control (non-supplemented diet), inulin (10 g kg
1), B. subtilis (107 cfu g
1) and inulin þ B. subtilis (10 g kg
1 and 107 cfu g
1 respectively). Dietary administration of inulin or B. subtilis for two weeks stimulated the serum complement activity and the IgM level, as well as leucocyte phagocytic activity; furthermore, inulin stimulated leucocyte respiratory burst activity. When inulin and B. subtilis were administered together (as a synbiotic), only the serum complement activity and the IgM level increased in a statistically significant manner. Furthermore, the complement activity showed a significant increase in fish fed the three experimental diets for four weeks. The challenge experiment showed that the fish fed inulin or the synbiotic diet had non-significantly lower or significantly higher cumulative mortality, respectively, compared with the control group (non-supplemented diet). These results suggest that inulin and B. subtilis modulate the immune response of the gilthead seabream, although the combined administration increases susceptibility to infection by P. damselae subsp. piscicida. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Gilthead seabream Immune system Disease resistance Synbiotic Teleost

1. Introduction The rapid development of aquaculture in recent years has led to the emergence of diseases and problems associated with intensive farming; these diseases have resulted in production losses and remain a primary constraint to continued expansion of aquaculture [1e3]. Traditional disease control and prevention strategies employ vaccines, antibiotics and chemotherapeutics. However, application of antibiotics can lead to the development of antibiotic-resistant bacterial strains and cause many other problems such as environmental hazards, food safety problems and resistance of human

* Corresponding author. Tel.: þ34 868887665; fax: þ34 868883963. E-mail addresses: [email protected] (R. Cerezuela), [email protected] (F.A. Guardiola), [email protected] (J. Meseguer), [email protected] (M.Á. Esteban). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2012.02.025

pathogens; the use of antibiotics can also adversely affect the health status of fish [4]. Moreover, subtherapeutic doses of antibiotics are often added to aquatic feeds to promote growth, and this has further contributed to drug resistance [5]. This situation and recent restrictions on the use of antibiotics have promoted the use of probiotics and prebiotics as significant alternatives to antibiotics, and there is increased interest in aquaculture in using these additives to prevent and/or control fish diseases [6,7]. Probiotics are usually live microorganisms that have beneficial effects on the health of the host. Various benefits of probiotics have been studied in fish and other aquatic organisms including improving intestinal balance and feed utilisation, contributing to digestion, inhibiting pathogenic microorganisms, and enhancing immune responses [1,7e13]. The most common probiotics used in aquaculture are Lactobacillus sp., Bacillus sp., Vibrio sp., Saccharomyces sp. and Enterococcus sp. [9,14]. Bacillus subtilis has been

R. Cerezuela et al. / Fish & Shellfish Immunology 32 (2012) 1032e1040

reported to have various beneficial properties when used as a supplement in fish diets [14e19]. Prebiotics are selectively fermented ingredients that lead to specific changes in the composition and/or activity of the gastrointestinal microflora, with resulting benefits for the host’s wellbeing and health [20]. Although prebiotics are now widely used in humans and animal foodstuffs, information about their effects on aquatic animals is still scarce [10,12], especially on the immune system of fish. Inulin and oligofructose, which are both considered important probiotic substrates, are amongst the most well-studied of the prebiotics due to their effect on intestinal bifidobacteria [21e23]. Studies of the effects of inulin on fish have demonstrated that inulin could affect intestinal microbiota [24,25], but information about the influence of inulin on the immune system is still scarce [26]. Until now, prebiotics and probiotics have mostly been studied in isolation in fish. Synbiotics are products that contain both probiotics and prebiotics. Gibson and Roberfroid [27] stated that the use of synbiotics in fish may provide the benefit of both pre- and probiotics mainly due to their synergistic effect. However, studies of synbiotics in fish are still in their infancy [28e32] and, to date, the effects of a combination of inulin and B. subtilis on fish’s immune systems have not been evaluated. Therefore, the aim of the current study was to evaluate the potential in vivo effect of the dietary administration of inulin and B. subtilis, single or combined, on different immune parameters, on the expression of immunerelated genes of the gilthead seabream (Sparus aurata) and on protecting against an experimental challenge with Photobacterium damselae subsp. piscicida. 2. Material and methods 2.1. Microorganisms B. subtilis (CECT 35, Valencia, Spain) were grown in nutrient agar (Laboratorios Conda, Madrid) (pH 6.8; 30  C) plates for 2e3 days. Colonies from cultured plates were then subcultured in 750 ml nutrient broth in continuous gentle agitation for 15 h. Absorbance at 600 nm from 1 ml aliquots was measured every hour until bacteria had been growing for 24 h. This culture was used to prepare the experimental diets. Simultaneously, the number of bacterial cells present per ml of culture medium of such aliquots was measured by plating, in order to characterise the growth curve of this bacterial species. The strain Lgh41/01 of P. damselae subsp. piscicida isolated from diseased Senegalese sole [33], courtesy of Dr. Moriñigo (Málaga, Spain) was selected to test the protective capacity of the assayed diets. P. damselae subsp. piscicida colonies, which were grown on tryptic soy agar (Laboratorios Conda, Madrid) supplemented with 1.5% NaCl (TSAs) plates for 24 h at 22  C, were subcultured in 750 ml of liquid tryptic soy broth (Laboratorios Conda, Madrid) with 1.5% NaCl (TSBs) in continuous agitation. Absorbance at 600 nm and bacterial cell numbers were counted as before and the growth curve established. Both bacterial cell cultures were centrifuged at 6000 g for 15 min at 4  C, washed in sterile phosphate-buffered saline (PBS, pH 7.4), counted by plating and adjusted to the required concentrations. 2.2. Animals, experimental design and sampling Two hundred eighty-eight specimens (50 g mean body weight) of the hermaphroditic protandrous seawater teleost gilthead seabream (S. aurata L.), obtained from CULMAREX S.A. (Murcia, Spain) were randomly assigned and kept in running seawater

1033

aquaria (200e250 l, flow rate 1500 l/h) at 28& salinity, 20  C and a 12 h light: 12 h dark photoperiod and fed with a commercial pellet diet (Skretting) at a rate of 1% body weight day
1. Fish were subjected to a preventive bath of formaldehyde (37%, 30 min) (Panreac), and a quarantine was induced for a month before the start of the feedings trials without showing any disease. Fish were starved for 24 h prior to sampling. All experimental protocols were approved by the Bioethical Committee of the University of Murcia. Inulin and B. subtilis were added in the laboratory to the commercial pellet diet to obtain the experimental diets containing 0 (control), inulin (10, 15 or 30 g kg
1, Sigma), B. subtilis (107 cfu g
1) or B. subtilis þ inulin (107 cfu g
1 þ 10 g kg
1). The B. subtilis strain and concentration employed was based in previous studies by Salinas et al. [18]. Briefly, normal pellet diet was crushed, mixed with tap water (where inulin or bacterial suspensions were added at the desired volume or concentration) and made again into pellets. Control diet was processed in the same manner. Re-made pellets were allowed to dry and stored at 4  C until use. In a first experiment, conducted to select optimum concentration of inulin for following trials, ninety-six fish were distributed into 8 equal groups and received one of the following diets (each diet of two replicates): (1) non-supplemented commercial pelleted diet (control group); (2) diet supplemented with 10 g kg
1 inulin; (3) diet supplemented with 15 g kg
1 inulin; (4) diet supplemented with 30 g kg
1 inulin. In the second experiment, ninety-six fish in eight aquaria were fed with one of these diets: (1) non-supplemented commercial pelleted diet (control group); (2) diet supplemented with 10 g kg
1 inulin; (3) diet supplemented with 107 cfu g
1 B. subtilis; (4) diet supplemented with 10 g kg
1 inulin and 107 cfu g
1 B. subtilis, with two replicates for each treatment group. In both experiments, six specimens of each group were sampling following to 2 and 4 weeks of feeding trial. For sampling, specimens were sacrificed by an overdose of MS222 (100 mg l
1, Sandoz), and blood and head-kidney (HK) were isolated from each fish under sterile conditions. 2.3. In vitro assay With the aim of evaluating the potency of inulin to sustain or promote the growth of selected bacteria, an in vitro assay was performed. B. subtilis were grown in minimum medium supplemented with 1% inulin. Inulin or glucose were added to medium minimum and put on a flat-bottomed 96-well plate. Bacteria were precultured as mentioned, harvested at the exponential growth phase and inoculated in the plate at a density of 105 cfu ml
1. Then, plate was incubated at 22  C for 48 h and growth was monitored every 20 min by measuring the optical density (OD) of the culture at a wave length of 600 nm using a spectrophotometer. 2.4. Serum and head-kidney leucocytes isolation Blood samples were obtained from the caudal vein of each specimen with a 27-gauge needle and 1 ml syringe. After clotting at 4  C, each sample was centrifuged (2000 g, 10 min, 4  C) and the serum was removed and frozen at
80  C until use. The HK was excised, cut into small fragments and transferred to 8 ml of sRPMI [RPMI-1640 culture medium (Gibco) supplemented with 0.35% sodium chloride (to adjust the medium’s osmolarity to gilthead seabream plasma osmolarity of 353.33 mOs), 2% foetal calf serum (FCS, Gibco), 100 i.u.ml
1 penicillin (Flow) and 100 mgml
1 streptomycin (Flow)] [34]. Cell suspensions were obtained by forcing fragments of the organ through a nylon mesh (mesh size 100 mm), washed twice (400 g, 10 min), counted and adjusted to

1034

R. Cerezuela et al. / Fish & Shellfish Immunology 32 (2012) 1032e1040

107 cellsml
1 in sRPMI. Cell viability was determined by the trypan blue exclusion test. 2.5. Natural haemolytic complement activity The activity of the alternative complement pathway was assayed using sheep red blood cells (SRBC, Biomedics) as targets [35]. Equal volumes of SRBC suspension (6%) in phenol red-free Hank’s buffer (HBSS) containing Mgþ2 and EGTA were mixed with serially diluted serum to give final serum concentrations ranging from 10% to 0.078%. After incubation for 90 min at 22  C, the samples were centrifuged at 400 g for 5 min at 4  C to avoid unlysed erythrocytes. The relative haemoglobin content of the supernatants was assessed by measuring their optical density at 550 nm in a plate reader. The values of maximum (100%) and minimum (spontaneous) haemolysis were obtained by adding 100 ml of distilled water or HBSS to 100 ml samples of SRBC, respectively. The degree of haemolysis (Y) was estimated and the lysis curve for each specimen was obtained by plotting Y/(1
Y) against the volume of serum added (ml) on a logelog scaled graph. The volume of serum producing 50% haemolysis (ACH50) was determined and the number of ACH50 units ml
1 obtained for each experimental group. 2.6. Serum IgM level Total serum IgM levels were analysed using the enzyme-linked immunosorbent assay (ELISA) [36]. Thus, 20 ml per well of 1/100 diluted serum were placed in flat-bottomed 96-well plates in triplicate and the proteins were coated by overnight incubation at 4  C with 200 ml of carbonateebicarbonate buffer (35 mM NaHCO3 and 15 mM Na2CO3, pH 9.6). After three rinses with PBT (20 mM TriseHCl, 150 mM NaCl and 0.05% Tween 20, pH 7.3) the plates were blocked for 2 h at room temperature with blocking buffer containing 3% bovine serum albumin (BSA) in PBS, followed by three rinses with PBT. The plates were then incubated for 1 h with 100 ml per well of mouse anti-gilthead seabream IgM monoclonal antibody (Aquatic Diagnostics Ltd.) (1/100 in blocking buffer), washed and incubated with the secondary antibody anti-mouse IgG-HRP (1/1000 in blocking buffer). After exhaustive rinsing with PBT the plates were developed using 100 ml of a 0.42 mM TMB solution, prepared daily in a 100 mM citric acid-sodium acetate buffer, pH 5.4, containing 0.01% H2O2. The reaction was allowed to proceed for 10 min and stopped by the addition of 50 ml of 2 M H2SO4 and the plates were read at 450 nm. Negative controls consisted of samples without serum or without primary antibody, whose OD values were subtracted for each sample value. 2.7. Respiratory burst activity The respiratory burst activity of gilthead seabream HK leucocytes was studied by a chemiluminescence method [37]. Briefly, samples of 106 leucocytes in sRPMI were placed in the wells of a flat-bottomed 96-well microtiter plate, to which 100 ml of HBSS containing 1 mg ml
1 phorbol myristate acetate (PMA, Sigma) and 10
4 M luminol (Sigma) was added. The plate was shaken and immediately read in a plate reader for 1 h at 2 min intervals. The kinetics of the reactions were analysed and the maximum slope of each curve was calculated. Luminescence backgrounds were calculated using reagent solutions containing luminol but not PMA. 2.8. Phagocytic activity The phagocytosis of Saccharomyces cerevisiae (strain S288C) by gilthead seabream HK leucocytes was studied by flow cytometry [38]. Heat-killed and lyophilized yeast cells were labelled with

fluorescein isothiocyanate (FITC, Sigma), washed and adjusted to 5  107 cells ml
1 of sRPMI. Phagocytosis samples consisted of 125 ml of labelled-yeast cells and 100 ml of HK leucocytes in sRPMI (6.25 yeast cells:1 leucocyte). Samples were mixed, centrifuged (400 g, 5 min, 22  C), resuspended and incubated at 22  C for 30 min. At the end of the incubation time, the samples were placed on ice to stop phagocytosis and 400 ml ice-cold PBS was added to each sample. The fluorescence of the extracellular yeasts was quenched by adding 40 ml ice-cold trypan blue (0.4% in PBS). Standard samples of FITC-labelled S. cerevisiae or HK leucocytes were included in each phagocytosis assay. All samples were analysed in a flow cytometer (Becton Dickinson) with an argon-ion laser adjusted to 488 nm. Analyses were performed on 3000 cells, which were acquired at a rate of 300 cells/ s. Data were collected in the form of two-parameter side scatter (granularity) (SSC) and forward scatter (size) (FSC), and green fluorescence (FL1) and red fluorescence (FL2) dot plots or histograms were made on a computerised system. The fluorescence histograms represented the relative fluorescence on a logarithmic scale. The cytometer was set to analyse the phagocytic cells, showing highest SSC and FSC values. Phagocytic ability was defined as the percentage of cells with one or more ingested bacteria (green-FITC fluorescent cells) within the phagocytic cell population. The relative number of ingested bacteria per cell (phagocytic capacity) was assessed in arbitrary units from the mean fluorescence intensity of the phagocytic cells. The quantitative study of the flow cytometric results was made using the statistical option of the Lysis Software Package (Becton Dickinson). 2.9. Real-time PCR Tissue fragments from HK were obtained and immediately stored at
80  C in TRIzol reagent (Invitrogen) for RNA extraction. Total RNA was extracted from 0.5 g of seabream tissue using TRIzol Reagent (Invitrogen). It was then quantified and the purity was assessed by spectrophotometry; the 260:280 ratios were 1.8e2.0. The RNA was then treated with DNase I (Promega) to remove genomic DNA contamination. Complementary DNA (cDNA) was synthesized from 1 mg of total RNA using the SuperScript III reverse transcriptase (Invitrogen) with an oligo-dT18 primer. The expression of seven selected immune-relevant genes was analysed by real-time PCR, which was performed with an ABI PRISM 7500 instrument (Applied Biosystems) using SYBR Green PCR Core Reagents (Applied Biosystems). Reaction mixtures (containing 10 ml of 2SYBR Green supermix, 5 ml of primers (0.6 mM each) and 5 ml of cDNA template) were incubated for 10 min at 95  C, followed by 40 cycles of 15 s at 95  C, 1 min at 60  C, and finally 15 s at 95  C, 1 min at 60  C and 15 s at 95  C. For each mRNA, gene expression was corrected by the elongation factor 1-alpha (EF-1a) content in each sample. The primers used are shown in Table 1. In all cases, each PCR was performed with triplicate samples. 2.10. Challenge with P. damselae subsp. piscicida The last experiment consisted in the challenge with P. damselae subsp. piscicida following to the administration of the experimental diets. Ninety-six specimens were randomly assigned to eight aquaria (two replicate for treatment) and fed with experimental diets (control diet; diet supplemented with 10 g kg
1 inulin; diet supplemented with 107 cfu g
1 B. subtilis; or diet supplemented with both 10 g kg
1 inulin and 107 cfu g
1 B. subtilis) at a rate of 1% dry diet kg
1 biomass during four weeks. At day 28 of feeding trial, fish were inoculated intraperitoneally with P. damselae subsp. piscicida bacterial dose of 109 cfu g
1 (lethal dose previously determined) in 0.1 ml of sterile PBS. Fish specimens inoculated with

R. Cerezuela et al. / Fish & Shellfish Immunology 32 (2012) 1032e1040 Table 1 Primers used for real-time PCR.

0.7

GenBank ID

Primer sequence (50 e30 )

EF-1aa

AF184170

IgMHb

AM493677

TCRbc

AM261210

MHCIad

DQ211540

MHCIIae

DQ019401

CSF-1Rf

AM050293

b-defg

FM158209

CTGTCAAGGAAATCCGTCGT TGACCTGAGCGTTGAAGTTG CAGCCTCGAGAAGTGGAAAC GAGGTTGACCAGGTTGGTGT AAGTGCATTGCCAGCTTCTT TTGGCGGTCTGACTTCTCTT ATGAGGTTCTTGGTGTTTCTGG TGGAGCGATCCATGTCTCTGC CTGGACCAAGAACGGAAAGA CATCCCAGATCCTGGTCAGT ACGTCTGGTCCTATGGCATC AGTCTGGTTGGGACATCTGG CCCCAGTCTGAGTGGAGTGT AATGAGACACGCAGCACAAG

a

Elongation factor 1-alpha. Immunoglobulin M (heavy chain). T-cell receptor b. Major histocompatibility complex class Ia. Major histocompatibility complex class IIa. Colony-stimulating factor receptor-1. b-defensin.

0.6 OD (600 nm)

Gene

b

1035

0.5 0.4 0.3 0.2

Glucose

0.1

Inulin

0 0

4

8

12

16

20 24 28 Time (h)

32

36

40

44

48

Fig. 1. Growth curves of B. subtilis in medium minimum supplemented with glucose or inulin. Values are means of duplicate measurements.

0.1 ml PBS were used as control. Inoculated fish were observed daily and all the mortalities were recorded for 15 days, considering only the bacterial origin when the bacterial strain was reisolated in pure culture from internal organs of dead fish. Identification of reisolated bacteria as P. damselae subsp. piscicida was carried out following the protocol described by Rajan et al. [39]. Bacterial were isolated from internal organs and cultured on tryptic soy agar (Laboratorios Conda, Madrid) supplemented with 1.5% NaCl (TSAs) for 24e48 h. Single colonies were subcultured in thiosulphate citrate bile salts-sucrose agar (TCBS) (24e48 h) and used for PCR amplification with primers for a capsular polyshaccharide gene (GeneBank accession number AB074290) of P. damselae subsp. piscicida.

and four weeks of the treatment (Fig. 2). As regards the humoral response, the complement activity was significantly higher in the fish fed the 10 g kg
1 inulin-supplemented diet for two (P ¼ 0.005) and four weeks (P ¼ 0.017) compared with the values found in the control fish (non-supplemented diet). There was no significant difference in this activity among the fish fed the 15 or 30 g kg
1 inulin-supplemented diets or the control diet. In terms of the cellular immune responses (Fig. 2), the inulinsupplemented diets significantly affected phagocytic activity. The 10 g kg
1 inulin-supplemented diet provoked an increase in phagocytic ability of the fish fed for two (P ¼ 0.006) and four (P ¼ 0.046) weeks, whereas the phagocytic capacity increased with the administration of the 10 and 30 g kg
1 inulin-supplemented diet for two weeks (P ¼ 0.028 and P ¼ 0.025 respectively). However, at four weeks, the increase provoked by 30 g kg
1 inulin reverted to a statistically significant decrease (P ¼ 0.03). Administration of the 15 g kg
1 inulin-supplemented diet had no effect on phagocytic activity.

2.11. Statistical analysis

3.3. Second trial

Data are expressed as fold increase (mean  standard error, SE), obtained by dividing each sample value by the mean control value at the same sampling time, minus one in humoral and cellular parameters. Values higher than 0 (1 in RT-PCR results) in a parameter express an increase while values lower than 0 express a decrease in a parameter. Immune parameters and gene expression data were statistically analysed by one-way analysis of variance (ANOVA) and S.N.K. (Student-NewmaneKeuls) comparison of means when necessary. Mortality data were compared using the KaplaneMeier method [40]. Differences were considered statistically significant when P  0.05. All data were analysed with the Statistical Package for Social Science (SPSS for Windows, version 15.0; SPSS Inc., Chicago, IL, USA).

As observed in the first trial, the inulin-supplemented diet resulted in a significant increase in the haemolytic complement activity (in the fish fed the experimental diet for two (P ¼ 0.019) and four weeks (P ¼ 0.003)) and in the phagocytic capacity (in the fish fed the experimental diet for four weeks (P ¼ 0.036)). However, the IgM levels, phagocytic ability and respiratory burst only significantly increased following two weeks of the feeding trial (P ¼ 0.038, 0.005, and 0 respectively) (Fig. 3). In contrast, with respect to the control diet, the fish fed the B. subtilis-supplemented diet showed a significant increase in IgM levels and phagocytic ability but not respiratory burst compared with the fish fed inulin [complement activity at two (P ¼ 0.031) and four weeks (P ¼ 0.001); IgM level (P ¼ 0.007) and phagocytic ability (P ¼ 0.031) at two weeks]. Thus, there were no significant differences between the two treatments. When administered together, inulin and B. subtilis led to a significant increase in only two humoral immune parameters at different administration times: complement activity at four weeks (P ¼ 0.013) and the IgM level at two weeks (P ¼ 0). In relation to the complement activity, the observed increase was lower than that observed in the fish fed inulin and B. subtilis separately. In terms of the IgM level, the increase was higher, although there were no statistically significant differences between the inulin, B. subtilis and inulin þ B. subtilis-supplemented diets. The inulin þ B. subtilis-supplemented diet did not significantly affect the phagocytic ability and capacity. The expression of immune-related genes in HK of the seabream fed the experimental diets for two or four weeks showed no

c d e f g

3. Results 3.1. In vitro assay Growth curves of B. subtilis in presence of inulin without another carbon source demonstrated that this probiotic is capable to use inulin. The prebiotic inulin supports the growth of B. subtilis as good as glucose (Fig. 1). 3.2. First trial The humoral and cellular innate immune parameters of gilthead seabream fed inulin-supplemented diets were evaluated after two

1036

R. Cerezuela et al. / Fish & Shellfish Immunology 32 (2012) 1032e1040

Complement activity

Fold increase

1.5 1.25 1 0.75 0.5 0.25 0 -0.25 -0.5

Experimental diets Inulin 10 g kg-1

* *

Inulin 15 g kg-1 Inulin 30 g kg-1

Phagocytic ability 1.5 1.25 1 0.75 0.5 0.25 0 -0.25 -0.5

Phagocytic capacity 0.5

*

0.25

*

*

*

0 -0.25

*

-0.5

2

4

2

4

Administration time (weeks) Fig. 2. Humoral and cellular immune activities of seabream specimens fed diets containing different inulin concentrations. The bars represent the means  s.e. (n ¼ 12) fold increase relative to control. Asterisks denote significant differences between control and treated groups (P  0.05).

significant variations (P values ranged from 0.489 to 0.732), although the expression of all of the genes studied was upregulated after the feeding trials in all of the diets assayed compared with the control group (Fig. 4). At two weeks, the genes mostly affected were TCRb (P ¼ 0.542), MHCIIa (P ¼ 0.671), CSF-1R (P ¼ 0.619) and b-defensin (P ¼ 0.547). Inulin supplementation resulted in no significant increase in the expression of TCRb compared with that observed with the B. subtilis diet or synbiotic

formulation. In contrast, the expression of MHCIIa and CSF1R was higher in the fish fed the combined diet. The expression of the bdefensin gene was higher in the fish fed the inulin or inulin and B. subtilis diets compared with the control group and the fish fed the B. subtilis only diet. At four weeks, expression of all studied genes decreased to levels similar or lower than control, although any of the observed differences were statistically significant (P values ranged from 0.536 to 0.698).

Serum IgMIgM level Serum level

Fold increase

Complement activity 2 1.75 1.5 1.25 1 0.75 0.5 0.25 0

0.5

*

*

* *

0.25

*

*

*

*

0 -0.25 -0.5

Respiratotyburst burst Respiratory 3 2.5 2 1.5 1 0.5 0 -0.5 -1

*

Phagocytic ability Phagocytic ability

Phagocytic capacity Phagocytic capacity

1.5

0.5

1.25 1 0.75

0.25

*

*

*

0

0.5

-0.25

0.25

-0.5

0

2

4

2

4

Administration time (weeks) Fig. 3. Humoral and cellular immune activities of seabream fed different experimental diets: inulin 10 g kg
1 ( ), B. subtilis 107 cfu g
1 ( ) or inulin 10 g kg
1 þ B. subtilis 107 cfu g
1 ( ), for two and four weeks. The bars represent the means  s.e. (n ¼ 12) fold increase relative to control. Asterisks denote significant differences between control and treated groups (P  0.05).

R. Cerezuela et al. / Fish & Shellfish Immunology 32 (2012) 1032e1040

1000

4. Discussion

a

100

Fold increase

10

1 IgMh 10

TCRβ

MHCIα

MHCIIα

CSF-1R

β-def

TCRβ

MHCIα

MHCIIα

CSF-1R

β-def

b

1

0.1

0.01 IgMh

Fig. 4. Expression of immune-relevant genes determined by real-time PCR in HK of gilthead seabream fed experimental diets: inulin 10 g kg
1 ( ), B. subtilis 107 cfu g
1 ( ) or inulin 10 g kg
1 þ B. subtilis 107 cfu g
1 ( ) following two (a) or four (b) weeks of treatment. The bars represent the means  s.e. (n ¼ 12) fold increase relative to control.

3.4. Challenge with P. damselae subsp. piscicida Mortalities in challenged fish occurred during the first days post-injection (Fig. 5). The cumulative mortality of the fish fed the experimental diets ranged from 33.3% (10 g kg
1 inulin) to 100% (10 g kg
1 inulin þ 107 cfu g
1 B. subtilis), whereas the cumulative mortality of the fish fed the non-supplemented diet (control) or the B. subtilis-supplemented diet was 50%. Statistical analysis of the cumulative mortality at the end of the challenge with P. damselae subsp. piscicida in the fish fed the supplemented diet containing inulin þ B. subtilis was significantly higher than that observed in the fish fed the control diet. No external lesions were observed. Bacteriological analysis revealed the presence of P. damselae subsp. piscicida in all of the fish that died during the challenge.

100 90

Survival (%)

80 70 60 50 40 Control Inulin B. subtilis B. subtilis + Inulin

30 20 10 0 0

1037

1

2

3

4

5

6

7

Days after challenge Fig. 5. KaplaneMeier survival curves for each group following a 7 day P. damselae subsp. piscicida challenge of gilthead seabream fed experimental diets (n ¼ 24). Mortality between groups was compared using the KaplaneMeier method. The lines represent the means of two replicates. Asterisk denotes significant difference from the control (P  0.05).

In aquaculture, fish may be exposed to different sources of stress such as high stocking densities or manipulation. As a result of these artificial conditions, which are very different than those in the wild, their defence systems can be weakened, and they may become the target of pathogens such as viruses, bacteria, fungi and parasites, all of which may be easily transmitted and spread rapidly in the aquatic environment. Treatments such as antibiotics and chemotherapeutics create resistant bacteria and immunosuppression in the host [41]. Therefore, alternative strategies must be developed to improve aquatic animal health and to prevent diseases. For this purpose, the use of feed additives such as probiotics and prebiotics is considered a promising option in aquaculture. These functional feed ingredients can increase disease resistance by causing upregulation of the nonspecific or specific immune system of the host, thereby, improving defence against pathogens. Inulin is a fructooligosaccharide commonly used as a prebiotic in human and animal feed [42,43]. Recently, it has been proposed that inulin may have interesting applications in aquaculture to stimulate beneficial gut bacteria, suppress pathogens and enhance the immune response, although high dosages might be also negative impact in gut morphology [12]. Applications of inulin have been studied in various fish species such as Atlantic salmon (Salmo salar L.) [44], Nile tilapia (Oreochromis niloticus) [45] and hybrid striped bass (Morone chrysops  Morone saxatilis) [46]. However, these studies have failed to shed sufficient light on the immunostimulatory properties of inulin in fish. In the present work, the first trial was carried out to determine the most effective concentration of inulin for fish of a specific weight prior to the administration of the probiotic. In a previous study in our laboratory, the dietary administration of 5 or 10 g kg
1 inulin to fish weighting 175 g for two weeks exerted no positive effect on the innate immune parameters of this fish [26]. However, factors such as age, sex, weight, status and other characteristics of the fish as well as time of administration can affect the response of fish to prebiotics [6,32]. Likely as a result of variations in these characteristics, our results indicated that the administration of 10 g kg
1 inulin had a higher significantly positive effect on some innate immune parameters of the gilthead seabream than those observed in the fish fed other concentrations of the prebiotic (15 or 30 g kg
1). This observation can be due to the exhaust of cells in presence of higher concentrations. Based on these results, a concentration of 10 g kg
1 inulin was selected for the subsequent feeding trials. Prebiotic-induced immunomodulation can be due to selective increase/decrease in specific intestinal bacteria, interactions with carbohydrate receptors on intestinal epithelial cells and immune cells or partial absorption resulting in systemic contact with the immune system [42]. Some previous studies have demonstrated that dietary inulin had a damaging effect on enterocytes [12]; perhaps, inulin concentrations used in this study could have similar effects on seabream gut cells, although some histological studies are needed to demonstrate this hypothesis. In the second trial, we studied the effect of inulin and B. subtilis, single or combined, on different immune parameters and on immune-related gene expression. In vitro assay results support the hypothesis of a prebiotic capacity of inulin for the probiotic used in the present work. Fish recognise invading pathogens and employ a number of nonspecific mechanisms to neutralise them [47]. Some of these responses have been widely used as indicators of the health status of fish in different studies. The alternative pathway of complement activity constitutes a powerful nonspecific defence mechanism by fish that confers protection against a wide range of potentially invasive organisms, such as bacteria, fungi, viruses and parasites [48]. In the present work, the single administration of

1038

R. Cerezuela et al. / Fish & Shellfish Immunology 32 (2012) 1032e1040

inulin and B. subtilis for two weeks significantly stimulated complement activity compared with the control group, which showed slightly higher complement activity compared with the fish fed inulin. Following four weeks of the feeding trial, this activity continued to be stimulated, although the increase was lower than that previously observed. At this stage the combination of both ingredients significantly increased the complement activity; however, the increase was lower than that provoked by the single administration of inulin and B. subtilis. The significantly enhanced complement activity by dietary B. subtilis in this study is in agreement with previous results on rainbow trout (Oncorhynchus mykiss) [49], but in contrast to studies on yellow croaker (Larimichthys crocea). Results reported for B. subtilis administered in combination with a prebiotic are contradictory. Ai et al. [29] showed that the administration of B. subtilis in combination with fructooligosaccharide had no effect on complement activity. However, another study on cobia (Rachycentron canadum) demonstrated that dietary supplementation with B. subtilis combined with chitosan significantly enhanced the serum complement activities [30]. Our results showed a significant increase in this activity with synbiotic administration, but no synergistic effect was observed. More studies are needed to know the general effect of B. subtilis on complement activity of different fish species. Immunoglobulin M (IgM), the primary antibody of fish, is a major component of the teleost humoral immune system, and it is used to identify and neutralise foreign objects such as bacteria and viruses. Despite the significance of IgM levels as an immune parameter, there have been few studies of these levels following the administration of probiotics or prebiotics. Nayak et al. [16] reported a significant increase in specific antibody titre against Edwarsiella tarda in Indian major carp (Labeo rohita) following dietary intake of B. subtilis. Moreover, another study demonstrated that IgM levels in gilthead seabream are subjected to immunomodulators such as vitamin A, levamisol, chitosan and yeast cells, or to stressors such as hypoxia, crowding and anaesthetics [36]. In common with these findings, in our study, dietary inulin and B. subtilis tended to have a positive influence on the serum IgM level, which was significantly enhanced following two weeks of treatment with both ingredients combined or separated. This increase was higher in the fish fed the combination of inulin and B. subtilis compared with the single-dose groups. Probiotics and prebiotics might actively stimulate the secretion of IgM by B lymphocytes. When administered together, the effect of the individual ingredients would be augmented, causing increased secretion of IgM [12,50]. Respiratory burst, which participate in the degradation of internalised bacteria and other microorganisms during phagocytosis, have been widely used to evaluate the defence ability against pathogens. Based on the present experiment, only one of the assayed diets (inulin-supplemented diet) had a marked enhancing effect on the respiratory burst activity of the gilthead seabream. The increase in this activity, which occurred following two weeks of the treatment, returned to normal during the next weeks, suggesting the exhaust of the cells. This result is in agreement with that observed in cobia [30] where the administration of chitosan had a similar effect on this activity. However, our results indicate that the respiratory burst activity was independent of dietary B. subtilis. This finding is in contrast with previous studies [14,17], which found that this activity was regulated by dietary B. subtilis in L. rohita. Phagocytosis is the primary nonspecific defence mechanism of vertebrates against invasion by pathogenic organisms [51]. Our results revealed a significant increase in phagocytic ability following two weeks of the feeding trial with single inulin and

B. subtilis. After four weeks, this activity showed a higher increase with respect to that observed at two weeks, but the difference was not statistically significant, probably due to the variations in the characteristics of the fish referred to earlier in the paper. This finding agrees with previous studies with B. subtilis or Bacillus sp. that demonstrated that these probiotics increase phagocytic activity in the rainbow trout (O. mykiss) [17,52]. However, another study of the same fish species (O. mykiss) revealed no effect of B. subtilis on phagocytic activity [49]. In combination with chitosan, B. subtilis was reported to exert a significant stimulant effect on cobia phagocytosis that was higher than that observed with chitosan alone; however, this study did not evaluate the effects of single administration of B. subtilis [30]. Our results showed not only no potentiation of the individual effect of inulin or B. subtilis on phagocytic activity but that the individual effect of each ingredient is cancelled when the two ingredients are administered together. The stimulation of phagocytic ability by inulin or B. subtilis might occur through signalling molecules, which in combination, cause interference and prevent stimulation. In the present work, generally the levels of immune response were decreased over time, suggesting a quick response to diet. This phenomenon is in agreement with other previous researches [53]. Mechanisms through which probiotics and prebiotics exert their immunostimulant effects have not been studied in fish. In others animals, some of the proposed mechanisms include interactions with macrophages, monocytes and lymphocytes; secretion of antimicrobial peptides; or balance control of proinflammatory and anti-inflammatory cytokines [54e56]. Complex interactions between probiotics, prebiotics, the host’s immune system and microbiota could lead to widely variable responses, which must be investigated to understand the different effects of synbiotics on the immune system. To evaluate whether the probiotic and prebiotic treatment influenced the expression of immune-related genes, the expression of EF-1a, IgMH, TCRb, MHCIa, MHCIIa, CSF-1R and b-defensin was examined using real-time PCR. In the present study, gene expression in the head-kidney was not significantly affected by the experimental diets compared with the control group. Interestingly, the observed increase in serum IgM levels did not correlate with up-regulation of IgM gene expression, suggesting an increase in the secretion but not the production of IgM. The most affected genes were TCRb, b-defensin, MHCIIa and CSF-1R, all of which were slightly up-regulated following two weeks of treatment with the three assayed diets (inulin, B. subtilis and inulin þ B. subtilis) compared with the control group. These results suggest that innate immune mechanisms are more influenced by inulin and B. subtilis than adaptive mechanisms. Our results demonstrated that both inulin and B. subtilis stimulate some of the activities evaluated to some extent, although the comparison of the combination feeding with feeding probiotics and prebiotics alone revealed no clear synergistic effect. The immunostimulatory properties of probiotics and prebiotics are strongly affected by various factors including the dose, type and duration of the trial and the species, status, age and culture conditions of the fish [11,12]. The discord and contradictions observed in the present study compared with previous work may be attributable to these factors. However, the observed enhancement of the activities of serum complement, serum IgM and phagocytosis in the present study should prove useful in enabling fish to better resist a possible microbial infection. An experimental infection provides an opportunity to determine the effect of the assayed treatments on the resistance of the fish species. P. damselae subsp. piscicida is an important pathogen gilthead seabream and other marine fish and causes important losses in fish aquaculture worldwide [57]. In the present study, only

R. Cerezuela et al. / Fish & Shellfish Immunology 32 (2012) 1032e1040

the inulin-supplemented diet provoked an increase in the resistance of the gilthead seabream to P. damselae subsp. piscicida, although the difference compared with the controls was not statistically significant, probably due to the effect of the sample size. Previous studies reported beneficial effects of fructooligosaccharides in terms of disease resistance in the crucian carp (Carassius auratus) [9], whereas in yellow croaker no significant effects were observed in relation to resistance to pathogen infection [29]. To our knowledge, only two previous studies have evaluated disease resistance in fish following administration of inulin. In these studies, inulin supplementation had no effect on the susceptibility of grass carp (Ctenopharyngodon idellus) and tilapia (Tilapia aureus) to Aeromonas hydrophyla and E. tarda, respectively [58]. The present results showed no effect of B. subtilis on the disease resistance of the gilthead seabream. This finding is contrary to previous studies of yellow croaker [29] and rohu [14] which found that the dietary administration of this probiotic enhanced resistance against Vibrio harveyi and Aeromonas hydrophila. In previous studies of cobia and yellow croaker fed B. subtilis combined with chitosan or B. subtilis combined with fructooligosaccharide, respectively, Geng et al. [30] and Ai et al. [29] reported an increase in the disease resistance of the fish. However, in the present challenge, the most interesting result was the increase in mortality following the combined administration of B. subtilis and inulin. According to the literature, no previous work has provided evidence for a detrimental effect of probiotics or prebiotics on disease resistance in fish. In the present study, the increase in some immune parameters observed following the administration of the experimental diets did not correlate with an improvement in disease resistance. Moreover, the mortality of synbiotic-treated fish was significantly higher than that observed in the control group. These results suggest that the combination of B. subtilis and inulin seems to exert a negative effect on gilthead seabream, probably not immune-related, that favours infection caused by P. damselae subsp. piscicida. More physiological or morphological studies (e.g., effects of these substances on the gut, changes in bacterial microbiota) are needed to understand potential source of the observed effects.

Acknowledgements This work was funded by a national project of the Ministerio de Ciencia e Innovación (AGL2008-05119-C02-01) and Fundación Séneca (02958/PI/05).

References [1] Verschuere L, Rombaut G, Sorgeloos P, Verstraete W. Probiotic bacteria as biological control agents in aquaculture. Microbiol Mol Biol 2000;64:655e71. [2] Subasinghe RP. Epidemiological approach to aquatic animal health management: opportunities and challenges for developing countries to increase aquatic production through aquaculture. Prev Vet Med 2005;67:117e24. [3] Torrecillas S, Makol A, Caballero MJ, Montero D, Robaina L, Real F, et al. Immune stimulation and improved infection resistance in European sea bass (Dicentrarchus labrax) fed mannan oligosaccharides. Fish Shellfish Immunol 2007;23:969e81. [4] Austin B, Austin DA. Bacterial fish pathogens: diseases of farmed and wild fish. 4th ed. Chichester, UK: Springer-Praxis; 2007. [5] Hernández P. Responsible use of antibiotics in aquaculture. In: FAO, editor. FAO fisheries technical paper no 469, vol. 469; 2005. p. 1e97. Rome. [6] Magnadottir B. Immunological control of fish diseases. Mar Biotechnol (NY) 2010;12:361e79. [7] Dimitroglou A, Merrifield DL, Carnevali O, Picchietti S, Avella M, Daniels C, et al. Microbial manipulations to improve fish health and production e a Mediterranean perspective. Fish Shellfish Immunol 2011;30:1e16. [8] Kesarcodi-Watson A, Kaspar H, Lategan M, Gibson L. Probiotics in aquaculture: the need, principles and mechanisms of action and screening processes. Aquaculture 2008;274:1e14.

1039

[9] Wang Y, Tian Z, Yao J, Li W. Effect of probiotics, Enterococcus faecium, on tilapia (Oreochromis niloticus) growth performance and immune response. Aquaculture 2008;277:203e7. [10] Merrifield DL, Dimitroglou A, Foey A, Davies SJ, Baker RTM, Bøgwald J, et al. The current status and future focus of probiotic and prebiotic applications for salmonids. Aquaculture 2010;302:1e18. [11] Nayak SK. Probiotics and immunity: a fish perspective. Fish Shellfish Immunol 2010;29:2e14. [12] Ringø E, Olsen RE, Gifstad TØ, Dalmo RA, Amlund H, Hemre G-I, et al. Prebiotics in aquaculture: a review. Aquac Nutr 2010;16:117e36. [13] Burr G, Gatlin D, Ricke S. Microbial ecology of the gastrointestinal tract of fish and the potential application of prebiotics and probiotics in finfish aquaculture. J World Aquacult Soc 2005;36:425e36. [14] Kumar R, Mukherjee SC, Ranjan R, Nayak SK. Enhanced innate immune parameters in Labeo rohita (Ham.) following oral administration of Bacillus subtilis. Fish Shellfish Immunol 2008;24:168e72. [15] Aly SM, Abdel-Galil Ahmed Y, Abdel-Aziz Ghareeb A, Mohamed MF. Studies on Bacillus subtilis and Lactobacillus acidophilus, as potential probiotics, on the immune response and resistance of Tilapia nilotica (Oreochromis niloticus) to challenge infections. Fish Shellfish Immunol 2008;25:128e36. [16] Nayak SK, Swain P, Mukherjee SC. Effect of dietary supplementation of probiotic and vitamin C on the immune response of Indian major carp, Labeo rohita (Ham. Fish Shellfish Immunol 2007;23:892e6. [17] Newaj-Fyzul A, Adesiyun AA, Mutani A, Ramsubhag A, Brunt J, Austin B. Bacillus subtilis AB1 controls Aeromonas infection in rainbow trout (Oncorhynchus mykiss, Walbaum). J Appl Microbiol 2007;103:1699e706. [18] Salinas I, Cuesta A, Esteban MA, Meseguer J. Dietary administration of Lactobacillus delbrüeckii and Bacillus subtilis, single or combined, on gilthead seabream cellular innate immune responses. Fish Shellfish Immunol 2005;19:67e77. [19] Salinas I, Abelli L, Bertoni F, Picchietti S, Roque A, Furones D, et al. Monospecies and multispecies probiotic formulations produce different systemic and local immunostimulatory effects in the gilthead seabream (Sparus aurata L.). Fish Shellfish Immunol 2008;25:114e23. [20] Roberfroid M. Prebiotics: the concept revisited. J Nutr 2007;137:830e7. [21] Flamm G, Glinsmann W, Kritchevsky D, Prosky L, Roberfroid M. Inulin and oligofructose as dietary fiber: a review of the evidence. Crit Rev Food Sci Nutr 2001;41:353e62. [22] Kaur N, Gupta AK. Applications of inulin and oligofructose in health and nutrition. J Biosci 2002;27:703e14. [23] Watzl B, Girrbach S, Roller M. Inulin, oligofructose and immunomodulation. Br J Nutr 2007;93:49e55. [24] Ringø E, Sperstad S, Myklebust R, Mayhew TM, Olsen RE. The effect of dietary inulin on aerobic bacteria associated with hindgut of Arctic charr (Salvelinus alpinus L.). Aquac Res 2006;37:891e7. [25] Mahious AS, Gatesoupe FJ, Hervi M, Metailler R, Ollevier F. Effect of dietary inulin and oligosaccharides as prebiotics for weaning turbot, Psetta maxima (Linnaeus, C. 1758). Aquacult Int 2005;14:219e29. [26] Cerezuela R, Cuesta A, Meseguer J, Angeles Esteban M. Effects of inulin on gilthead seabream (Sparus aurata L.) innate immune parameters. Fish Shellfish Immunol 2008;24:663e8. [27] Gibson GR, Roberfroid MB. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J Nutr 1995;125:1401e12. [28] Rodriguez-Estrada U, Satoh S, Haga Y, Fushimi H, Sweetman J. Effects of single and combined supplementation of Enterococcus faecalis, mannanoligosaccharide and polyhydrobutyric acid on growth performance and immune response of rainbow trout Oncorhynchus mykiss. Aquacult Sci 2009; 57:609e17. [29] Ai Q, Xu H, Mai K, Xu W, Wang J, Zhang W. Effects of dietary supplementation of Bacillus subtilis and fructooligosaccharide on growth performance, survival, non-specific immune response and disease resistance of juvenile large yellow croaker, Larimichthys crocea. Aquaculture 2011;317:155e61. [30] Geng X, Dong X-H, Tan B-P, Yang Q-H, Chi S-Y, Liu H-Y, et al. Effects of dietary chitosan and Bacillus subtilis on the growth performance, non-specific immunity and disease resistance of cobia, Rachycentron canadum. Fish Shellfish Immunol 2011;31:400e6. [31] Mehrabi Z, Firouzbakhsh F, Jafarpour A. Effects of dietary supplementation of synbiotic on growth performance, serum biochemical parameters and carcass composition in rainbow trout (Oncorhynchus mykiss) fingerlings. J Anim Physiol Anim Nutr; 2011. doi:10.1111/j.1439-0396.2011.01167.x. [32] Ye J-D, Wang K, Li F-D, Sun Y-Z. Single or combined effects of fructo- and mannanoligosaccharide supplements and Bacillus clausii on the growth, feed utilization, body composition, digestive enzyme activity, innate immune response and lipid metabolism of the Japanese flounder Paralichthys olivaceus. Aquac Nutr 2011;17:902e11. [33] Díaz-Rosales P, Chabrillón M, Moriñigo MA, Balebona MC. Survival against exogenous hydrogen peroxide of Photobacterium damselae subsp. piscicida under different culture conditions. J Fish Dis 2003;26:305e8. [34] Esteban M, Mulero V, Muñoz J, Meseguer J. Methodological aspects of assessing phagocytosis of Vibrio anguillarum by leucocytes of gilthead seabream (Sparus aurata L.) by flow cytometry and electron microscopy. Cell Tissue Res 1998;293:133e41. [35] Ortuño J, Esteban MÁ, Mulero V, Meseguer J. Methods for studying the haemolytic, chemoattractant and opsonic activities of seabream (Sparus aurata L.). In: Barnes AC, Davidson GA, Hiney M, McInthos D, editors. Methodology in fish diseases research. Aberdeen: Albion Press; 1998. p. 97e100.

1040

R. Cerezuela et al. / Fish & Shellfish Immunology 32 (2012) 1032e1040

[36] Cuesta A, Meseguer J, Esteban MA. Total serum immunoglobulin M levels are affected by immunomodulators in seabream (Sparus aurata L.). Vet Immunol Immunopathol 2004;101:203e10. [37] Bayne CJ, Levy S. Modulation of the oxidative burst in trout myeloid cells by adrenocorticotropic hormone and catecholamines: mechanisms of action. J Leukoc Biol 1991;50:554e60. [38] Rodríguez A, Esteban MA, Meseguer J. Phagocytosis and peroxidase release by seabream (Sparus aurata L.) leucocytes in response to yeast cells. Anat Rec A Discov Mol Cell Evol Biol 2003;272:415e23. [39] Rajan PR, Lin JH-Y, Ho M-S, Yang H-L. Simple and rapid detection of Photobacterium damselae ssp. piscicida by a PCR technique and plating method. J Appl Microbiol 2003;95:1375e80. [40] Pérez-Sánchez T, Balcázar JL, Merrifield DL, Carnevali O, Gioacchini G, de Blas I, et al. Expression of immune-related genes in rainbow trout (Oncorhynchus mykiss) induced by probiotic bacteria during Lactococcus garvieae infection. Fish Shellfish Immunol 2011;31:196e201. [41] Panigrahi A, Azad IS. Microbial intervention for better fish health in aquaculture: the Indian scenario. Fish Physiol Biochem 2007;33:429e40. [42] Seifert S, Watzl B. Inulin and oligofructose: review of experimental data on immune modulation. J Nutr 2007;137:2563Se7S. [43] Vulevic J, Rastall RA, Gibson GR. Developing a quantitative approach for determining the in vitro prebiotic potential of dietary oligosaccharides. FEMS Microbiol Lett 2004;236:153e9. [44] Bakke-McKellep AM, Penn MH, Salas PM, Refstie S, Sperstad S, Landsverk T, et al. Effects of dietary soyabean meal, inulin and oxytetracycline on intestinal microbiota and epithelial cell stress, apoptosis and proliferation in the teleost Atlantic salmon (Salmo salar L.). Br J Nutr 2007;97:699e713. [45] Ibrahem MD, Fathi M, Mesalhy S, Abd El-Aty AM. Effect of dietary supplementation of inulin and vitamin C on the growth, hematology, innate immunity, and resistance of Nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol 2010;29:241e6. [46] Burr G, Hume M, Ricke S, Nisbet D, Iii DG. In vitro and in vivo evaluation of the prebiotics GroBiotic-A, inulin, mannanoligosaccharide, and galactooligosa

[47] [48] [49]

[50] [51]

[52]

[53]

[54] [55] [56] [57] [58]

ccharide on the digestive microbiota and performance of hybrid striped bass (Morone chrysops  Morone saxatilis). Microb Ecol 2010;59:187e98. Magnadóttir B. Innate immunity of fish (overview). Fish Shellfish Immunol 2006;20:137e51. Müller-Eberhard HJ. Molecular organization and function of the complement system. Annu Rev Biochem 1988;57:321e47. Panigrahi A, Kiron V, Satoh S, Hirono I, Kobayashi T, Sugita H, et al. Immune modulation and expression of cytokine genes in rainbow trout Oncorhynchus mykiss upon probiotic feeding. Dev Comp Immunol 2007;31: 372e82. Ng SC, Hart AL, Kamm MA, Stagg AJ, Knight SC. Mechanisms of action of probiotics: recent advances. Inflamm Bowel Dis 2009;15:300e10. Olivier G, Eaton CA, Campbell N. Interaction between Aeromonas salmonicida and peritoneal macrophages of brook trout (Salvelinus fontinalis). Vet Immunol Immunopathol 1986;12:223e34. Brunt J, Newaj-Fyzul A, Austin B. The development of probiotics for the control of multiple bacterial diseases of rainbow trout, Oncorhynchus mykiss (Walbaum). J Fish Dis 2007;30:573e9. Sharifuzzaman SM, Austin B. Development of protection in rainbow trout (Oncorhynchus mykiss, Walbaum) to Vibrio anguillarum following use of the probiotic Kocuria SM1. Fish Shellfish Immunol 2010;29:212e6. Sherman PM, Ossa JC, Johnson-Henry K. Unraveling mechanisms of action of probiotics. Nutr Clin Pract 2009;24:10e4. Quigley EMM. Prebiotics and probiotics; modifying and mining the microbiota. Pharmacol Res 2010;61:213e8. Isolauri E, Sütas Y, Kankaanpää P, Arvilommi H, Salminen S. Probiotics: effects on immunity. Am J Clin Nutr 2001;73:444e50. Romalde JL. Photobacterium damselae subsp. piscicida: an integrated view of a bacterial fish pathogen. Int Microbiol 2002;5:3e9. Wang WS, Wang DH. Enhancement of the resistance of tilapia and grass carp to experimental Aeromonas hydrophila and Edwardsiella tarda infections by several polysaccharides. Comp Immunol Microbiol Infect Dis 1997;20: 261e70.