Modulation of the immune parameters and expression of genes of gilthead seabream (Sparus aurata L.) by dietary administration of oxytetracycline

Aquaculture 334–337 (2012) 51–57

Contents lists available at SciVerse ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aqua-online

Modulation of the immune parameters and expression of genes of gilthead seabream (Sparus aurata L.) by dietary administration of oxytetracycline F.A. Guardiola, R. Cerezuela, J. Meseguer, M.A. Esteban ⁎ Fish Innate Immune System Group, Department of Cell Biology and Histology, Faculty of Biology, University of Murcia, 30100 Murcia, Spain

a r t i c l e

i n f o

Article history: Received 16 December 2011 Received in revised form 23 December 2011 Accepted 5 January 2012 Available online 12 January 2012 Keywords: Oxytetracycline Immune system Real time-PCR Gilthead seabream (Sparus aurata L.) Teleosts

a b s t r a c t The oxytetracycline (OTC) is an antibiotic widely used in the aquaculture, principally in the treatment of infections caused by the pathogenic Gram-negative bacteria. In the present study, the consequences of the oral administration of OTC on the main humoral (natural haemolytic complement activity, IgM levels and seric peroxidase level) and cellular (respiratory burst, intracellular peroxidase level and phagocytosis) immune parameters of gilthead seabream (Sparus aurata, L) were evaluated after 7, 14 and 21 days of treatment. Furthermore, the expression levels of immune-associated genes (MHC-IIα, C3, IL-1β, COX-2 and β-defensin) were analysed by real-time polymerase chain reaction in head-kidney and gut. Three experimental groups were established: control group (fed with non-supplemented OTC food) and experimental groups (4 and 8 mg OTC g− 1 feed, respectively) (N = 30). The results reveal a decrease of the natural haemolytic complement activity to the higher dose of OTC administered. By contrast, after 7 days of treatment, fish fed the lowest concentration of OTC were observed to have a statistically significant increase in the percentage of phagocytic cells, while the phagocytic capacity and respiratory burst increased after 14 days of treatment for both concentrations of OTC. No significant effects were observed after 21 days of treatment for both concentrations of OTC with regard to the values obtained in the control group. In head-kidney and gut, the dietary administration of OTC not caused statistically significant variation, only in C3 gene expression at 7 days in gut. The present results suggest that after dietary administration of OTC, the humoral and cellular innate immune parameters of gilthead seabream are depressed and stimulated respectively, and induce up- or down-regulation of the immune-relevant genes analysed depending on the concentration of OTC supplied in diet. © 2012 Elsevier B.V. All rights reserved.

1. Introduction A large increase in the demand for seafood products has occurred in the last century. This has led to a concomitant increase in highintensity aquaculture methods, characterized by high stock density, which can give rise to disease outbreaks, making necessary the use of formulated feeds containing antibiotics, among other substances (Jerbi et al., 2011). In the case of intensive aquaculture, the chemicals that are most frequently applied to prevent or to treat disease outbreaks are formaldehyde and oxytetracycline (OTC). The first is highly effective against most protozoa and common parasites such as monogenetic trematodes. OTC is a tetracycline broad-spectrum antibiotic with bacteriostatic action produced by Streptomyces spp. fungi and it is used to treat systemic bacterial infections that affect fish (Jerbi et al., 2011). It is known that the indiscriminate use of

⁎ Corresponding author at: Department of Cell Biology and Histology, Faculty of Biology, University of Murcia, 30100 Murcia, Spain. Tel.: + 34 868887665; fax: + 34 868363963. E-mail address: [email protected] (M.A. Esteban). 0044-8486/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.aquaculture.2012.01.003

antibiotics in aquaculture may cause toxic effects, bacterial resistance and accumulation of residues in tissues of individuals, as well as other potentially negative effects on human health and environmental quality which have raised public concern, resulting in strict regulations of their use (Coyne et al., 2001). For that reason, more studies are needed to understand and clarify an appropriate use. Immunomodulating effects of the tetracyclines in mammals, birds and fish have been described in a number of publications (Bogert van den and Kroon, 1982; Lundén et al., 1998; Rijkers et al., 1980; Rijkers et al., 1981; Siwicki et al., 1989). The results are contrasting: depression (Grondel et al., 1987a; Lundén et al., 1998; Nikolaev and Nazarmukhamedova, 1974; Rijkers et al., 1980, 1981; Siwicki et al., 1989), as well as no effect of tetracyclines on in vivo humoral responses are reported (Thong and Ferrante, 1980). Depression of in vivo cellular mediated responses is also found (Rijkers et al., 1980; Thong and Ferrante, 1980). The contradictory results are most likely due to the different conditions used in the various studies. Regarding fish, the fish species, temperature, antibiotic dose and route of administration are also important in this respect because of the influence of drug absorption and withdrawal Kroon and De Jong, 1979; Björklund and Bylund, 1990).

52

F.A. Guardiola et al. / Aquaculture 334–337 (2012) 51–57

Antibiotics are lipophilic and persistent in water, soil and organisms because they are produced to induce a biological effect (Halling-Sørensen, 1998). The OTC is an antibiotic which has a low bioavailability when administered orally (Rigos et al., 2003; Ueno et al., 2004), although it persists in tissues of fish (Björklund et al., 1990). In several fish species, levels of OTC were always higher in the liver, blood, muscle tissue and kidney (Grondel et al., 1987b; Herman et al., 1969; Reja et al., 1996). Furthermore, OTC (as some other antimicrobial agents like sulfadiazine in combination with trimethoprim or florfenicol) are held or retained in scales, bone tissue and also in the pronephros (Bergsjø et al., 1979; Grondel et al., 1987a, 1987b; Horsberg et al., 1994). The pronephros is an important lymphoid organ of fish, and, for this reason, the OTC could interact with the immune cells and have an influence on immune responses (Lundén et al., 2002). The effect of an antibiotic (antimicrobial agent) in a cell depends on different factors, such as the capacity of penetration, intracellular location, concentration in the cytoplasm and intracellular organelles, metabolism and intracellular biological activity (Donowitz, 1994). The penetration of OTC in immune cells could enhance or, conversely, impair the cell functions (Hand et al., 1990). The mode of action of OTC is the interference with bacterial protein synthesis (mRNA translation) by binding to the bacterial 30S ribosomal subunit of the microbial 70S ribosomes. As the OTC has widespread therapeutic applications in fish farming (Taffalla et al., 1999), it is important to understand its effects on the fish immune system, because appropriate elimination of bacteria requires both effectiveness of the antimicrobial drug and a well-functioning defence system of the fish (Lundén et al., 2002). Usually, the antibiotic is orally administered in fish farms by being incorporated into the feed (Elema et al., 1996), although, surprisingly, most of the studies focus on the effects of OTC on fish immune systems has been carried out in vitro. The immunomodulatory effects of OTC have been studied in several fish species (carp, salmon and rainbow trout). It has been described that OTC has immunosuppressive effects on fish (Rijkers et al., 1980), may cause oxidative stress (Enis et al., 2011) and liver damage (Horsberg and Berge, 1986), and has a high incidence of bacterial resistance (Miranda and Zemelmen, 2002). To our knowledge, there is only one previous work that evaluates the immunomodulatory effects of orally administered OTC on the seabream immune response. OTC was administered at 75 mg kg − 1 for 10 days and increased nitroblue tetrazolium (+) cells, and total erythrocyte and leucocyte numbers. The effects of OTC on the immune system lasted around 21 days after ceasing the administration and the parameters evaluated then returned to normal levels (Serezli et al., 2005). Taking into account all these previous considerations, the aim of the present study was to determine the effects of dietary administration of OTC, one of the most commonly used antibiotics in fish farming, on the main innate immune parameters and on the expression on different immune-relevant genes of gilthead seabream (Sparus aurata L.), which is the species with the highest rate of production in Mediterranean mariculture. To our knowledge, this is the first study to examine the immune related gene expression associated with OTC use in aquaculture. 2. Materials and methods 2.1. Animals Ninety specimens (65.66 ± 1.06 g and 16.73 ± 0.12 cm) of the hermaphroditic protandrous seawater teleost gilthead seabream (S. aurata L.), obtained from Culmarex S.A. (Murcia, Spain), were kept in running seawater aquaria (flow rate 1500 l h − 1) at 28% salinity, 20 °C and a 12 h light: 12 h dark photoperiod. The animals were fed a commercial pellet diet (Skretting, Spain) at a rate of 2%

body weight per day. Fish were subjected to a preventive bath of formaldehyde (37%, 30 min) (Panreac), and a quarantined was induced for a month without showing any disease. Furthermore, five specimens were sampled to study the main immune parameters and found to fit the normal values which are used to get. Fish were then randomly redistributed into three aquaria (n = 30) and acclimatized for two weeks to the laboratory aquaria conditions prior to the experiment. The Bioethical Committee of the University of Murcia approved the studies. 2.2. Experimental design The experimental period lasted 21 days, making a total of three samples at 7, 14 and 21 days in the control group and experimental groups (4 and 8 mg OTC (Sigma, Germany) g− 1 feed, respectively). The oxytetracycline was administered orally, through commercial feed, dissolved in cod liver oil. The fish were anesthetized with MS222 (Sandoz, Spain, 100 mg ml− 1 water) (Esteban and Meseguer, 1994). 2.3. Sample collection/serum collection and leucocyte isolation Blood samples were collected from the caudal vein with an insulin syringe. The blood samples were left to clot at 4 °C for 4 h and later the serum was collected after centrifugation (10,000 ×g, 5 min) and stored at −80 °C until use. Head-kidney (HK) leucocytes were isolated from each fish under sterile conditions, according to Esteban et al. (1998). Briefly, the HK was excised, cut into small fragments and transferred to 8 ml of sRPMI [RPMI-1640 culture medium (Gibco, England) supplemented with 0.35% sodium chloride (to adjust the medium's osmolarity to gilthead seabream plasma osmolarity of 353.33 mOs), 2% foetal calf serum (FCS, Gibco, England), 100 i.u. ml− 1 penicillin (Flow) and 100 mg ml− 1 streptomycin (Flow)] (Esteban et al., 1998). Cell suspensions were obtained by forcing fragments of the organ through a nylon mesh (mesh size 100 μm) and washed twice (400 ×g, 10 min). HK cell suspensions were layered over a 34–51% Percoll density gradient (Pharmacia) and the bands of leucocytes above the 34–51% interfaces were collected and adjusted to 107 cells ml− 1 in sRPMI. Cell viability was higher than 98%, as determined by the trypan blue exclusion test. All the cellular immune functions were performed only in viable cells. 2.4. Serum and leucocyte peroxidase activity The peroxidase activity in serum or leucocytes was measured according to Quade and Roth (1997). The colour-change reaction was determined by reading the optical density of samples at 450 nm in a plate reader. Standard samples without serum or leucocytes were used as blanks. 2.5. Natural haemolytic complement activity The activity of the alternative complement pathway was assayed using sheep red blood cells (SRBC, Conda, Spain) as targets (Ortuño et al., 1998). The values of maximum (100%) and minimum (spontaneous) haemolysis were obtained by adding 100 μl of distilled water or HBSS to 100 μl samples of SRBC, respectively. The degree of haemolysis (Y) was estimated and the lysis curve for each specimen was obtained by plotting Y/(1-Y)− 1 against the volume of serum added (ml) on a log– log scaled graph. The volume of serum producing 50% haemolysis (ACH50) and the number of ACH50 units ml− 1 obtained for each experimental group were determined. 2.6. Serum IgM level Total serum IgM levels were analysed according to Cuesta et al. (2004), using the enzyme-linked immunosorbent assay (ELISA), serial

F.A. Guardiola et al. / Aquaculture 334–337 (2012) 51–57

53

dilutions of seabream serum (from 1/1 to 1/1000) and the commercial monoclonal antibody as indicated by the manufacturer's instructions (mouse anti-gilthead seabream IgM monoclonal antibody, Aquatic Diagnostics Ltd.). The 1/100 serum dilution gave an optical density in the linear range of the serum dilution versus absorbance curve and was chosen to compare the total IgM level in different serum samples. The secondary antibody used was anti-mouse IgG-HRP (1/1000 in blocking buffer). The reaction was allowed to proceed for 10 min and stopped by the addition of 50 μl of 2 M H2SO4 and the plates were read at 450 nm. Negative controls consisted of samples without serum or without primary antibody, whose OD values were subtracted for each sample value.

expression of eight selected immune-relevant genes was analysed by real-time PCR, which was performed with an ABI PRISM 7500 instrument (Applied Biosystems) using SYBR Green PCR Core Reagents (Applied Biosystems). Reaction mixtures (containing 10 μl of 2 × SYBR Green supermix, 5 μl of primers (0.6 μM each) and 5 μl of cDNA template) were incubated for 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C, 1 min at 60 °C, and finally 15 s at 95 °C, 1 min at 60 °C and 15 s at 95 °C. For each mRNA, gene expression was corrected by the elongation factor 1α RNA content in each sample. The primers used are shown in Table 1. In all cases, each PCR was performed with triplicate samples.

2.7. Respiratory burst activity

2.10. Statistical analysis

The respiratory burst activity of gilthead seabream HK leucocytes was studied by a chemiluminescence method (Bayne and Levy, 1991) using phorbol myristate acetate (PMA, Sigma, Germany) and luminol (Sigma, Germany). The plate was shaken and immediately read in a plate reader for 1 h at 2 min intervals. The kinetics of the reactions were analysed and the maximum slope of each curve was calculated. Luminescence backgrounds were calculated using reagent solutions containing luminol but not PMA.

The results are expressed as a fold increase (mean ± standard error, SE), which was obtained by dividing each sample value by the mean control value at the same sampling time, minus one. Values higher than 0 express an increase in each parameter; and lower than 0 values express a decrease. Data were statistically analysed by one-way analysis of variance (ANOVA) and a Student–Newman– Keuls (S.N.K.) comparison of means when necessary. Differences were considered statistically significant when P ≤ 0.05.

2.8. Phagocytic activity

3. Results

The phagocytosis of Saccharomyces cerevisiae (strain S288C) by gilthead seabream HK leucocytes was studied by flow cytometry (Rodríguez et al., 2003). Heat-killed and lyophilised yeast cells were labelled with fluorescein isothiocyanate (FITC, Sigma, Germany), washed and adjusted to 5 × 10 7 cells ml − 1 of sRPMI. Phagocytosis samples consisted of 125 μl of labelled-yeast cells and 100 μl of HK leucocytes in sRPMI (6.25 yeast cells: 1 leucocyte). At the end of the incubation time (1 h), the samples were placed on ice to stop phagocytosis and 400 μl ice-cold PBS was added to each sample. The fluorescence of the extracellular yeasts was quenched by adding 40 μl ice-cold trypan blue (0.4% in PBS). Standard samples of FITClabelled S. cerevisiae or HK leucocytes were included in each phagocytosis assay. All samples were analysed in a flow cytometer (Becton Dickinson) with an argon-ion laser adjusted to 488 nm. Analyses were performed on 3000 cells, which were acquired at a rate of 300 cells s − 1. Data were collected in the form of two-parameter side scatter (granularity) (SSC) and forward scatter (size) (FSC), while green fluorescence (FL1) and red fluorescence (FL2) dot plots or histograms were made on a computerised system. The fluorescence histograms represented the relative fluorescence on a logarithmic scale. The cytometer was set to analyse the phagocytic cells showing highest SSC and FSC values. Phagocytic ability was defined as the percentage of cells with one or more ingested yeasts (green-FITC fluorescent cells) within the phagocytic cell population. The relative number of ingested yeasts per cell (phagocytic capacity) was assessed in arbitrary units from the mean fluorescence intensity of the phagocytic cells. The quantitative study of the flow cytometric results was made using the statistical option of the Lysis Software Package (Becton Dickinson).

During the trial all fish fed well and consumed the experimetal diets.

2.9. Real-time PCR After 7 or 21 days of OTC administration, total RNA was extracted from 0.5 g of seabream head-kidney and gut using TRIzol Reagent (Invitrogen, Spain). It was then quantified and the purity was assessed by spectrophotometry; the 260:280 ratios were 1.8–2.0. The RNA was then treated with DNase I (Promega) to remove genomic DNA contamination. Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using the SuperScript III reverse transcriptase (Invitrogen, Spain) with an oligo-dT18 primer. The

3.1. Serum and leucocyte peroxidase activity The peroxidase activity measured in serum and HK leukocytes specimens of gilthead seabream fed OTC supplemented diets does not suffer any statistical variations when compared to the values found in specimens from the control group (non-supplemented diet) (Table 2).

3.2. Natural haemolytic complement activity The gilthead seabream specimens which were fed with 8 mg of OTC g − 1 feed showed a decreased haemolytic complement activity after 7 and 21 days of feeding, being statistically significant only in fish fed for 7 days with respect to the values obtained in the serum from specimens in the control group. Comparatively, the seric haemolytic complement activity of seabream specimens fed the lowest OTC assayed concentration (4 mg g − 1 of feed) increased non-statistically significant with the treatment (Fig. 1).

Table 1 Primers used for real-time PCR. Gene name

Gene GenBank abbreviation number

Elongation factor 1α

Ef-1α

Major histocompatibility MHC-IIα complex class IIα Complement 3 C3 Interleukin-1β

IL-1β

Ciclooxigenase-2

COX-2

Β-defensin

BD

AF184170

Primer sequences (5´ → 3´)

CTGTCAAGGAAATCCGTCGT TGACCTGAGCGTTGAAGTTG DQ019401 CTGGACCAAGAACGGAAAGA CATCCCAGATCCTGGTCAGT CX734936 ATAGACAAAGCGGTGGCCTA GTGGGACCTCTCTGTGAAA AJ277166 GGGCTGAACAACAGCACTCT CTTAACACTCTCCACCCTCCA AM266029 GAGTACTGGAAGCCGAGCAC GATATCACTGCCGCCTGAGT FM158209 CCCCAGTCTGAGTGGAGTGT AATGAGACACGCAGCACAAG

54

F.A. Guardiola et al. / Aquaculture 334–337 (2012) 51–57

Table 2 Serum peroxidase activity (units ml serum-1), leucocyte peroxidase activity (units 10–7) and seric immunoglobulin M (OD 450 nm) level of gilthead seabream specimens fed three different diets: control group (non-supplemented) and experimental groups (4 and 8 mg OTC g− 1 feed, respectively). Fish were sampled after 7, 14 and 21 days. Data represent the means ± S.E. (n = 5). Activities

Experimental groups

Serum peroxidase

Control 4 mg OTC g− 1 8 mg OTC g− 1 Control 4 mg OTC g− 1 8 mg OTC g− 1 Control 4 mg OTC g− 1 8 mg OTC g− 1

Leucocyte peroxidase content

Serum immunoglobulin M

feed feed feed feed feed feed

Days of treatment 7

14

21

20.96 ± 4.13 22.97 ± 1.88 18.30 ± 3.51 25.98 ± 6.13 33.65 ± 4.63 34.56 ± 8.17 0.24 ± 0.03 0.33 ± 0.02 0.31 ± 0.03

35.92 ± 8.69 37.25 ± 2.95 39.21 ± 6.19 39.26 ± 3.88 53.44 ± 8.25 59.30 ± 8.39 0.26 ± 0.03 0.28 ± 0.02 0.31 ± 0.01

56.44 ± 17.93 25.93 ± 3.05 32.81 ± 6.73 39.34 ± 2.26 32.24 ± 2.90 38.85 ± 1.17 0.32 ± 0.04 0.26 ± 0.02 0.33 ± 0.03

3.3. Serum IgM level

3.6. Real-time PCR

The total IgM level present in the serum of gilthead seabream fed with OTC supplemented diets did not show any statistically significant differences with regard to the levels present in the serum of the specimens corresponding to the control group (Table 2).

Only the C3 gene expression suffered a statistically significant variation for both groups fed with OTC (4 and 8 mg g − 1 feed) for 7 days. The expression of genes in the HK of seabream specimens fed with both concentrations of OTC for 7 and 21 days did not suffer any statistical variation, nonetheless there was an increase and a decrease of the expression of genes (MHC-IIα, IL-1β, COX-2, β-defensin) in the specimens fed for 7 and 21 days with the lowest and the higher concentrations of OTC, respectively (Fig. 5A and B). In the gut, the expression of genes of seabream specimens decreased for both groups fed with OTC (4 and 8 mg g − 1 feed) for 7 days, being statistically significant for C3 with the exception of the MHC-IIα gene, which increased (Fig. 6A). The expression of genes in the gut of seabream specimens fed with both concentrations of OTC for 21 days increased for C3 and COX-2, while the expression of MHC-IIα and β-defensin genes decreased (Fig. 6B).

3.4. Respiratory burst activity The respiratory burst activity of HK leucocytes of gilthead seabream fed with 8 mg OTC g − 1 of feed for 14 days showed a statistically significant increase in respiratory burst activity with respect to the values found in the control group. However, the specimens fed with 4 mg OTC g − 1 of feed did not suffer any deviation statistically significant with respect to the values found in the control fish. The administration of this OTC concentration for 7 or 21 days did not produce any significant variation in this activity (Fig. 2). 3.5. Phagocytic activity

4. Discussion The percentage of phagocytic cells (phagocytic ability) and the number of particles ingested per phagocyte (phagocytic capacity) of seabream HK leucocytes from both OTC experimental groups fed for 7 and 14 days increased, being statistically significant for the phagocytic ability of the group of fish fed with the lowest concentration of OTC supplied to 7 days compared to the values obtained for the specimens in the control group. Any statistically significant variation was obtained in these two groups when fish were fed with OTC for 21 days (Figs. 3 and 4).

OTC has been used as the first choice drug for nearly all bacterial fish diseases, such as vibriosis, yersiniosis, flavobacteriosis, furunculosis, and columnaris. It is commonly administrated via the diet or via immersion. The application dose associated with the first route varies between 50 and 100 mg OTC/kg body weights per day for 3–21 days, depending on the infection (Treves-Brown, 2000). However, the recommended dose is 75 mg OTC/kg body weight per day for 10 days (Lunden and Bylund, 2000). In the present study seabream

4 mg OTC g-1 feed 8 mg OTC g-1 feed

1

1 * 0.5

Fold increase

Fold increase

0.5

4 mg OTC g-1 feed 8 mg OTC g-1 feed

0

-0.5

*

-0.5

-1 7

0

14

21

Time (days)

-1 7

14

21

Time (days) Fig. 1. Natural haemolytic complement activity of gilthead seabream specimens. Natural haemolytic complement activity (ACH50 ml− 1) of gilthead seabream specimens fed with feed supplemented with two doses of OTC (4 and 8 mg g− 1 of feed, respectively) for the sampling days 7, 14 and 21. The bars represent the means± s.e. (n = 5). Asterisk denotes significant differences between control and treatment groups (P ≤ 0.05).

Fig. 2. Respiratory burst activity of HK leucocytes of gilthead seabream specimens. Respiratory burst activity of HK leucocytes of gilthead seabream specimens fed with feed supplemented with two doses of OTC (4 and 8 mg g− 1 of feed, respectively) for the sampling days 7, 14 and 21. The bars represent the means ± s.e. (n = 5). Asterisk denotes significant differences between control and treatment groups (P ≤ 0.05).

F.A. Guardiola et al. / Aquaculture 334–337 (2012) 51–57

1

100

4 mg OTC g-1 feed 8 mg OTC g-1 feed

A

10 *

Fold increase

Fold increase

0.5

55

0

-0.5

1

0,1 -1 7

14

0,01

21

Time (days)

specimens were fed diets supplemented with two different concentrations of OTC (4 and 8 mg g− 1 feed) for 21 days. Both, dosages and administration times are those frequently used at present for a therapeutic use in Mediterranean gilthead seabream farms. The present results demonstrate that innate humoral activity (seric peroxidase titre and the haemolytic activity of complement) slightly decreased after the OTC administration. These data are consistent with those obtained in other fish species where the OTC produces a reduction in the humoral immune response but with a temporary effect of the repression (Grondel et al., 1987a; Rijkers et al., 1980, 1981). In contrast, dietary administration of levamisole (a widely used antihelminthic) stimulates the haemolytic complement activity in gilthead seabream (Mulero et al., 1998). The oral administration of OTC in turbot (Scophthalmus maximus L.) had no effect on the respiratory burst and phagocytosis activities of HK macrophages (Taffalla et al., 1999). On the contrary, in the present work, respiratory burst of HK leucocytes of gilthead seabream showed a statistically significant increase in specimens treated for 14 days with the highest OTC concentration. Similarly, the respiratory burst of spleen phagocytes of rainbow trout fed orally with oxolinic acid was significantly stimulated (Siwicki et al., 1989), while this activity was slightly depressed in rainbow trout immunized with a commercial oil-based divalent (furunculosis/vibriosis) vaccine and fed orally simultaneously with OTC (Lundén et al., 1998). Furthermore, the effect produced by OTC and other antibacterial agents (e.g. oxolinic acid, florfenicol and sulphadiazine in combination

1

4 mg OTC g-1 feed 8 mg OTC g-1 feed

Fold increase

0.5

0

-0.5

-1 7

14

21

Time (days) Fig. 4. Phagocytic capacity of HK leucocytes of gilthead seabream specimens. Phagocytic capacity of HK leucocytes of gilthead seabream specimens fed with feed supplemented with two doses of OTC (4 and 8 mg g− 1 of feed, respectively) for the sampling days 7, 14 and 21. The bars represent the means ± s.e. (n = 5).

10

Fold increase

Fig. 3. Percentage phagocity ability of HK leucocytes of gilthead seabream specimens. Percentage phagocity ability of HK leucocytes of gilthead seabream specimens fed with feed supplemented with two doses of OTC (4 and 8 mg g− 1 of feed, respectively) for the sampling days 7, 14 and 21. The bars represent the means ± s.e. (n = 5). Asterisk denotes significant differences between control and treatment groups (P ≤ 0.05).

B

1

0,1

0,01

MCH-II

C3

IL-1β

COX-2

BD

Fig. 5. Expression of immune-relevant genes determined by real-time PCR in HK of gilthead seabream. A: Expression of immune-relevant genes determined by real-time PCR in HK of gilthead seabream fed with feed supplemented with 4 (white bars) and 8 (black bars) mg of OTC g− 1 of feed for the sampling day 7. The bars represent the means ± s.e. (n = 5). B: Expression of immune-relevant genes determined by real-time PCR in HK of gilthead seabream fed with feed supplemented with 4 (white bars) and 8 (black bars) mg of OTC g− 1 of feed for the sampling day 21. The bars represent the means± s.e. (n = 5).

with trimethoprim) on cellular activities (the respiratory burst and phagocytosis) in rainbow trout was much higher when cells were exposed to the drugs in vivo than in vitro. This indicates that the modulatory effect results from the integrated properties of the drug and its metabolites in the cell or in the whole organism rather than from the direct effect of the parent compound (Lundén et al., 2002). More studies are needed to know if similar conclusions could be demonstrated in gilthead seabream. Regarding other tested cellular immune activity, phagocytosis is considered to be the main cellular process involved in the elimination of damaged cells and microorganisms (Esteban and Meseguer, 1994; Finco-Kent and Thune, 1987; Olivier et al., 1985). Phagocytic ability and capacity of HK leucocytes of gilthead seabream also increased after the administration of OTC being the increment observed statistically significant for the phagocytic ability of leucocytes isolated from specimens fed the lower concentration of OTC for 7 days. The phagocytic ability and capacity of HK leucocytes were also stimulated after treatment for 5 weeks with levamisole in the same fish species (Mulero et al., 1998). After phagocytosis of microorganisms, leucocytes release their granule content (including a wide variety of cytotoxic agents, such as lysosomal enzymes, oxygen metabolites, and cytotoxic proteins, used to kill pathogens) into the phagosomes (Ortuño et al., 2000; Torreilles et al., 1996). Among the lysosomal enzymes released by leucocytes, two peroxidases (myeloperoxidase (MPO) and eosinophil peroxidase (EPO)) have been widely reported to act as very important microbicidal agents in mammals (Rodríguez et al., 2003). The oral administration of both concentrations of OTC used in this study also produced a slightly increase in the peroxidase activity of HK leucocytes in specimens treated for 7 and 14 days, while the specimens sampled after 21 days of treatment showed a slight decrease for both doses of OTC with respect to data obtained for leucocytes specimens of the control group. The results confirm the hypothesis that the OTC effects

56

F.A. Guardiola et al. / Aquaculture 334–337 (2012) 51–57

100

could provoke statistically significant changes, and perhaps the down-regulation of such genes could be the responsible of the immunedepression observed in some previous works although further studies are needed to confirm this hypothesis. Similarly, the expression of genes in the gut revealed slight variations in gene expression, as observed in HK. Nevertheless, it is to highlight the statistically significant decrease of C3 at 7 days of treatment with OTC. The complement is responsible for various immune functions including elimination of invading pathogens, promotion of inflammatory responses, and clearance of apoptotic cell and necrotic cell debris, in addition to modulation of adaptive immune responses (Le Friec and Kemper, 2009; Walport, 2001) for that reasons, a decrease of C3 gene expression could imply a compromise of the fish innate immune response. The present results demonstrate a decrease in C3 gene expression in gut after short periods of OTC administration, which agrees with the results previously shown regarding humoral immune activity. These results seem to support the fact that administration time is important for OTC to achieve the desired effects.

A Fold increase

10

1

0,1 *

*

0,01

B Fold increase

10

1

5. Conclusion

0,1

0,01 MCH-II

C3

IL-1β

COX-2

BD

Fig. 6. Expression of immune-relevant genes determined by real-time PCR in gut of gilthead seabream. A: Expression of immune-relevant genes determined by real-time PCR in gut of gilthead seabream fed with feed supplemented with 4 (white bars) and 8 (black bars) mg of OTC g− 1 of feed for the sampling day 7. The bars represent the means ± s.e. (n = 5). Asterisks denote significant differences between control and treatment. B: Expression of immune-relevant genes determined by real-time PCR in gut of gilthead seabream fed with feed supplemented with 4 (white bars) and 8 (black bars) mg of OTC g− 1 of feed for the sampling day 21. The bars represent the means ± s.e. (n = 5). Asterisks denote significant differences between control and treatment.

on immune parameters depend on both, the doses and the administration time. The bioavailability, absorption and elimination of the OTC could help to understand the observed effects on immune cell activities. Concretely, Rigos et al. (2003) demonstrated that the bioavailability of OTC following oral administration in aqueous suspension to gilthead seabream specimens is low, although OTC was found in the plasma. The absorption of OTC was found to be slow but well distributed throughout the body and the antibiotic was also eliminated slowly (Elema et al., 1996). According to this work, it may be assumed that in the present study, the OTC has reached cells of the immune system located in different organs (including the head-kidney) and that we observe the effects of the presence of OTC on the activity of these cells. More studies are needed to understand the pharmacokinetics, and toxicological (ecotoxicity and genotoxicity) and pathological effects of OTC in this important fish species with highest rate of production in Mediterranean mariculture. Not many genes have been identified in the seabream and a panel of immune-relevant genes were selected, including those responsible for (i) the pro-inflammatory process (interleukin-1b (IL1β), ciclooxigenase-2 (COX-2)); (ii) the innate immune receptor major histocompatibility complex (MHC) class IIα, which is implied in the immune defense against pathogens; (iii) the complement component 3 (C3): and (iv) the antimicrobial peptide β-defensin (BD). The expression of these genes has been studied in HK (as the main haemopoietic organ) (Cuesta et al., 2011) and gut (as one of the main infection routes in fish) (Ringø et al., 2004). The expression of genes in HK after the administration of OTC (with both concentrations) does not produce any statistically significant effect although there is a general down-regulation tendency in all the studied genes at 21 days. The administration of OTC at longer times

The present results indicate that OTC interferes with immune mechanisms in gilthead seabream, inducing a decrease in the humoral innate immune parameters and an increase in the cellular parameters; futhermore, provokes a decrease in the C3 gene expression in gut. There is a need for additional information to understand and clarify an appropriate use of OTC in Mediterranean farmed species to further improve treatment efficacy. Acknowledgments This work was funded by grants from the Ministerio de Ciencia e Innovación (AGL2008-05119-C02-01, Spain) and Fundación Séneca (04538/GERM/06). References Bayne, C.J., Levy, S., 1991. Modulation of the oxidative burst in trout myeloid cells by adrenocorticotropic hormone and catecholamines: mechanisms of action. Journal of Leukocyte Biology 50, 554–560. Bergsjø, T., Nafstad, I., Ingebrigtsen, K., 1979. The distribution of 35S-sulfadiazine and 14 C-trimethoprim in rainbow trout Salmo gairdneri. Acta Veterinaria Scandinavica 20, 102–109. Björklund, H., Bylund, G., 1990. Temperature-related absorption and excretion of oxytetracycline in rainbow trout (Salmo gairdneri R.). Aquaculture 84, 363–372. Björklund, H., Bondestam, J., Bylund, G., 1990. Residues of oxytetracycline in wild fish and sediments from fish farms. Aquaculture 86, 359–368. Bogert van den, C., Kroon, M., 1982. Effects of oxytetracycline on in vivo proliferation and differentiation of erythroid and lymphoid cells in rat. Clinical and Experimental Immunology 50, 327–335. Coyne, R., Smith, P., Moriarty, C., 2001. The fate of oxytetracycline in the marine environment of a salmon cage farm. Marine Environment and Health Series No: 3. Cuesta, A., Meseguer, J., Esteban, M.A., 2004. Total serum immunoglobulin M levels are affected by immunomodulators in seabream (Sparus aurata L.). Veterinary Immunology and Immunopathology 101, 203–210. Cuesta, A., Meseguer, J., Esteban, M.A., 2011. Molecular and functional characterization of the gilthead seabream β-defensin demonstrate its chemotactic and antimicrobial activity. Molecular Immunology 48, 1432–1438. Donowitz, G.R., 1994. Tissue-directed antibiotics and intracellular parasites: complex interaction of phagocytes, pathogens and drugs. Clinical Infectious Diseases 19, 926–930. Elema, M.O., Hoff, K.A., Kristensen, H.G., 1996. Bioavailability of oxytetracycline from medicated feed administered to atlantic salmon (Salmo salar L.) in seawater. Aquaculture 143, 7–14. Enis, Y.M., Mişe, Y.S., Silici, S., 2011. Protective effect of propolis against oxidative stress and immunosuppression induced by oxytetracycline in rainbow trout (Oncorhynchus mykiss, W.). Fish & Shellfish Immunology 31, 318–325. Esteban, M.A., Meseguer, J., 1994. The phagocytic defence mechanism in sea bass (Dicentrarchus labrax L.): an ultrastructural study. The Anatomical Record 240, 589–597. Esteban, M.A., Mulero, V., Muñoz, J., Meseguer, J., 1998. Methodological aspects of assessing phagocytosis of Vibrio anguillarum by leucocytes of gilthead seabream (Sparus aurata L.) by flow cytometry and electron microscopy. Cell and Tissue Research 293, 133–141. Finco-Kent, D., Thune, R.L., 1987. Phagocytosis by catfish neutrophils. Journal of Fish Biology 31A, 41–49.

F.A. Guardiola et al. / Aquaculture 334–337 (2012) 51–57 Grondel, J.L., Nouws, J.F.M., Muiswinkel van, W.B., 1987a. The influence of antibiotics on the immune system: immuno-pharmakokinetic investigations on the primary anti-SRBC response in carp, Cyprinus carpio L., after oxytetracycline injection. Journal of Fish Diseases 10, 35–43. Grondel, J.L., Nouws, J.F.M., Jong de, M., Schutte, A.R., Driessens, F., 1987b. Pharmacokinetics and tissue distribution of oxytetracycline in carp, Cyprinus carpio L., following different routes of administration. Journal of Fish Diseases 10, 153–163. Halling-Sørensen, B., 1998. Occurrence, fate and effects of pharmaceutical substances in the environment–a review. Chemosphere 36 (2), 357–393. Hand, W.L., Hand, D.L., King-Thompson, N.L., 1990. Antibiotic inhibition of the respiratory burst response in human polumorphonuclear leukocytes. Antimicrobial Agents and Chemotherapy 5, 863–870. Herman, R.L., Collis, D., Bullock, G.L., 1969. Oxytetracycline residues in different tissues of trout. U.S. Fish Wildlife Service Technical Paper 37. Horsberg, T.E., Berge, G.N., 1986. Medikamentell behandling av oppdrettsfisk (Pharmacotherapeutics in fish farming–a review). Nor. Vet. Tidsskr. 98, 805–812. Horsberg, T.E., Martinsen, B., Varma, K.J., 1994. The distribution of 14C-florfenicol in Atlantic salmon (Salmo salar). Aquaculture 122, 97–106. Jerbi, M.A., Ouanes, Z., Besbes, R., Achour, L., Kacem, A., 2011. Single and combined genotoxic and cytotoxic effects of two xenobiotics widely used in intensive aquaculture. Mutation Research 724, 22–27. Kroon, A.M., De Jong, L., 1979. The use of antibiotics to study mitochondrial protein synthesis. Methods in Enzymology 56, 29. Le Friec, G., Kemper, C., 2009. Complement: coming full circle. Archivum Immunologiae et Therapiae Experimentalis 57 (6), 393–407. Lunden, T., Bylund, G., 2000. The influence of in vitro and in vivo exposure to antibiotics on mitogen-induced proliferation of lymphoid cells in rainbow trout (Oncorhynchus mykiss). Fish & Shellfish Immunology 10, 395–404. Lundén, T., Miettinen, S., Lönnström, L.G., Lilius, E.M., Bylund, G., 1998. Influence of oxytetracycline and oxolinic acid on the immune response of rainbow trout (Oncorhynchus mykiss). Fish & Shellfish Immunology 3, 217–230. Lundén, T., Lilius, E.M., Bylund, G., 2002. Respiratory burst activity of rainbow trout (Oncorhynchus mykiss) phagocytes is modulated by antimicrobial drugs. Aquaculture 207, 203–212. Miranda, C.D., Zemelmen, R., 2002. Bacterial resistence to oxytetracycline in Chilean salmon farming. Aquaculture 212, 31–47. Mulero, V., Esteban, M.A., Muñoz, J., Meseguer, J., 1998. Dietary intake of levamisole enhances the immune response and disease resistance of the marine teleost gilthead seabream (Sparus aurata L.). Fish & Shellfish Immunology 8, 49–62. Nikolaev, A.I., Nazarmukhamedova, M.N., 1974. Effect of streptomycin and oxytetracycline on the number of antibody forming cells and haemagglutinin titre in immunized animals. Zhurnal Mikrobiologii, Epidemiologii, i Immunobiologii 8, 93. Olivier, G., Evelyn, T.P.T., Lallier, R., 1985. Immunity to Aeromonas salmonicida in coho salmon (Oncorhynchus kisutch) induced by modified Freund's complete adjuvant: its non-specific nature and probable role of macrophages in the phenomenon. Developmental and Comparative Immunology 9, 419–432.

57

Ortuño, J., Esteban, M.A., Mulero, V., Meseguer, J., 1998. Methods for studying the haemolytic, chemoattractant and opsonic activities of seabream (Sparus aurata L.) serum. Methodology in fish diseases research. Albion Press, pp. 97–100. Ortuño, J., Esteban, M.A., Meseguer, J., 2000. High dietary intake of α-tocopherol acetate enhances the non-specific immune response of gilthead seabream (Sparus aurata L.). Fish & Shellfish Immunology 10, 293–307. Quade, M.J., Roth, J.A., 1997. A rapid, direct assay to measure degranulation of bovine neutrophil primary granules. Veterinary Immunology and Immunopathology 58, 239–248. Reja, A., Moreno, L., Serrano, J.M., Santiago, D., Soler, F., 1996. Concentration-time profiles of oxytetracycline in blood, kidney and liver or tench (Tinca tinca L) after intramuscular administration. Veterinary and Human Toxicology 38, 344–347. Rigos, G., Nengas, I., Tyrpenou, A.E., Alexis, M., Toisi, G.M., 2003. Pharmacokinetics and bioavailability of oxytetracycline in gilthead seabream (Sparus aurata) after a single dose. Aquaculture 221, 75–83. Rijkers, G.T., Teunissen, A.G., Oosterom van, R., Muiswinkel van, W.B., 1980. The immune system of cyprinid fish: the immunosuppressive effect of the antibiotic oxytetracycline in carp (Cyprinus carpio L.). Aquaculture 19, 177–189. Rijkers, G.T., Oosterom van, R., Muiswinkel van, W.B., 1981. The immune system of cyprinid fish. Oxytetracycline and the regulation of humoral immunity in carp (Cyprinus carpio L). Veterinary Immunology and Immunopathology 2, 281–290. Ringø, E., Jutfelt, F., Kanapathippillai, P., Bakken, Y., Sundell, K., Glette, J., Mayhew, T.M., Myklebust, R., Olsen, R.E., 2004. Damaging effect of the fish pathogen Aeromonas salmonicida ssp. salmonicida on intestinal enterocytes of Atlantic salmon (Salmo salar L.). Cell and Tissue Research 318, 305–311. Rodríguez, A., Esteban, M.A., Meseguer, J., 2003. Phagocytosis and peroxidase release by seabream (Sparus aurata L.) leucocytes in response to yeast cells. The Anatomical Record 272A, 415–423. Serezli, R., Cagirgan, H., Okumus, I., Akhan, S., Balta, F., 2005. The effect of oxytetracycline on non-specific immune response in sea bream (Sparus aurata L. 1758). Turkish Journal of Veterinary and Animal Sciences 29, 31–35. Siwicki, A.K., Anderson, D.P., Dixon, O.W., 1989. Comparisons of nonspecific and specific immunomodulation by oxolinic acid, oxytetracycline and levamisole in salmonids. Veterinary Immunology and Immunopathology 23, 195–200. Taffalla, C., Novoa, B., Alvarex, J.M., Figueras, A., 1999. In vivo and in vitro effect of oxytetracycline treatment on the immune response of turbot, Scophthalmus maximus (L.). Journal of Fish Diseases 2, 271–276. Thong, Y.H., Ferrante, A., 1980. Effect of tetracyline treatment on immunological responses in mice. Clinical and Experimental Immunology 39, 728. Torreilles, J., Guérin, M.C., Roch, P., 1996. Espéces oxygénées réactives et systémes de défense des bivalves marins. CR. Acad. Sci. 319, 209–218. Treves-Brown, K.M., 2000. Applied fish pharmacology. Kluwer Academic Publishers, London. Ueno, R., Kinoshita, A., Wakabayashi, J., 2004. Comparative pharmacokinetics of oxytetracycline in eel and its fate in a closed aquatic environment. Aquaculture 235, 53–63. Walport, M.J., 2001. Complement. First of two parts. The New England Journal of Medicine 344 (14), 1058–1066.