Induction of immune responses in mice by a DNA vaccine encoding Cryptosporidium parvum Cp12 and Cp21 and its effect against homologous oocyst challenge

Veterinary Parasitology 172 (2010) 1–7

Contents lists available at ScienceDirect

Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar

Induction of immune responses in mice by a DNA vaccine encoding Cryptosporidium parvum Cp12 and Cp21 and its effect against homologous oocyst challenge Qinlei Yu a,b , Jianhua Li a,∗ , Xichen Zhang a,∗ , Pengtao Gong a , Guocai Zhang a , Shuhong Li c , Huitang Wang d a

College of Animal Science and Veterinary Medicine, Jilin University, 5333 Xi’an Road, Changchun 130062, China Jilin Provincial Animal Disease Control Center, Changchun 130062, China c Norman Bethune College of Medical Science, Jilin University, Changchun 130062, China d School of Science and Technology, Changchun University of Science and Technology, 11 Floor, Science and Technology Building-B, Weixing Road 7186, Changchun 130012, China b

a r t i c l e

i n f o

Article history: Received 1 July 2009 Received in revised form 19 April 2010 Accepted 27 April 2010 Keywords: Cryptosporidium parvum Cp12 Cp21 pVAX1

a b s t r a c t Cp12 and Cp21 surface proteins on the sporozoite of Cryptosporidium parvum have been identified as the immunodominant antigens involved in the immune response to C. parvum infection. In the present study, the efficacy of Cp12 and Cp21 antigens as vaccine candidates was investigated in BALB/c mice that were susceptible to C. parvum infection. DNA sequences of Cp12, Cp21, Cp12-Cp21, and C (CpG oligodeoxynucleotide (ODN))-Cp12-Cp21 were amplified and then cloned into pVAX1 vector to form the four recombinant plasmids pVAX1-Cp12, pVAX1-Cp21, pVAX1-Cp12-Cp21, and pVAX1-C-Cp12-Cp21. Recombinant protein expression from these four plasmids in HeLa cells were confirmed by indirect immunofluorescence staining and Western blot analysis. The in vivo efficacies of the four DNA vaccines were tested in BALB/c mice. The results indicated that the four DNA vaccines elicited significant antibody responses and specific cellular responses when compared to control mice that received vector only or PBS. Among those four plasmids, pVAX1-C-Cp12Cp21 elicited significantly higher levels of IgG. Also, the percentages of CD4+ and CD8+ T cells were significantly higher in the group with pVAX1-C-Cp12-Cp21 nasal sprays. Their efficacy in immunoprotection against homologous challenge was also detected after administration of the four DNA vaccines. The results showed that mice in the pVAX1-C-Cp12-Cp21 nasal group had a 77.5% reduction in the level of oocyst shedding and a significant difference was detected when this group was compared with the pVAX1, PBS, pVAX1-Cp12, and pVAX1-Cp21 groups. The reduction in the level of oocysts shedding from the group of pVAX1-C-Cp12-Cp21 nasal spray was also higher than that of pVAX1-Cp12-Cp21 group. These results suggested that C-Cp12-Cp21-DNA may provide an effective means of eliciting humoral and cellular responses and generating protective immunity against C. parvum infections in BALB/c mice. © 2010 Elsevier B.V. All rights reserved.

∗ Corresponding authors. Tel.: +86 431 87981351; fax: +86 431 87981351. E-mail addresses: [email protected] (J. Li), [email protected] (X. Zhang). 0304-4017/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2010.04.036

2

Q. Yu et al. / Veterinary Parasitology 172 (2010) 1–7

1. Introduction

2.2. Plasmid DNA construction

The genus Cryptosporidium is comprised of obligate enteric protozoan parasites in phylum Apicomplexa represented by fourteen species with various host specificities (Xiao et al., 2004; Cacciò, 2005). C. parvum, which infects the gastrointestinal tract of animals and humans, is important (O’Donoghue, 1995; Rose et al., 2002). C. parvum infects the gastrointestinal epithelium to cause a self-limited diarrhea in immunocompetent subjects but potentially life threatening in immunocompromised individuals, such as AIDS patients (Nime et al., 1976; O’Donoghue, 1995; Chen and LaRusso, 2000). Vaccination against C. parvum has been tested in ruminants aiming to generate hyperimmune colostrum which contains antibodies that may be effective in passive immunotherapy against cryptosporidiosis in the young. Screening for antigens of C. parvum, which can elicit protective antibodies, is important in developing strategies for vaccine development (Doyle et al., 1993; Belli et al., 2005). Surface proteins have been known to play a role in motility, attachment, as well as host invasion. Research works on P23 and Cp15 antigens suggest that they are very promising candidates for vaccine development (Jenkins, 2004). Consequently, research efforts have been focused on identification of novel vaccine targets to find alternative strategies against cryptosporidiosis. Recently, Cp12 and Cp21 surface proteins on the sporozoite of C. parvum have been identified as the immunodominant antigens involved in the immune response to C. parvum infection (Yao et al., 2007). In the present study, Cp12 and Cp21 antigens were investigated as vaccine candidates in BALB/c mice, which are susceptible to C. parvum infection, and evaluate its biological activity, so as to control cryptosporidiosis in the future.

The recombinant eukaryotic expression vectors pVAX1Cp12, pVAX1-Cp21, pVAX1-Cp12-Cp21, and pVAX1-CCp12-Cp21 were constructed by inserting the corresponding DNA fragments into the pVAX1 expression vector and confirmed by PCR and restriction endonuclease digestions. The resultant DNA plasmids were named as Cp12-DNA vaccine, Cp21-DNA vaccine, Cp12-Cp21-DNA vaccine, and C-Cp12-Cp21-DNA vaccine.

2. Materials and methods

2.3. Cell culture and transfection HeLa cells, obtained from Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, were incubated at 37 ◦ C in a 5% CO2 incubator in RPMI 1640 supplemented with 10% FBS, 10 mM HEPES, 2 mM l-glutamine, 100 U/ml penicillin, 100 ␮g/ml streptomycin. The day before transfection, cells were seeded in a six-well plate at 3 × 105 cells per well. The cells were transfected the next day with pVAX1, pVAX1-Cp12, pVAX1-Cp21, pVAX1-Cp12-Cp21, and pVAX1-C-Cp12-Cp21 using the lipofectamine 2000 reagent (Invitrogen, Rockville, MD). After 48 h, the transfected cells were selected in medium supplemented with 500 ␮g/ml of G418 (Promega) for 15 days. The selected cells were then selected in culture medium with 300 ␮g/ml of G418 till individual cell clones were formed. 2.4. Immunofluorescence staining HeLa cells (4 × 105 ) selected for pVAX1-Cp12, pVAX1Cp21, pVAX1-Cp12-CP21, and pVAX1-C-Cp12-Cp21 were cultured on glass coverslips for 48 h. The coverslips were then washed with 0.01 M PBS and fixed in 100% acetone for 30 min at room temperature. After washed with 0.01 M PBS, coverslips were stained with mouse anti-C. parvum serum followed by fluorescein isothiocyanate (FITC) labeled goat anti-mouse IgG. Cells were analyzed under a fluorescence microscope. HeLa cells transfected with pVAX1 served as the negative control cells.

2.1. Amplification of DNA fragments by polymerase chain reaction

2.5. Western blotting

The four DNA fragments were amplified by PCR according to the nucleotide sequences of Cp12 and Cp21 of C. parvum deposited in GenBank (GenBank accession numbers: XM 625821.1 for Cp12 and XM 626459.1 for Cp21), the booster sequence was numbered 1826(CpG oligodeoxynucleotide (ODN)). The specific primers used for the PCR reactions were shown in Table 1. The C-Cp12DNA was amplified using a forward primer (E1) containing the booster sequence encoding for CpG-ODN(“1826 (5 TCCATGACGTTCCTGACGTT)”). Also, the Cp21 DNA was amplified using a forward primer (D2) containing a synthetic linker sequence encoding for the peptide (G-G-S). The PCR conditions (DNA amplified meter; Biometra, Germany) were 94 ◦ C 3 min, 30 cycles of 94 ◦ C for 45 s, 48 ◦ C for 55 s, 72 ◦ C for 1 min, with an extension at 72 ◦ C for 10 min. The amplified DNA fragments were cloned into pMD18-T vector and the sequences verified.

The transfected HeLa cells (4 × 105 ) were seeded into 6-well plates. Cells were collected on ice after 48 h of culture. The cells were first washed twice with ice-cold PBS and then re-suspended in 40 ␮l of lysis buffer (50 mM Tris (pH 7.6), 150 mM NaCl, 5 mM EDTA (pH 8.0), 0.6% Nonidet P-40, 50 mM Na3 VO4 , 20 mM ␤-glycerophosphate, 1 mM phenylmethylsulfonyl fluoride, 2 mM p-nitrophenyl phosphate, and 1:25 Complete Mini Protease Inhibitor cocktail) (Boehringer, Mannheim, Germany). After the lysates were incubated on ice for 30 min, they were centrifuged (12,000 × g at 4 ◦ C) for 5 min to obtain the cytosolic fraction. Samples were separated by SDS-PAGE electrophoresis and transferred to a polyvinylidene difluoride (PVDF) membrane. The blots were then washed in Tris–Tween-buffered saline [TTBS, 20 mM Tris–HCl buffer, pH 7.6, 137 mM NaCl and 0.05% (vol/vol) Tween 20], blocked overnight with 5% (wt/vol) nonfat dry milk, and

Q. Yu et al. / Veterinary Parasitology 172 (2010) 1–7

3

Table 1 The sequence of primers.

probed with mouse anti-C. parvum serum (1:100) and a secondary goat anti-mouse IgG conjugated with alkaline phosphatase. Signals were detected using ECL plus regent (GE Healthcare).

Two hundred 5–7-week-old BALB/c mice (18–22 g) were randomly divided into 10 groups. Mice in different groups were immunized at weeks 0, 3, and 5 with different schemes as shown in Table 2.

detection of immunofluorescence and Western blotting. For serum IgG ELISA, wells of a microtiter plate were coated with crude C. parvum antigens overnight at 4 ◦ C, washed three times with PBS-T, blocked with 10% nonfat dry milk in PBS, and then incubated with serial dilutions of sera in 1% BSA in PBS at 37 ◦ C for 1 h. The plates were washed and incubated with the peroxidase-conjugated goat antimouse IgG antibody (1:1000) at 37 ◦ C for 1 h. After washing, the OPD substrate was added to wells and the reaction was stopped by 2 M sulfuric acid after color development. The plates were read at A490 .

2.7. Serum antibody responses in DNA vaccinated mice

2.8. Cellular immune response induced by DNA vaccines

Serum samples were collected from venous plexus of mice tails before and after treatments and were stored at −20 ◦ C. Besides, the serum samples collected on the seventh week were used as another secondary antibody in the

The mice were killed 20 days after the last immunization. Lymphocyte subsets were analyzed as described previously (Aleixo et al., 1995). Briefly, freshly isolated splenocytes (1–2 million) were washed and re-suspended

2.6. DNA immunization protocol

Table 2 Comparison of the percentage of CD4+ , CD8+ T cells in each group (n = 10). Groups

Immune dose/times

CD4+ /%

pVAX1-CP12 musculature (A) pVAX1-CP21 musculature (B) pVAX1-CP12 nasal (C) pVAX1-CP21 nasal (D) pVAX1-CP12-CP21 musculature (E) pVAX1-C-CP12-CP21 musculature (F) pVAX1-CP12-CP21 nasal (G) pVAX1-C-CP12-CP21 nasal (H) pVAX1 (I) PBS (J)

100 ␮g/3 100 ␮g/3 100 ␮g/3 100 ␮g/3 100 ␮g/3 100 ␮g/3 100 ␮g/3 100 ␮g/3 100 ␮g/3 0.1 ml/3

30.4 29.15 35.3 34.2 32.4 33.3 36.9 39.1 21.25 19.05

± ± ± ± ± ± ± ± ± ±

CD8+ /% 0.42 0.919 0.141 0.283 0.283 0.283* 1.91 0.707*,# 0.778 0.629

13.75 13.15 15.65 16.25 14.2 13.75 16.05 15.3 15.87 11.35

± ± ± ± ± ± ± ± ± ±

0.495 0.91 0.212 1.061 0.424 0.071 0.50 0.566*,# 0.325 1.202

Percentage of CD4+ : *P < 0.01 as compared with groups A, B, C, D, I, J; # P < 0.05 as compared with group F. Percentage of CD8+ : *P < 0.01 as compared with group J; # P < 0.05 as compared with group F.

4

Q. Yu et al. / Veterinary Parasitology 172 (2010) 1–7

in FACS buffer (phosphate-buffered saline with 5% fetal calf serum, and 0.1% sodium azide). Cells were stained with optimal concentrations of FITC conjugated antiimmunoglobulin (Ig) antibody (100 ␮g/ml), PE conjugated anti-CD4 antibody (5 ␮g/ml), PE conjugated anti-CD8 antibody (12.5 ␮g/ml) (PharMingen, San Diego, CA). Cells were incubated at 4 ◦ C for 20 min washed by PBS, and finally detected by flow cytometry (FACSan; Becton-Dickinson Immunocytometry Systems, Mountain View, CA). 2.9. Protective effect of the four DNA vaccines against C. parvum oocysts challenges Each mouse was orally inoculated with 1 × 106 C. parvum oocysts in 0.5 ml of water 2 weeks after the last immunization. Samples of feces were collected every 2 days from the day of inoculation to the 21 days after inoculation. 0.25 g of feces from each mouse was homogenized with 750 ␮l of water. Sheather sucrose solution (4 ml) was then added to each sample and mixed. Oocysts in each fece sample were counted in a cell counter (Sagodira et al., 1999a,b). 2.10. Statistical analysis Statistical analysis was performed using SPSS 14.0 software for variance (ANOVA) and Duncan’s multiple ranges. P < 0.05 was considered statistically significant. 3. Results 3.1. Plasmid DNA construction In order to construct the recombinant plasmids, we designed the recombinant plasmid as Fig. 1. All of the DNA fragments encoding individual genes were first amplified by PCR. Expression plasmids pVAX1-Cp12, pVAX1-Cp21, pVAX1-Cp12-Cp21, and pVAX1-C-Cp12-Cp21 carrying respective DNA fragment were constructed by standard recombinant DNA techniques. 3.2. Immunofluorescence staining HeLa cells were transfected with the recombinant plasmids pVAX1-Cp12, pVAX1-Cp21, pVAX1-Cp12-Cp21, and pVAX1-C-Cp12-Cp21. The expression of the fusion proteins were detected by Immunofluorescence staining with

Fig. 1. Strategy of the recombinant plasmid pVAX1-C-Cp12-Cp21 construction. The Cp12-DNA and Cp21-DNA fragments were cloned and inserted into the pVAX1 at the sites of BamHI and XhoI. A linker sequence encoding a peptide (G-G-S) was inserted between the Cp12 and Cp21.

mouse anti-C. parvum serum and fluorescence labeled goat anti-mouse IgG. Strong green fluorescence was observed under a fluorescence microscope for cells transfected with the recombinant plasmids, not for cells transfected with pVAX1 vector. The results suggested that plasmids pVAX1-Cp12, pVAX1-Cp21, pVAX1-Cp12-Cp21, and pVAX1-C-Cp12-Cp21 have been successfully expressed in HeLa cells (Fig. 2). In addition, the antibodies specific to Cp12 and Cp21 in immunofluorescence were collected on the seventh week, and the results were consistent with the utilization of mouse anti-C. parvum sera. 3.3. Western blotting Western blot analysis using mouse anti-C. parvum serum and AP-labeled goat anti-mouse IgG showed that transfection of Hela cells with different plasmids resulted in the expressions of the expected recombinant protein bands (Cp12, 12 kD; Cp21, 21 kD; Cp12-Cp21, 33 kD and C-Cp12-Cp21, 33 kD), whereas no band was detected from cells transfected with pVAX1 vector (Fig. 3). In addition, the antibodies specific to Cp12 and Cp21 in Western analyses

Fig. 2. Indirect fluorescence technique detected target fragments expression in HeLa cells transfected with recombinant plasmids. The production of recombinant plasmids were assessed by IFE using polyclonal mouse antibody. Both the anti-C. parvum serum and the positive serum collected from experimental mice in the seventh week after inoculation could react with lysate of C. parvum oocysts, and could use to immunofluorescence. (A) HeLa cells transfected with pVAX1-Cp12; (B) HeLa cells transfected with pVAX1-Cp21; (C) HeLa cells transfected with pVAX1-Cp12-Cp21; (D) HeLa cells transfected with pVAX1-C-Cp12-Cp21; (E) HeLa cells transfected with the vector pVAX1 as negative control.

Q. Yu et al. / Veterinary Parasitology 172 (2010) 1–7

5

Fig. 3. Western blotting assay of the secretion of recombinant proteins in transfected HeLa cells. The production of recombinant proteins were assessed by immunoblot analysis using polyclonal mouse antibody. Both the anti-C. parvum serum and the positive serum collected from experimental mice in the seventh week after inoculation could react with lysate of C. parvum oocysts, and could use to Western blotting. (A) N: negative control; 1: cell culture containing Cp12 fusion protein of 12 kD. (B) N: negative control; 1: cell culture containing Cp21 fusion protein of 21 kD s. (C) N: negative control; 1: cell culture containing Cp12-Cp21 fusion protein of 33 kD; 2: cell culture containing C-Cp12-Cp21 fusion protein of 33 kD. The molecular sizes of the proteins are labeled on the bottom.

were collected on the seventh week, and the results were consistent with the utilization of mouse anti-C. parvum sera.

3.4. Serum antibody responses in DNA vaccinated mice Specific antibody against C. parvum was detected in the experimental mice after the recombinant plasmids immunization. Significantly higher level of IgG was detected in the pVAX1-C-Cp12-Cp21 nasal spray group when compared with groups immunized with pVAX1 vector and PBS (P < 0.01). The IgG level in the pVAX1-C-Cp12-Cp21 nasal spray group was also higher than that of pVAX1-Cp12, pVAX1-Cp21, and pVAX1-Cp12-Cp21 group but was not significant (Figs. 4 and 5).

Fig. 5. Antibody responses induce by four recombinant plasmids. BALB/c mice were immunized by nasal spray, and pVAX1 vector, PBS as control. Sera were collected and analyzed by ELISA. Each bar represented the mean OD (±S.E., n = 10), the significant difference of serum antibody titers was marked with the asterisk compared with PBS control (P < 0.05).

3.6. Protective effect of four DNA vaccines 3.5. Cellular immune response induced by DNA vaccines The spleen lymphocytes were examined by flow cytometry. The percentages of CD4+ T cells in pVAX1-CCp12-Cp21 nasal group were significantly higher than that in the groups treated with pVAX1 vector, PBS, pVAX1-Cp12, and pVAX1-Cp21 (P < 0.01). The percentages of CD8+ T cells in pVAX1-C-Cp12-Cp21 nasal spray group was significantly higher than that in the PBS group (P < 0.01) (Table 2).

Fig. 4. Antibody responses induce by four recombinant plasmids. BALB/c mice were immunized by musculature injection, and pVAX1 vector, PBS as control. Sera were collected and analyzed by ELISA. Each bar represented the mean OD (±S.E., n = 10), the significant difference of serum antibody titers was marked with the asterisk compared with PBS control (P < 0.05).

Mice were monitored for 21 days after the last immunization by examining the numbers and duration of parasite oocyst excretion. Mice in both pVAX1-Cp12-Cp21 and pVAX1-C-Cp12-Cp21 experimental groups excreted less numbers of oocysts than that in the pVAX1 vector, PBS, pVAX1-Cp12, and pVAX1-Cp21 groups (P < 0.05). Mice in the pVAX1-C-Cp12-Cp21 nasal spray group have a 77.5% reduction in the level of oocysts shedding (Figs. 6 and 7). The values observed from mice immunized with plasmids encoding C-CP12-CP21 were similar among groups immunized through either intramuscular or intranasal routes.

Fig. 6. Protective results of the mice immunized with recombinant plasmids against homology challenge. All the mice were infected with 1 × 106 C. parvum oocysts in the seventh week after immunization and their oocysts excretion was monitored for 21 days. Compared with the control group, experimental mice could partially prevent C. parvum infection.

6

Q. Yu et al. / Veterinary Parasitology 172 (2010) 1–7

Fig. 7. Protective results of the mice immunized with recombinant plasmids against homology challenge. All the mice were infected with 1 × 106 C. parvum oocysts in the seventh week after immunization and their oocysts excretion was monitored for 21 days. Compared with the control group, experimental mice could partially prevent C. parvum infection.

4. Discussion C. parvum is a major pathogen of diarrhea in human and young-rearing animals such as calves, lambs, and kids. Although many drugs have been tested against cryptosporidiosis, none has shown enough efficacy to be commercialized as a specific treatment for Cryptosporidium infections (Portnoy et al., 1984; Fichtenbaum et al., 1993; Mancassola et al., 1995). More and more researchers considered an immunological method a hopeful treatment to prevent cryptosporidiosis in the future. The researches indicated that multivalue fusion proteins containing different antigens were of good immunogenicity and would play an important role against parasite infection. In this study, Cp12 and Cp21 antigen were investigated as vaccine candidates in BALB/c mice. Our data shows that the four DNA vaccines induced significant antibody response as well as influenced cellular immune responses when compared with control mice, especially C-Cp12-Cp21-DNA. Furthermore, reduction in oocysts shedding was also significant, indicating a partial protection against C. parvum infection in BALB/c mice. Recent studies have shown that it is feasible to give DNA via the oral or the nasal mucosae. In addition, intranasal immunization with antigen generates specific antibody responses in external secretions and serum and also confers protection against infectious agents (Klavinskis et al., 1997; Sasaki et al., 1998; Sagodira et al., 1999a,b). Also nasal immunization of mice with C. parvum DNA induced systemic and intestinal immune responses. Our data shows that serum IgG level, the percentages of CD4+ T and CD8+ T cells were all elevated significantly in the nasal groups. The protective effect of the nasal spray group was also better than that of the muscle injected group. The recombinant plasmids containing the insert were successfully constructed. A linker sequence encoding a flexible peptide (G-G-S) was inserted between the CP12 and CP21 sequences to keep the CP12 and CP21 protein maintaining their natural configurations. Immunofluorescence and Western analyses collectively demonstrated that Cp12 and Cp21 were expressed in transfected eukaryotic host cells. The recombinant proteins could react with positive anti-C. parvum serum specifically. And the positive serum samples collected from the experimental mice in the

seventh week after inoculation with recombinant proteins also could recognize C. parvum ingredients corresponding to the 12 and 21 kDa proteins. Besides a specific immuno-enhancement sequence encoding CpG-ODN(1862) was inserted in front of the Cp12 sequences. The Cp12 and Cp21 DNA vaccines with CpG-ODN elicited stronger humoral and cellular immune responses compared with non CpG-ODN vaccines. Mice in the pVAX1-C-Cp12-Cp21 nasal group excreted less oocysts, which is a 77.5% reduction in the level of oocysts shedding. However, the recombinant plasmids could not prevent oocysts infection completely, for many reasons such as adjuvants, times and routes of immunization, suggesting that we must study the immunization mechanism against C. parvum infection in depth. Although current DNA vaccines cannot inhibit oocyst infection completely, the use of a recombinant plasmid containing the C. parvum surface antigen gene can induce specific immune responses and thus protect mice from challenge with oocysts according previous and present study (Sagodira et al., 1999a,b; Hong-Xuan et al., 2005; Ehigiator et al., 2007). The implications of a Cryptosporidium spp. vaccine to reduce incidence of cryptosporidiosis deserve further exploration which will subsequently reduce the risk of waterborne outbreaks.

Acknowledgments This work was supported by High Technology Research and Development Program (863) of China (No. 2006AA10A207), National Key Technology R & D Program of China (No. 2007BAD40B05) and National Natural Science Foundation of China (No. 30400324).

References Aleixo, L.F., Goodenow, M.M., Sleasman, J.W., 1995. Molecular analysis of highly enriched populations of T-cell-depleted monocytes. Clin. Diagn. Lab. Immunol. 2 (November (6)), 733–739. Belli, S.I., Walker, R.A., Flowers, S.A., 2005. Global protein expression analysis in apicomplexan parasites: current status. Proteomics 5, 918–924. Cacciò, S.M., 2005. Molecular epidemiology of human cryptosporidiosis. Parassitologia 47, 185–192. Chen, X.M., LaRusso, N.F., 2000. Mechanisms of attachment and internalization of Cryptosporidium parvum to biliary and intestinal epithelial cells. Gastroenterology 118, 368–379. Doyle, P.S., Crabb, J., Petersen, C., 1993. Anti-Cryptosporidium parvum antibodies inhibit infectivity in vitro and in vivo. Infect. Immun. 61, 4079–4084. Ehigiator, H.N., Romagnoli, P., Priest, J.W., Secor, W.E., Mead, J.R., 2007. Induction of murine immune responses by DNA encoding a 23-kDa antigen of Cryptosporidium parvum. Parasitol. Res. 101, 943–950. Fichtenbaum, C.J., Ritchie, D.J., Powderly, W.G., 1993. Use of paromomycin for treatment of cryptosporidiosis in patients with AIDS. Clin. Infect. Dis. 16, 298–300. Hong-Xuan, H., Lei, C., Cheng-Min, W., Kai, Z., Yi, T., Xi-Ming, Q., MingXing, D., 2005. Expression of the recombinant fusion protein CP15-23 of Cryptosporidium parvum and its protective test. J. Nanosci. Nanotechnol. 5, 1292–1296. Jenkins, M.C., 2004. Present and future control of cryptosporidiosis in humans and animals. Expert Rev. Vaccines 3, 669–671. Klavinskis, L., Gao, S., Barnfield, L.C., 1997. Mucosal immunisation with nucleic acid. Vaccine 15, 818–820. Mancassola, R., Reperant, J.M., Naciri, M., Chartier, C., 1995. Chemoprophylaxis of Cryptosporidium parvum infection with paromomycin in kids and immunological study. Antimicrob. Agents Chemother. 39, 75–78.

Q. Yu et al. / Veterinary Parasitology 172 (2010) 1–7 Nime, F.A., Burek, J.D., Page, D.L., Holscher, M.A., Yardley, J.H., 1976. Acute enterocolitis in a human being infected with the protozoan Cryptosporidium. Gastroenterology 70, 592–598. O’Donoghue, P.J., 1995. Cryptosporidium and cryptosporidiosis in man and animals. Int. J. Parasitol. 25, 139–195. Portnoy, D., Whiteside, M.E., MacLeod, C.L., 1984. Treatment of intestinal cryptosporidiosis with spiramycin. Ann. Intern. Med. 101, 202–204. Rose, J.B., Huffman, D.E., Gennaccaro, A., 2002. Risk and control of waterborne cryptosporidiosis. FEMS Microbiol. Rev. 26, 113–123. Sagodira, S., Iochmann, S., Mevelec, M.N., Dimier-Poisson, I., Bout, D., 1999a. Nasal immunization of mice with Cryptosporidium parvum DNA induces systemic and intestinal immune responses. Parasite Immunol. 21, 507–516.

7

Sasaki, S., Hamajima, K., Fukushima, J., 1998. Comparison of intranasal and intramuscular immunization against human immunodeficiency virus type 1 with a DNA-monophosphoryl lipid A adjuvant. Infect. Immun. 66, 823–826. Sagodira, S., Buzoni-Gatel, D., Iochmann, S., Naciri, M., Bout, D., 1999b. Protection of kids against Cryptosporidium parvum infection after immunization of dams with CP15-DNA. Vaccine 17, 2346–2355. Xiao, L., Fayer, R., Ryan, U., Upton, S.J., 2004. Cryptosporidium taxonomy: recent advances and implications for public health. Clin. Microbiol. Rev. 17, 72–97. Yao, L., Yin, J., Zhang, X., 2007. Cryptosporidium parvum: identification of a new surface adhesion protein on sporozoite and oocyst by screening of a phage-display cDNA library. Exp. Parasitol. 115, 333–338.