Influence of correlation between HLA-G polymorphism and Interleukin-6 (IL6) gene expression on the risk of schizophrenia

Cytokine xxx (xxxx) xxx–xxx

Contents lists available at ScienceDirect

Cytokine journal homepage: www.elsevier.com/locate/cytokine

Influence of correlation between HLA-G polymorphism and Interleukin-6 (IL6) gene expression on the risk of schizophrenia Venkataram Shivakumara,b, Monojit Debnathc, Deepthi Venugopala,c, Ashwini Rajasekarana,c, Sunil V. Kalmadya,b, Manjula Subbannaa,c, Janardhanan C. Narayanaswamya,b, ⁎ Anekal C. Amareshaa,b, Ganesan Venkatasubramaniana,b, a

Translational Psychiatry Laboratory, Neurobiology Research Centre, National Institute of Mental Health and Neurosciences, Bangalore, India Department of Psychiatry, National Institute of Mental Health and Neurosciences, Bangalore, India c Department of Human Genetics, National Institute of Mental Health and Neurosciences, Bangalore, India b

A R T I C L E I N F O

A B S T R A C T

Keywords: Schizophrenia HLA-G IL-6 Inflammation Infection Neurodevelopment

Converging evidence suggests important implications of immuno-inflammatory pathway in the risk and progression of schizophrenia. Prenatal infection resulting in maternal immune activation and developmental neuroinflammation reportedly increases the risk of schizophrenia in the offspring by generating pro-inflammatory cytokines including IL-6. However, it is not known how prenatal infection can induce immuno-inflammatory responses despite the presence of immuno-inhibitory Human Leukocyte Antigen-G (HLA-G) molecules. To address this, the present study was aimed at examining the correlation between 14 bp Insertion/Deletion (INDEL) polymorphism of HLA-G and IL-6 gene expression in schizophrenia patients. The 14 bp INDEL polymorphism was studied by PCR amplification/direct sequencing and IL-6 gene expression was quantified by using real-time RT-PCR in 56 schizophrenia patients and 99 healthy controls. We observed significantly low IL6 gene expression in the peripheral mononuclear cells (PBMCs) of schizophrenia patients (t = 3.8, p = .004) compared to the controls. In addition, schizophrenia patients carrying Del/ Del genotype of HLA-G 14 bp INDEL exhibited significantly lower IL6 gene expression (t = 3.1; p = .004) than the Del/Ins as well as Ins/Ins carriers. Our findings suggest that presence of “high-expressor” HLA-G 14 bp Del/ Del genotype in schizophrenia patients could attenuate IL-6 mediated inflammation in schizophrenia. Based on these findings it can be assumed that HLA-G and cytokine interactions might play an important role in the immunological underpinnings of schizophrenia.

1. Introduction Accumulating data from the recent genome wide association studies (GWAS) suggest contribution of common polygenic variation to the risk of schizophrenia [1,2]. In addition to genetic variation, risk of schizophrenia due to exposures to environmental adversities is widely appreciated [3,4]. This is evident from various gene-environment studies implicating immune related genes that play a crucial role in gene-environment interaction. This understanding has been supported by a largest ever GWAS that identified 108 schizophrenia associated genetic loci, of which majority have immune-related functions [2]. Amongst the immunity genes, the Major Histocompatibility Complex (MHC) as well as cytokine genes have been studied extensively in schizophrenia [5–7]. A recent study demonstrated that the functional alleles that were strongly implicated by schizophrenia GWAS was indeed represented by

⁎

genes within MHC locus of chromosome 6 [8]. The MHC and cytokine molecules have been demonstrated to regulate fundamental events of brain development such as neurite outgrowth, synapse formation, and plasticity [9–11]. However, altered expressions of these immune molecules were shown to have deleterious effects on the developing brain and subsequently increasing the risk of schizophrenia in the offspring [11–13]. Based on this understanding recently, immune-mediated neurodevelopmental origin of schizophrenia has been postulated as one of the predominant research paradigms of schizophrenia pathogenesis [14,15]. The human leukocyte antigen-G (HLA-G) is a non-classical MHC class-I molecule which predominantly possesses tolerogenic and antiinflammatory functions. It primarily suppresses the functioning of natural killer (NK) cells and cytotoxic T lymphocytes (CTLs) [16,17]. With its predominant expression at the feto-maternal interface, HLA-G

Corresponding author at: Department of Psychiatry, National Institute of Mental Health and Neurosciences, Hosur Road, Bangalore 560029, India. E-mail address: [email protected] (G. Venkatasubramanian).

https://doi.org/10.1016/j.cyto.2017.11.016 Received 2 March 2017; Received in revised form 14 October 2017; Accepted 27 November 2017 1043-4666/ © 2017 Elsevier Ltd. All rights reserved.

Please cite this article as: Shivakumar, V., Cytokine (2017), https://doi.org/10.1016/j.cyto.2017.11.016

Cytokine xxx (xxxx) xxx–xxx

V. Shivakumar et al.

first-degree relatives or had co-morbid substance abuse/dependence. History was elicited carefully to rule out any recent high grade fever/ infection within the past six weeks or any co-morbid medical condition that could influence immune system in all the subjects (patient/control).

plays important immuno-modulatory role in the outcome of pregnancy. It is noteworthy that HLA-G expression also influences cytokine production as well as polarization during pregnancy [18–21]. The crucial role of HLA-G in influencing Th1/Th2 balance has been reported in physiological and various pathological conditions. HLA-G favouring Th2 dominance during normal pregnancy and promoting Th1 response in preeclampsia was also demonstrated in some studies [19,22]. It was previously hypothesized that perturbation of HLA-G expression due to environmental adversities in early pregnancy might enhance the risk of schizophrenia in the offspring through cytokine-mediated neurodevelopmental abnormality [23]. In our recent studies, we have shown association of soluble HLA-G (sHLA-G) and HLA-G genotypes with the core features of schizophrenia [24,25]. In addition, we have also reported the influence of IL10 genotype on sHLA-G levels and their association with the risk of schizophrenia [26]. However, the impact of functional interactions between HLA-G and pro-inflammatory cytokines on the risk of schizophrenia is currently not known. Amongst the pro-inflammatory cytokines, IL-6 plays crucial roles in the central nervous system development and function [27]. Higher expression of IL6 mRNA was found to alter fetal brain development during the early phases of pregnancy in rodents [28,29]. Data obtained from clinical studies exhibit elevated serum and cerebrospinal fluid (CSF) levels and increased mRNA expression of IL-6 in dorsolateral prefrontal cortex (DLPFC) in schizophrenia patients [30–32]. Notably, elevated plasma IL-6 levels were found to increase the risk for subsequent decline in cognitive function [33,34]. In addition to this, altered IL-6 levels and IL6 polymorphisms were found to be associated with psychopathology, severity of the illness, cognition, brain morphometry etc. in schizophrenia [4,35,36]. Taken together, a significant role of IL-6 in the immunopathogenetic risk of schizophrenia is a consistent finding; however, the impact of IL6 on schizophrenia risk in correlation to immuno-dampening HLA-G molecules has not been explored so far. To address this gap of knowledge, in this exploratory investigation, we have examined HLA-G 14 bp Insertion/ Deletion (INDEL) polymorphism and IL6 gene expression to understand whether HLA-G gene variants have any role in determining IL6 mediated risk of schizophrenia.

2.2. Genotyping From all the consenting participants, peripheral blood (10 mL) was drawn from the median cubital vein into EDTA-coated vacutainers (BD Vacutainer® tubes, Becton & Dickinson, NJ, USA) under aseptic conditions. 5 mL blood was processed for separation of plasma and leukocyte layer and the remaining 5 mL was used for separation of PBMCs. The leukocyte suspension was utilized for genomic DNA extraction. Genomic DNA was isolated by spin column method (Qiagen, Inc, Limburg, Netherlands). Genotyping of HLA-G 14 bp INDEL (located in Chr6: 29798582) was done by PCR amplification (Applied Biosystems VeritiTM) in 154 Schizophrenia patients and 170 healthy controls. For PCR amplification, 1 µL of genomic DNA (100 ng) was added to a 30 µL reaction mix containing 18 µL of Applied Biosystems True Allele PCR Premix (Applied Biosystems, USA), 1µL of each primer (10 µM), and 9µL of RNase free water. The forward and reverse primers were 5′ GTGATGGGCTGTTTAAAGTGTCACC 3′; 5′ GGAAGGAATGCAGTTCAG CATGA 3′, respectively. The mixture was then initially subjected to denaturation for 12 min at 95 °C, followed by 30 cycles of denaturation for 30 s at 94 °C, annealing for 60 s at 64 °C, extension for 120 s at 72 °C, and final extension for 10 min at 72 °C. The amplified products were separated by electrophoresis on 3% agarose gel, containing ethidium bromide (0.5 µg/mL). The gel was visualized under ultraviolet illumination using Gel Documentation system (VilberLourmat, France). The genotype profile of the 14 bp INDEL polymorphism was further validated by direct sequencing using Applied Biosystems 3730xI DNA analyzer in a subset of subjects. 2.3. IL6 gene expression The gene expression profile of IL6 was examined in 56 drug naïve/ drug free schizophrenia patients and 99 healthy subjects. Peripheral blood mononuclear cells (PBMCs) were isolated using Ficoll-Paque Plus (GE Healthcare Bio-Sciences AB, Sweden), based on the principle of differential migration of cells during centrifugation. Total RNA isolation was carried out using commercial spin column method (Qiagen, Inc, Limburg, Netherlands) from the isolated PBMCs. The extracted RNA was reverse transcribed to single-stranded cDNA using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA). qPCR was performed with a commercially available TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, California) containingAmpliTaq Gold® DNA polymerase. IL-6 TaqMan probes and primers were pre-formulated and designed by the same manufacturer, with primers spanning exon boundaries to avoid non-specific amplification of gDNA due to cDNA contamination. The PCR amplification of IL-6 in each sample was normalized to ACTB endogenous control (Assay id: 4326315E). Multiplex Relative Standard Curve method [RSCM] was applied for relative gene expression quantification. Five points of twofold dilution series was used as the standard curve in every plate. qPCR was performed on StepOnePlus™ Real-Time PCR Systems (Applied Biosystems, Foster City, California) in a 96-well format. Reactions were performed in a final volume of 10 μL containing, TaqMan Universal PCR Master Mix, probes (final concentration of 250 nM) and primers for IL-6 (final concentration of 900 nM) and ACTB (final concentration of 150 nM) as well as 1μL of RT reaction. The assay for every sample was run in quadruples, including the standards, and no-template control. Standard PCR conditions of 2 min at 50 °C, 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C was followed.

2. Materials and methods 2.1. Subjects A total of 154 schizophrenia (DSM-IV) patients (age range: 18–45 years) attending the clinical services at National Institute of Mental Health and Neurosciences (NIMHANS), Bangalore, India were recruited for the study. Amongst them, 56 patients were antipsychoticnaïve/antipsychotic-free; 43 patients were never treated, antipsychoticnaive and presenting to the hospital for the first time & 13 patients were antipsychotic-free and without receiving any treatment for at least 3 months. This study was approved by the Institutional ethics committee. Patients and healthy volunteers were explained about the study in their language and a written informed consent was obtained. The diagnosis was established using the Mini International Neuropsychiatric Interview Plus [37], which was confirmed independently by a qualified psychiatrist. The patients were assessed for their demographic and clinical characteristics (history of presenting illness as well as any other medical illness, family & personal history as well as antipsychoticnaïve/antipsychotic-free status) with reliable information as ascertained by a first-degree relative. The Scale for Assessment of Positive Symptoms (SAPS) [38] and the Scale for Assessment of Negative Symptoms (SANS) [39] Likert-type scales were used to assess the clinical symptoms of patients. Healthy controls (N = 170) were recruited purely on voluntary basis and were screened using MINI plus to rule out any psychiatric diagnosis. A comprehensive mental status examination was done. None of the controls had family history of psychiatric disorder in 2

Cytokine xxx (xxxx) xxx–xxx

V. Shivakumar et al.

r = 0.11; p = .43; SANS total score: r = −0.04; p = .76). The impact of correlation between HLA-G 14 bp INDEL polymorphism and IL6 gene expression was also examined in the patients as well as controls. It was observed that Del/Del carrying schizophrenia patients had significantly lower level of IL-6 gene expression (t = 3.1; p = .004) than the Ins/Ins and Ins/Del genotypes carriers (p > .05) (Fig. 2).

Table 1 Sociodemographic and clinical profile of study subjects. Characteristic

Patients (N = 56) [Mean ± SD]

Controls (N = 99) [Mean ± SD]

Statistics

P

Age in years Sex [M:F] Age at Onset (in years) Duration of Illness (in years) SANS SAPS

32.6 ± 6.6 33:23 28.6 ± 6.9 2.9 ± 4.1 31.9 ± 28.9 27.7 ± 12.7

26.1 ± 4.5 68:30 – – – –

7.28a 1.73b

< .05 > .05

5. Discussion

The statistical analyses were performed using the Statistical Package for Social Sciences (version-11) [SPSS Inc.,]. The following statistical tests were used: student’s t-test (two-tailed), chi-square test and Pearson’s correlation. The significance was set at p < .05 (two-tailed).

Dysregulated immune system is critically implicated in both risk for and progression of schizophrenia [14,40]. Importantly, chronic lowgrade inflammation both in the periphery and central nervous system elicited by altered levels of various pro-inflammatory cytokines like IL6, IL-1β, TNF-α, etc has been shown to contribute predominantly to the pathogenesis of schizophrenia [41–43]. Though the production of certain cytokines is influenced by HLA-G molecules, the importance of HLA-G with respect to cytokine abnormality has so far not been investigated in schizophrenia [44,45]. The objective of the study was to explore the correlation between genetic variation within HLA-G locus and IL6 gene expression in schizophrenia.

4. Results

5.1. IL6 gene expression in schizophrenia

The demographic and clinical characteristics of the study group have been summarized in Table 1. The groups were matched with respect to sex, however patients as a group were older than controls (p < .05); since, there was no significant correlation between age and IL-6 gene expression either in patients or in controls, age was not used as a covariate in further analyses. The data of HLA-G 14 bp INDEL polymorphism were taken from our previous study (not shown here) [24], where we had shown a strong association of Ins/Ins genotype and Ins allele of 14 bp INDEL of HLA-G with schizophrenia risk. On analyzing the gene expression of IL6 in the PBMCs, we found that there was a significant difference between the patient and control groups; a mean value of 1.43 ± 1.76 Relative Units (RU) was noted in patients and 2.62 ± 3.35 RU in controls (t = 3.8, p = .004) (Fig. 1). There was no significant correlation between IL-6 gene expression and illness variables (Illness duration: r = −0.01; p = .57; SAPS total score:

We observed a significantly reduced mRNA level of IL6 gene in drug-naïve schizophrenia patients than the healthy controls. This is in contradiction with a previous study, which demonstrated significantly higher leukocyte mRNA level of IL-6 in 24 patients with first episode psychosis, of which ten patients had a diagnosis of schizophrenia-like disorder [46]. Further, a post-mortem brain study has also shown elevated gene expression of IL-6 in the DLPFC of 20 schizophrenia patients [30]. Over the past few years, converging evidence based on immunological, genetic, gene expression and imaging studies have suggested significant implications of IL-6 in schizophrenia. Elevated serum levels of IL-6 were reported by multiple studies, including a metaanalysis [43,47]. In a meta-analysis, IL-6 is proposed to be a state-related marker of schizophrenia; increased level of IL-6 observed during acute exacerbations (acutely relapsed in-patients or first-episode psychosis) was normalized with antipsychotic treatment [42].

a b

Independent Samples t-Test [t]. Chi-Square test [χ2].

3. Statistical analysis

Fig. 1. The group differences in IL6 gene expression between patients and healthy controls. Gene expression is expressed as relative units (RU).

3

Cytokine xxx (xxxx) xxx–xxx

V. Shivakumar et al.

Fig. 2. The impact of HLA-G 14 bp INDEL polymorphism on IL6 gene expression. Gene expression is expressed as relative units (RU).

Interestingly, findings on the CSF levels of IL-6 in schizophrenia patients were found to be inconsistent [48–50], with a recent meta-analysis reporting no significant difference in the CSF IL6 levels between schizophrenia and control subjects [42]. In addition to this, the genetic association studies of IL6 variants in schizophrenia have provided conflicting results. Positive association between IL6 polymorphism and schizophrenia was reported in certain populations [6,51], however, such association could not be replicated in other populations [35,52,53]. Importantly, in Indian Bengalee population IL6 gene variation was not found to be associated with schizophrenia risk [41]. It is also interesting to note that a previous study on Indian schizophrenia patients has shown significantly lower serum levels of IL-6 [54]. Although the decreased mRNA level observed in the present study contradicts some of the previous findings, however, it lends further support to the other Indian studies. Further systematic evaluation is warranted to understand the reasons for such variation.

G on cytokine production. In the present study, schizophrenia patients carrying the “high-expressor” HLA-G 14 bp Del/Del genotype was shown to have a significantly lower IL6 gene expression. This finding suggests that enhanced production of HLA-G in Del/Del carrying schizophrenia patients could exert its anti-inflammatory effects by dampening the expression of IL-6, however, the precise underlying mechanism is yet to be ascertained. In an interesting study, [61] HLA-G was proposed to modulate tolerogenic attributes of dendritic cells through IL-6-STAT3 pathway. In this exploratory study, though a possible interaction between anti-inflammatory HLA-G and pro-inflammatory IL-6 in schizophrenia is suggested, the lack of data on the underlying mechanism has been the major limitation. 6. Conclusion The evidence of chronic low grade inflammation in schizophrenia has been provided by multiple animal as well as human studies. Inflammation is a complex process, mediated by co-ordinated actions of many cytokines. IL-6 plays pivotal role in driving the inflammatory responses. In the present study, reduced expression of IL6 gene was observed, implying diminished inflammation in this subset of schizophrenia patients. The anti-inflammatory properties of HLA-G have been demonstrated in various conditions. However, the functional interactions between HLA-G and IL-6 are not adequately known. Given the anti-inflammatory attributes of HLA-G, it seems likely that increased expression of HLA-G might have immuno-dampening effect on IL-6. Del/Del genotype of 14 bp INDEL of HLA-G is the “high expressor” genotype; schizophrenia patients carrying this genotype shown reduced expression of IL6 gene. This suggests that Del/Del genotype could provide protective effects to schizophrenia. The immuno-dampening attributes of HLA-G observed in schizophrenia patients could become an area of interest in the therapeutic management of schizophrenia.

5.2. Potential interactions between HLA-G and IL-6 in schizophrenia HLA-G molecules are increasingly being shown to be associated with various neuropsychiatric disorders. For example, “low expressor” (HLA-G 14 bp Ins/Ins) genotype was found to be less prevalent in bipolar patients born during winter season, indicating that 14 bp Ins/Ins may act as a protective genotype for bipolar disorder [55]. However, in a recent study, we demonstrated that the Ins/Ins genotype of 14 bp INDEL was found to confer a strong risk for schizophrenia [24]. Further, the frequencies of 14 bp Ins/Ins genotype and 14 bp Ins allele were found to be significantly higher in children with autistic spectrum disorders as well as their mothers [56]. HLA-G 14 bp INDEL is a functionally relevant genetic polymorphism which affects the production of HLA-G molecules. The presence of one of two 14 bp Del alleles (14 bp Del/Del and 14 bp Del/Ins genotypes) influence the higher production while 14 bp Ins/Ins is associated with lower production of HLA-G [57,58]. As demonstrated by in vitro studies, HLA-G (both soluble and membrane-bound) can modulate cytokine release by different cells [19,59]. The decidual mononuclear cells and PBMCs were found to release reduced amount of IFN-γ and TNF-α when they were co-cultured with HLA-G expressing cells [59]. However, in another co-culture experiment recombinant sHLA-G construct caused increased production of IFN-γ and TNF-α by uterine lymphocytes [45]. In addition, HLA-G homodimer was shown to induce secretion of IL-6, IL-8, and TNF-α from decidual macrophages and NK cells [60]. Although these findings provide conflicting views about the role of HLA-G on cytokine expression, they do emphasize the determining role of HLA-

Acknowledgement This study is supported by National Institute of Mental Health & Neurosciences intra-mural Research Grant (NIMHANS/001/103/2013/ 00234) to MD and Wellcome Trust/DBT India Alliance Senior Fellowship Research Grant to GV (500236/Z/11/Z). V.S. is supported by Department of Health Research, Young Scientist in Newer Research Areas: DHR/HRD/Young Scientist/Type-VI (2)/2015. AR is supported 4

Cytokine xxx (xxxx) xxx–xxx

V. Shivakumar et al.

by DST-INSPIRE fellowship. SVK and ACA are supported by the Wellcome Trust/DBT India Alliance. DV and MS are supported by UGC Fellowship.

effects of cytokines and decidualization, Human Reprod. 23 (1) (2008) 144–152. [19] T. Kanai, T. Fujii, N. Unno, T. Yamashita, H. Hyodo, A. Miki, Y. Hamai, S. Kozuma, Y. Taketani, Human leukocyte antigen-G-expressing cells differently modulate the release of cytokines from mononuclear cells present in the decidua versus peripheral blood, Am. J. Reprod. Immunol. 45 (2) (2001) 94–99. [20] P. Moreau, F. Adrian-Cabestre, C. Menier, V. Guiard, L. Gourand, J. Dausset, E.D. Carosella, P. Paul, IL-10 selectively induces HLA-G expression in human trophoblasts and monocytes, Int. Immunol. 11 (5) (1999) 803–811. [21] Y. Yang, D.E. Geraghty, J.S. Hunt, Cytokine regulation of HLA-G expression in human trophoblast cell lines, J. Reprod. Immunol. 29 (3) (1995) 179–195. [22] J.R. Wilczynski, Th1/Th2 cytokines balance–yin and yang of reproductive immunology, Eur. J. Obstet. Gynecol. Reprod. Biol. 122 (2) (2005) 136–143. [23] M. Debnath, T.K. Chaudhuri, The role of HLA-G in cytokine homeostasis during early pregnancy complicated with maternal infections: a novel etiopathological approach to the neurodevelopmental understanding of schizophrenia, Med. Hypoth. 66 (2) (2006) 286–293. [24] A. Rajasekaran, V. Shivakumar, S.V. Kalmady, J.C. Narayanaswamy, M. Subbana, D. Venugopal, A.C. Amaresha, G. Venkatasubramanian, M. Berk, M. Debnath, The impact of HLA-G 3' UTR variants and sHLA-G on risk and clinical correlates of schizophrenia, Human Immunol. 77 (12) (2016) 1166–1171. [25] A. Rajasekaran, V. Shivakumar, S.V. Kalmady, J.C. Narayanaswamy, D. Venugopal, A.C. Amaresha, G. Venkatasubramanian, M. Debnath, Soluble human leukocyte antigen (sHLA)-G levels may predict early onset of schizophrenia in male patients, Tissue Antigens 86 (1) (2015) 36–37. [26] A. Rajasekaran, V. Shivakumar, S.V. Kalmady, J.C. Narayanaswamy, M. Subbana, D. Venugopal, A.C. Amaresha, G. Venkatasubramanian, M. Debnath, The impact of IL10 polymorphisms and sHLA-G levels on the risk of schizophrenia, Asian J. Psychiat. 23 (2016) 39–43. [27] M. Erta, A. Quintana, J. Hidalgo, Interleukin-6, a major cytokine in the central nervous system, Int. J. Biol. Sci. 8 (9) (2012) 1254–1266. [28] K.A. Garbett, E.Y. Hsiao, S. Kalman, P.H. Patterson, K. Mirnics, Effects of maternal immune activation on gene expression patterns in the fetal brain, Transl. Psychiat. 2 (2012) e98. [29] S.E. Smith, J. Li, K. Garbett, K. Mirnics, P.H. Patterson, Maternal immune activation alters fetal brain development through interleukin-6, J. Neurosci.: the official journal of the Society for Neuroscience 27 (40) (2007) 10695–10702. [30] S.G. Fillman, N. Cloonan, V.S. Catts, L.C. Miller, J. Wong, T. McCrossin, M. Cairns, C.S. Weickert, Increased inflammatory markers identified in the dorsolateral prefrontal cortex of individuals with schizophrenia, Molecul. Psychiat. 18 (2) (2013) 206–214. [31] L. Schwieler, M.K. Larsson, E. Skogh, M.E. Kegel, F. Orhan, S. Abdelmoaty, A. Finn, M. Bhat, M. Samuelsson, K. Lundberg, M.L. Dahl, C. Sellgren, I. Schuppe-Koistinen, C. Svensson, S. Erhardt, G. Engberg, Increased levels of IL-6 in the cerebrospinal fluid of patients with chronic schizophrenia–significance for activation of the kynurenine pathway, J. Psychiat. Neurosci.: JPN 40 (2) (2015) 126–133. [32] X.Y. Zhang, D.F. Zhou, P.Y. Zhang, G.Y. Wu, L.Y. Cao, Y.C. Shen, Elevated interleukin-2, interleukin-6 and interleukin-8 serum levels in neuroleptic-free schizophrenia: association with psychopathology, Schizophrenia Res. 57 (2–3) (2002) 247–258. [33] A. Economos, C.B. Wright, Y.P. Moon, T. Rundek, L. Rabbani, M.C. Paik, R.L. Sacco, M.S. Elkind, Interleukin 6 plasma concentration associates with cognitive decline: the northern Manhattan study, Neuroepidemiology 40 (4) (2013) 253–259. [34] J.D. Weaver, M.H. Huang, M. Albert, T. Harris, J.W. Rowe, T.E. Seeman, Interleukin-6 and risk of cognitive decline: MacArthur studies of successful aging, Neurology 59 (3) (2002) 371–378. [35] D. Frydecka, B. Misiak, E. Pawlak-Adamska, L. Karabon, A. Tomkiewicz, P. Sedlaczek, A. Kiejna, J.A. Beszlej, Interleukin-6: the missing element of the neurocognitive deterioration in schizophrenia? The focus on genetic underpinnings, cognitive impairment and clinical manifestation, Eur. Arch. Psychiat. Clin. Neurosci. 265 (6) (2015) 449–459. [36] A. Stojanovic, L. Martorell, I. Montalvo, L. Ortega, R. Monseny, E. Vilella, J. Labad, Increased serum interleukin-6 levels in early stages of psychosis: associations with at-risk mental states and the severity of psychotic symptoms, Psychoneuroendocrinology 41 (2014) 23–32. [37] D.V. Sheehan, Y. Lecrubier, K.H. Sheehan, P. Amorim, J. Janavs, E. Weiller, T. Hergueta, R. Baker, G.C. Dunbar, The Mini-International Neuropsychiatric Interview (M.I.N.I.): the development and validation of a structured diagnostic psychiatric interview for DSM-IV and ICD-10, J. Clin. Psychiat. 59(Suppl 20) (1998) 22–33;quiz 34–57. [38] N. Andreasen, The Scale for the Assessment of Positive Symptoms, SAPS, The University of Iowa, Iowa City, IA, 1984. [39] N. Andreasen, The Scale for the Assessment of Negative Symptoms, SAPS, The University of Iowa, Iowa City, IA, 1983. [40] G. Venkatasubramanian, M. Debnath, The TRIPS (Toll-like receptors in immunoinflammatory pathogenesis) Hypothesis: a novel postulate to understand schizophrenia, Prog. Neuro-psychopharm. Biol. Psychiat. 44 (2013) 301–311. [41] M. Debnath, G. Venkatasubramanian, Recent advances in psychoneuroimmunology relevant to schizophrenia therapeutics, Curr. Opin. Psychiat. 26 (5) (2013) 433–439. [42] B.J. Miller, P. Buckley, W. Seabolt, A. Mellor, B. Kirkpatrick, Meta-analysis of cytokine alterations in schizophrenia: clinical status and antipsychotic effects, Biol. Psychiat. 70 (7) (2011) 663–671. [43] S. Potvin, E. Stip, A.A. Sepehry, A. Gendron, R. Bah, E. Kouassi, Inflammatory cytokine alterations in schizophrenia: a systematic quantitative review, Biol. Psychiat. 63 (8) (2008) 801–808. [44] T. Kanai, T. Fujii, S. Kozuma, T. Yamashita, A. Miki, A. Kikuchi, Y. Taketani, Soluble

Conflict of interest The authors declare that they have no conflicts of interest to disclose. References [1] S.M. Purcell, N.R. Wray, J.L. Stone, P.M. Visscher, M.C. O'Donovan, P.F. Sullivan, P. Sklar, Common polygenic variation contributes to risk of schizophrenia and bipolar disorder, Nature 460 (7256) (2009) 748–752. [2] Ripke, et al., Biological insights from 108 schizophrenia-associated genetic loci, Nature 511 (7510) (2014) 421–427. [3] J. van Os, B.P. Rutten, R. Poulton, Gene-environment interactions in schizophrenia: review of epidemiological findings and future directions, Schizophrenia Bullet. 34 (6) (2008) 1066–1082. [4] S.V. Kalmady, G. Venkatasubramanian, V. Shivakumar, S. Gautham, A. Subramaniam, D.A. Jose, A. Maitra, V. Ravi, B.N. Gangadhar, Relationship between Interleukin-6 gene polymorphism and hippocampal volume in antipsychoticnaive schizophrenia: evidence for differential susceptibility? PloS one 9 (5) (2014) e96021. [5] M. Debnath, D.M. Cannon, G. Venkatasubramanian, Variation in the major histocompatibility complex [MHC] gene family in schizophrenia: associations and functional implications, Prog. Neuro-psychopharm. & Biol. Psychiat. 42 (2013) 49–62. [6] M. Paul-Samojedny, A. Owczarek, M. Kowalczyk, R. Suchanek, M. Palacz, K. Kucia, A. Fila-Danilow, P. Borkowska, J. Kowalski, Association of interleukin 2 (IL-2), interleukin 6 (IL-6), and TNF-alpha (TNFalpha) gene polymorphisms with paranoid schizophrenia in a Polish population, J. Neuropsychiat. Clin. Neurosci. 25 (1) (2013) 72–82. [7] H. Stefansson, R.A. Ophoff, S. Steinberg, O.A. Andreassen, S. Cichon, D. Rujescu, T. Werge, O.P. Pietilainen, O. Mors, P.B. Mortensen, E. Sigurdsson, O. Gustafsson, M. Nyegaard, A. Tuulio-Henriksson, A. Ingason, T. Hansen, J. Suvisaari, J. Lonnqvist, T. Paunio, A.D. Borglum, A. Hartmann, A. Fink-Jensen, M. Nordentoft, D. Hougaard, B. Norgaard-Pedersen, Y. Bottcher, J. Olesen, R. Breuer, H.J. Moller, I. Giegling, H.B. Rasmussen, S. Timm, M. Mattheisen, I. Bitter, J.M. Rethelyi, B.B. Magnusdottir, T. Sigmundsson, P. Olason, G. Masson, J.R. Gulcher, M. Haraldsson, R. Fossdal, T.E. Thorgeirsson, U. Thorsteinsdottir, M. Ruggeri, S. Tosato, B. Franke, E. Strengman, L.A. Kiemeney, I. Melle, S. Djurovic, L. Abramova, V. Kaleda, J. Sanjuan, R. de Frutos, E. Bramon, E. Vassos, G. Fraser, U. Ettinger, M. Picchioni, N. Walker, T. Toulopoulou, A.C. Need, D. Ge, J.L. Yoon, K.V. Shianna, N.B. Freimer, R.M. Cantor, R. Murray, A. Kong, V. Golimbet, A. Carracedo, C. Arango, J. Costas, E.G. Jonsson, L. Terenius, I. Agartz, H. Petursson, M.M. Nothen, M. Rietschel, P.M. Matthews, P. Muglia, L. Peltonen, D. St Clair, D.B. Goldstein, K. Stefansson, D.A. Collier, Common variants conferring risk of schizophrenia, Nature 460 (7256) (2009) 744–747. [8] A. Sekar, A.R. Bialas, H. de Rivera, A. Davis, T.R. Hammond, N. Kamitaki, K. Tooley, J. Presumey, M. Baum, V. Van Doren, G. Genovese, S.A. Rose, R.E. Handsaker, M.J. Daly, M.C. Carroll, B. Stevens, S.A. McCarroll, Schizophrenia risk from complex variation of complement component 4, Nature 530 (7589) (2016) 177–183. [9] B.E. Deverman, P.H. Patterson, Cytokines and CNS development, Neuron 64 (1) (2009) 61–78. [10] P.A. Garay, A.K. McAllister, Novel roles for immune molecules in neural development: implications for neurodevelopmental disorders, Front. Synaptic Neurosci. 2 (2010) 136. [11] G.S. Huh, L.M. Boulanger, H. Du, P.A. Riquelme, T.M. Brotz, C.J. Shatz, Functional requirement for class I MHC in CNS development and plasticity, Science 290 (5499) (2000) 2155–2159. [12] N. Escande-Beillard, L. Washburn, D. Zekzer, Z.P. Wu, S. Eitan, S. Ivkovic, Y. Lu, H. Dang, B. Middleton, T.V. Bilousova, Y. Yoshimura, C.J. Evans, S. Joyce, J. Tian, D.L. Kaufman, Neurons preferentially respond to self-MHC class I allele products regardless of peptide presented, J. Immunol. 184 (2) (2010) 816–823. [13] Z.P. Wu, L. Washburn, T.V. Bilousova, M. Boudzinskaia, N. Escande-Beillard, J. Querubin, H. Dang, C.W. Xie, J. Tian, D.L. Kaufman, Enhanced neuronal expression of major histocompatibility complex class I leads to aberrations in neurodevelopment and neurorepair, J. Neuroimmunol. 232 (1–2) (2011) 8–16. [14] M. Debnath, M. Berk, Th17 pathway-mediated immunopathogenesis of schizophrenia: mechanisms and implications, Schizophrenia Bullet. 40 (6) (2014) 1412–1421. [15] M. Debnath, G. Venkatasubramanian, M. Berk, Fetal programming of schizophrenia: select mechanisms, Neurosci. Biobehav. Rev. 49 (2015) 90–104. [16] E.D. Carosella, P. Moreau, J. Lemaoult, N. Rouas-Freiss, HLA-G: from biology to clinical benefits, Trends Immunol. 29 (3) (2008) 125–132. [17] J.S. Hunt, M.G. Petroff, R.H. McIntire, C. Ober, HLA-G and immune tolerance in pregnancy, FASEB J.: Official Publication of the Federation of American Societies for Experimental Biology 19 (7) (2005) 681–693. [18] O. Blanco, I. Tirado, R. Munoz-Fernandez, A.C. Abadia-Molina, J.M. GarciaPacheco, J. Pena, E.G. Olivares, Human decidual stromal cells express HLA-G:

5

Cytokine xxx (xxxx) xxx–xxx

V. Shivakumar et al.

[45]

[46]

[47]

[48]

[49]

[50]

[51]

[52]

[53]

HLA-G influences the release of cytokines from allogeneic peripheral blood mononuclear cells in culture, Molecul. Human Reprod. 7 (2) (2001) 195–200. A. van der Meer, H.G. Lukassen, B. van Cranenbroek, E.H. Weiss, D.D. Braat, M.J. van Lierop, I. Joosten, Soluble HLA-G promotes Th1-type cytokine production by cytokine-activated uterine and peripheral natural killer cells, Molecul. Human Reprod. 13 (2) (2007) 123–133. M. Di Nicola, A. Cattaneo, N. Hepgul, M. Di Forti, K.J. Aitchison, L. Janiri, R.M. Murray, P. Dazzan, C.M. Pariante, V. Mondelli, Serum and gene expression profile of cytokines in first-episode psychosis, Brain Behav. Immun. 31 (2013) 90–95. S.O. Nunes, T. Matsuo, M.S. Kaminami, M.A. Watanabe, E.M. Reiche, E.N. Itano, An autoimmune or an inflammatory process in patients with schizophrenia, schizoaffective disorder, and in their biological relatives, Schizophrenia Res. 84 (1) (2006) 180–182. V. Barak, Y. Barak, J. Levine, B. Nisman, I. Roisman, Changes in interleukin-1 beta and soluble interleukin-2 receptor levels in CSF and serum of schizophrenic patients, J. Basic Clin. Physiol. Pharm. 6 (1) (1995) 61–69. D.L. Garver, R.L. Tamas, J.A. Holcomb, Elevated interleukin-6 in the cerebrospinal fluid of a previously delineated schizophrenia subtype, Neuropsychopharmacology: official publication of the American College of, Neuropsychopharmacology 28 (8) (2003) 1515–1520. D. Sasayama, K. Hattori, C. Wakabayashi, T. Teraishi, H. Hori, M. Ota, S. Yoshida, K. Arima, T. Higuchi, N. Amano, H. Kunugi, Increased cerebrospinal fluid interleukin-6 levels in patients with schizophrenia and those with major depressive disorder, J. Psychiat. Res. 47 (3) (2013) 401–406. R. Zakharyan, M. Petrek, A. Arakelyan, F. Mrazek, S. Atshemyan, A. Boyajyan, Interleukin-6 promoter polymorphism and plasma levels in patients with schizophrenia, Tissue Antigens 80 (2) (2012) 136–142. P. Kapelski, M. Skibinska, M. Maciukiewicz, J. Pawlak, A. Permoda-Osip, J. Twarowska-Hauser, Family-based association study of interleukin 6 (IL6) and its receptor (IL6R) functional polymorphisms in schizophrenia in the Polish population, J. Neuroimmunol. 285 (2015) 62–67. Y.L. Liu, C.M. Liu, C.S. Fann, W.C. Yang, Y.H. Chen, L.J. Tseng, S.K. Liu, M.H. Hsieh,

[54]

[55]

[56]

[57]

[58]

[59]

[60]

[61]

6

T.J. Hwang, H.Y. Chan, J.J. Chen, W.J. Chen, H.G. Hwu, Genetic variants of IL-6 and its receptor are not associated with schizophrenia in Taiwan, Neurosci. Lett. 468 (3) (2010) 330–333. B. Singh, N.K. Bera, C.R. Nayak, T.K. Chaudhuri, Decreased serum levels of interleukin-2 and interleukin-6 in Indian Bengalee schizophrenic patients, Cytokine 47 (1) (2009) 1–5. M. Debnath, M. Busson, S. Jamain, B. Etain, N. Hamdani, J. Oliveira, W. Boukouaci, K. Amokrane, H. Moins-Teisserenc, M. Lajnef, D. Bengoufa, A. Malafosse, F. Bellivier, C. Henry, J.P. Kahn, R. Krishnamoorthy, D. Charron, M. Leboyer, R. Tamouza, The HLA-G low expressor genotype is associated with protection against bipolar disorder, Human Immunol. 74 (5) (2013) 593–597. F.R. Guerini, E. Bolognesi, M. Chiappedi, A. Ghezzo, M.P. Canevini, M.M. Mensi, A. Vignoli, C. Agliardi, M. Zanette, M. Clerici, An HLA-G(*)14bp insertion/deletion polymorphism associates with the development of autistic spectrum disorders, Brain Behav. Immun. 44 (2015) 207–212. X.Y. Chen, W.H. Yan, A. Lin, H.H. Xu, J.G. Zhang, X.X. Wang, The 14 bp deletion polymorphisms in HLA-G gene play an important role in the expression of soluble HLA-G in plasma, Tissue Antigens 72 (4) (2008) 335–341. J. Di Cristofaro, D. El Moujally, A. Agnel, S. Mazieres, M. Cortey, A. Basire, J. Chiaroni, C. Picard, HLA-G haplotype structure shows good conservation between different populations and good correlation with high, normal and low soluble HLAG expression, Human Immunol. 74 (2) (2013) 203–206. T. Kanai, T. Fujii, S. Kozuma, A. Miki, T. Yamashita, H. Hyodo, N. Unno, S. Yoshida, Y. Taketani, A subclass of soluble HLA-G1 modulates the release of cytokines from mononuclear cells present in the decidua additively to membrane-bound HLA-G1, J. Reprod. Immunol. 60 (2) (2003) 85–96. C. Li, B.L. Houser, M.L. Nicotra, J.L. Strominger, HLA-G homodimer-induced cytokine secretion through HLA-G receptors on human decidual macrophages and natural killer cells, Proc. Nat. Acad. Sci. USA 106 (14) (2009) 5767–5772. S. Liang, V. Ristich, H. Arase, J. Dausset, E.D. Carosella, A. Horuzsko, Modulation of dendritic cell differentiation by HLA-G and ILT4 requires the IL-6–STAT3 signaling pathway, PNAS 105 (24) (2008) 8357–8362.